Mutagenetix > Incidental Mutation

Incidental Mutation 'R0655:Tmc1'

62531

Institutional Source

Beutler Lab

Gene Symbol

Tmc1

Ensembl Gene

ENSMUSG00000024749

Gene Name

transmembrane channel-like gene family 1

Synonyms

4933416G09Rik, Beethoven, Bth

MMRRC Submission

038840-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.291) question?

Stock #

R0655 (G1)

Quality Score

194

Status

Not validated

Chromosome

Chromosomal Location

20783458-20954202 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20799176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 606 (M606I)

Ref Sequence

ENSEMBL: ENSMUSP00000040859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039500]

AlphaFold

Q8R4P5

Predicted Effect

probably damaging
Transcript: ENSMUST00000039500
AA Change: M606I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: M606I

Domain	Start	End	E-Value	Type
SCOP:d1eq1a_	2	95	3e-3	SMART
low complexity region	129	150	N/A	INTRINSIC
transmembrane domain	184	206	N/A	INTRINSIC
transmembrane domain	265	287	N/A	INTRINSIC
low complexity region	295	302	N/A	INTRINSIC
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	431	453	N/A	INTRINSIC
Pfam:TMC	512	627	2.6e-36	PFAM
transmembrane domain	632	654	N/A	INTRINSIC
transmembrane domain	693	715	N/A	INTRINSIC
low complexity region	738	754	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf1	G	C	17: 35,957,845	I757M	probably benign	Het
Atg16l1	T	A	1: 87,766,829	I76N	probably damaging	Het
Baz1b	T	A	5: 135,242,430	I1289N	probably benign	Het
Bcl2l15	T	A	3: 103,832,969		probably null	Het
Btbd11	A	G	10: 85,645,526	T931A	probably damaging	Het
Cbl	G	T	9: 44,158,752	T566K	probably damaging	Het
Cbwd1	T	C	19: 24,953,320	M122V	possibly damaging	Het
Cd96	T	C	16: 46,099,119	K180E	probably benign	Het
Cpxm2	G	A	7: 132,054,820	T571I	possibly damaging	Het
Cyp2a12	A	T	7: 27,036,621	Y485F	probably benign	Het
Cyp4f17	T	A	17: 32,524,897	Y350N	possibly damaging	Het
Dstn	T	A	2: 143,938,422	I14N	probably damaging	Het
Eea1	A	G	10: 95,995,598	S184G	probably benign	Het
Eif1a	G	T	18: 46,608,063	G122C	probably damaging	Het
Esf1	T	A	2: 140,148,879	T562S	probably benign	Het
Fem1c	G	A	18: 46,505,160	R592C	probably benign	Het
Fig4	T	C	10: 41,285,677	N30S	probably damaging	Het
Gria2	C	A	3: 80,732,070	E212*	probably null	Het
Gsdmc2	C	T	15: 63,827,773	A269T	probably benign	Het
Herc4	T	C	10: 63,273,571	V195A	probably benign	Het
Hivep1	T	C	13: 42,167,585	S2123P	probably damaging	Het
Hspa4	T	C	11: 53,269,692	E519G	probably benign	Het
Htr2b	A	G	1: 86,110,843	S14P	probably benign	Het
Ifit1	T	C	19: 34,647,647	V61A	probably damaging	Het
Ifitm1	C	A	7: 140,969,536	F77L	probably benign	Het
Matn2	T	C	15: 34,345,200	S118P	probably benign	Het
Mtmr3	C	A	11: 4,488,610	D615Y	probably damaging	Het
Mtss1	C	A	15: 59,081,502	C9F	probably damaging	Het
Muc5b	A	T	7: 141,863,942	I3542F	probably benign	Het
Nwd2	T	C	5: 63,791,585	S167P	possibly damaging	Het
Olfr394	T	C	11: 73,887,805	D189G	possibly damaging	Het
Olfr694	A	T	7: 106,689,425	F102Y	probably damaging	Het
Olfr921	C	T	9: 38,775,554	Q100*	probably null	Het
Oscp1	T	C	4: 126,058,733	L18P	probably damaging	Het
Pax5	A	G	4: 44,537,462	S297P	probably damaging	Het
Phldb3	A	T	7: 24,624,372	D476V	probably benign	Het
Phlpp2	A	T	8: 109,895,587	I154L	probably benign	Het
Prx	T	A	7: 27,517,421	V449E	probably damaging	Het
Psd3	A	G	8: 67,963,689	S519P	probably benign	Het
Rnf138	T	G	18: 21,010,783	V128G	probably benign	Het
Safb	T	A	17: 56,597,803	S209T	probably benign	Het
Sbno1	C	A	5: 124,376,149	V1327L	possibly damaging	Het
Scarb1	A	G	5: 125,300,440	V176A	probably damaging	Het
Scd4	A	G	19: 44,338,968	H161R	possibly damaging	Het
Selenoo	T	A	15: 89,095,655	H335Q	probably damaging	Het
Slfn8	A	G	11: 83,003,821	F664S	probably benign	Het
Spef2	T	C	15: 9,626,131	I1116M	possibly damaging	Het
Taf2	G	A	15: 55,038,294	R835W	probably damaging	Het
Tdrd9	A	G	12: 112,040,465	E921G	probably damaging	Het
Tectb	G	A	19: 55,189,870	G234S	possibly damaging	Het
Tmed10	T	A	12: 85,343,517	I88F	probably damaging	Het
Tnfrsf11a	G	A	1: 105,808,155	V31I	unknown	Het
Trp53inp2	G	T	2: 155,386,168	G98*	probably null	Het
Tssc4	A	G	7: 143,070,045	D30G	probably damaging	Het
Uaca	T	C	9: 60,872,029	Y1233H	probably benign	Het
Unc13c	G	A	9: 73,930,953	T872I	probably damaging	Het
Unc80	A	G	1: 66,503,781	H398R	probably damaging	Het
Vmn1r64	G	A	7: 5,884,208	T112I	probably benign	Het
Vmn1r85	A	G	7: 13,084,723	Y165H	probably damaging	Het
Vmn2r72	A	T	7: 85,738,111	C748*	probably null	Het
Wdr17	A	G	8: 54,649,198	W929R	probably damaging	Het
Yeats2	A	T	16: 20,193,824	K591*	probably null	Het
Zbtb9	T	A	17: 26,974,100	S160T	probably damaging	Het
Znfx1	T	A	2: 167,056,907	R32S	probably damaging	Het

