Incidental Mutation 'R0655:Matn2'
ID62514
Institutional Source Beutler Lab
Gene Symbol Matn2
Ensembl Gene ENSMUSG00000022324
Gene Namematrilin 2
SynonymsCrtm2
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0655 (G1)
Quality Score141
Status Not validated
Chromosome15
Chromosomal Location34306677-34436273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34345200 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 118 (S118P)
Ref Sequence ENSEMBL: ENSMUSP00000128202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022947] [ENSMUST00000163455] [ENSMUST00000179647] [ENSMUST00000226766] [ENSMUST00000227759] [ENSMUST00000227772] [ENSMUST00000228570]
Predicted Effect probably benign
Transcript: ENSMUST00000022947
AA Change: S118P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000022947
Gene: ENSMUSG00000022324
AA Change: S118P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 55 237 1.99e-49 SMART
EGF 241 278 6.86e-4 SMART
EGF 282 319 5.49e-3 SMART
EGF 323 360 7.88e-4 SMART
EGF 364 401 6.76e-3 SMART
EGF 405 442 4.39e-2 SMART
EGF 446 483 9.41e-2 SMART
EGF 487 524 1.24e-1 SMART
EGF 528 565 2.23e-3 SMART
EGF 569 606 8.44e-4 SMART
EGF 610 647 9.55e-3 SMART
VWA 653 831 1.14e-49 SMART
Matrilin_ccoil 889 935 4.78e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163455
AA Change: S118P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128202
Gene: ENSMUSG00000022324
AA Change: S118P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 55 237 1.99e-49 SMART
EGF 241 278 6.86e-4 SMART
EGF 282 319 5.49e-3 SMART
EGF 323 360 7.88e-4 SMART
EGF 364 401 6.76e-3 SMART
EGF 405 442 4.39e-2 SMART
EGF 446 483 9.41e-2 SMART
EGF 487 524 1.24e-1 SMART
EGF 528 565 2.23e-3 SMART
EGF 569 606 8.44e-4 SMART
EGF 610 647 9.55e-3 SMART
VWA 653 831 1.14e-49 SMART
Matrilin_ccoil 908 955 7.77e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179647
Predicted Effect probably benign
Transcript: ENSMUST00000226766
AA Change: S118P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000227759
AA Change: S118P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000227772
Predicted Effect probably benign
Transcript: ENSMUST00000228570
AA Change: S118P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains five von Willebrand factor A domains. The specific function of this gene has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Matn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Matn2 APN 15 34428470 missense probably damaging 1.00
IGL00392:Matn2 APN 15 34402856 missense probably benign 0.00
IGL01475:Matn2 APN 15 34316525 missense possibly damaging 0.94
IGL02223:Matn2 APN 15 34423718 missense probably benign 0.00
IGL02252:Matn2 APN 15 34316590 missense probably damaging 0.98
IGL02288:Matn2 APN 15 34422386 missense probably damaging 1.00
IGL02738:Matn2 APN 15 34388739 missense probably benign 0.07
IGL02927:Matn2 APN 15 34355655 missense probably damaging 1.00
IGL03331:Matn2 APN 15 34345357 missense probably damaging 1.00
Engorged UTSW 15 34426234 missense probably damaging 1.00
PIT4260001:Matn2 UTSW 15 34428731 missense possibly damaging 0.78
R0124:Matn2 UTSW 15 34426151 splice site probably benign
R0422:Matn2 UTSW 15 34435771 splice site probably null
R0449:Matn2 UTSW 15 34428541 missense probably damaging 1.00
R0606:Matn2 UTSW 15 34345150 missense probably damaging 1.00
R0885:Matn2 UTSW 15 34316605 missense possibly damaging 0.67
R1384:Matn2 UTSW 15 34409810 missense probably benign 0.00
R1603:Matn2 UTSW 15 34388768 missense probably damaging 1.00
R1667:Matn2 UTSW 15 34378732 missense probably damaging 0.99
R1720:Matn2 UTSW 15 34345274 nonsense probably null
R1772:Matn2 UTSW 15 34428785 missense probably damaging 0.99
R2037:Matn2 UTSW 15 34433117 missense probably benign 0.00
R2107:Matn2 UTSW 15 34423759 missense probably damaging 1.00
R2240:Matn2 UTSW 15 34433063 missense probably damaging 1.00
R3933:Matn2 UTSW 15 34345420 splice site probably null
R3963:Matn2 UTSW 15 34388791 nonsense probably null
R4648:Matn2 UTSW 15 34428533 missense probably damaging 1.00
R4695:Matn2 UTSW 15 34402925 missense probably damaging 1.00
R4817:Matn2 UTSW 15 34423799 missense probably damaging 1.00
R4935:Matn2 UTSW 15 34428685 missense probably damaging 1.00
R5105:Matn2 UTSW 15 34355668 missense possibly damaging 0.95
R5177:Matn2 UTSW 15 34433514 missense possibly damaging 0.58
R5717:Matn2 UTSW 15 34399091 nonsense probably null
R5760:Matn2 UTSW 15 34355607 missense possibly damaging 0.46
R5776:Matn2 UTSW 15 34431619 missense probably damaging 1.00
R5842:Matn2 UTSW 15 34399056 missense probably damaging 0.99
R5917:Matn2 UTSW 15 34409766 nonsense probably null
R5964:Matn2 UTSW 15 34410165 missense probably damaging 1.00
R6265:Matn2 UTSW 15 34399155 missense probably damaging 1.00
R6272:Matn2 UTSW 15 34355607 missense possibly damaging 0.46
R6332:Matn2 UTSW 15 34423755 missense probably benign 0.00
R6457:Matn2 UTSW 15 34426234 missense probably damaging 1.00
R7351:Matn2 UTSW 15 34345336 missense probably damaging 0.97
R7660:Matn2 UTSW 15 34402946 missense probably benign 0.00
R7660:Matn2 UTSW 15 34423728 nonsense probably null
R7775:Matn2 UTSW 15 34399077 missense possibly damaging 0.94
R7778:Matn2 UTSW 15 34399077 missense possibly damaging 0.94
R8007:Matn2 UTSW 15 34426169 missense probably benign 0.01
R8059:Matn2 UTSW 15 34345335 missense probably damaging 1.00
R8174:Matn2 UTSW 15 34422409 missense probably benign 0.30
R8331:Matn2 UTSW 15 34428681 missense probably damaging 1.00
R8354:Matn2 UTSW 15 34378697 missense probably damaging 0.98
R8377:Matn2 UTSW 15 34345365 missense probably damaging 1.00
R8393:Matn2 UTSW 15 34355602 missense possibly damaging 0.92
R8532:Matn2 UTSW 15 34316553 missense probably benign 0.42
R8555:Matn2 UTSW 15 34423805 missense probably benign 0.03
R8756:Matn2 UTSW 15 34423730 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTTCATCATTGACAGCTCCCGAAG -3'
(R):5'- AAAGATCAGGATGCCTGTGTTCCG -3'

Sequencing Primer
(F):5'- GTGTCAACACCTATGACTATGC -3'
(R):5'- CCTTGGCAGCTACCTCAG -3'
Posted On2013-07-30