Other mutations in Tmc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Tmc1	APN	19	20816192	missense	probably damaging	1.00
IGL02104:Tmc1	APN	19	20832454	missense	probably benign	0.00
IGL02245:Tmc1	APN	19	20799192	missense	probably damaging	1.00
IGL02544:Tmc1	APN	19	20906963	missense	probably benign	0.04
IGL02699:Tmc1	APN	19	20832350	critical splice donor site	probably null
IGL02974:Tmc1	APN	19	20900844	missense	probably benign
IGL03194:Tmc1	APN	19	20804653	missense	probably damaging	1.00
dinner_bell	UTSW	19	20795516	missense	probably damaging	0.99
R0255:Tmc1	UTSW	19	20789587	missense	possibly damaging	0.93
R0381:Tmc1	UTSW	19	20799045	missense	probably damaging	1.00
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1496:Tmc1	UTSW	19	20868355	missense	probably damaging	1.00
R1542:Tmc1	UTSW	19	20816122	missense	probably damaging	1.00
R1773:Tmc1	UTSW	19	20826501	splice site	probably null
R1777:Tmc1	UTSW	19	20816109	critical splice donor site	probably null
R2067:Tmc1	UTSW	19	20824309	missense	possibly damaging	0.90
R2152:Tmc1	UTSW	19	20856675	missense	probably benign	0.01
R2180:Tmc1	UTSW	19	20824084	missense	probably damaging	0.96
R2204:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2205:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2285:Tmc1	UTSW	19	20789799	missense	probably damaging	0.96
R4505:Tmc1	UTSW	19	20868374	missense	probably benign	0.00
R4752:Tmc1	UTSW	19	20826649	missense	probably benign	0.35
R4975:Tmc1	UTSW	19	20906955	missense	probably damaging	0.96
R5040:Tmc1	UTSW	19	20824030	missense	possibly damaging	0.68
R5206:Tmc1	UTSW	19	20826660	missense	probably damaging	1.00
R5400:Tmc1	UTSW	19	20804602	missense	probably damaging	1.00
R5429:Tmc1	UTSW	19	20789622	missense	possibly damaging	0.72
R6200:Tmc1	UTSW	19	20789590	missense	possibly damaging	0.53
R6784:Tmc1	UTSW	19	20827651	critical splice donor site	probably null
R6796:Tmc1	UTSW	19	20799036	missense	probably damaging	1.00
R6808:Tmc1	UTSW	19	20795516	missense	probably damaging	0.99
R6812:Tmc1	UTSW	19	20900861	missense	probably damaging	1.00
R6834:Tmc1	UTSW	19	20795610	nonsense	probably null
R6978:Tmc1	UTSW	19	20804635	missense	probably damaging	1.00
R6986:Tmc1	UTSW	19	20824283	missense	probably benign	0.02
R7027:Tmc1	UTSW	19	20940903	critical splice donor site	probably null
R7378:Tmc1	UTSW	19	20868389	missense	probably damaging	0.98
R7520:Tmc1	UTSW	19	20799178	missense	probably damaging	0.99
R7573:Tmc1	UTSW	19	20907008	missense	probably damaging	0.98
R7825:Tmc1	UTSW	19	20804645	missense	possibly damaging	0.55
R8024:Tmc1	UTSW	19	20900817	missense	probably damaging	1.00
R8073:Tmc1	UTSW	19	20868361	missense	probably benign	0.08
R8786:Tmc1	UTSW	19	20826589	missense	probably damaging	1.00
R8791:Tmc1	UTSW	19	20789845	missense	probably benign	0.00
R8969:Tmc1	UTSW	19	20816229	missense	probably damaging	1.00
R8973:Tmc1	UTSW	19	20900851	missense	probably benign
R9429:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R9493:Tmc1	UTSW	19	20824280	missense	probably benign	0.00
Z1176:Tmc1	UTSW	19	20826506	missense	probably null	1.00
Z1177:Tmc1	UTSW	19	20795608	missense	possibly damaging	0.47
Z1177:Tmc1	UTSW	19	20823982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCCACAATCAAAAGATGGCGG -3'
(R):5'- ACAGGATGCAAGCCCTTAAAGGTC -3'

Sequencing Primer
(F):5'- GGAGGGAGACGATCATGTACAG -3'
(R):5'- CAAGCCCTTAAAGGTCTGTCATTTG -3'

Posted On

2013-07-30