Incidental Mutation 'R0656:Olfr1294'
ID62537
Institutional Source Beutler Lab
Gene Symbol Olfr1294
Ensembl Gene ENSMUSG00000109547
Gene Nameolfactory receptor 1294
SynonymsGA_x6K02T2Q125-72589785-72588847, MOR248-7
MMRRC Submission 038841-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R0656 (G1)
Quality Score117
Status Validated
Chromosome2
Chromosomal Location111536530-111540291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111537627 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 221 (I221V)
Ref Sequence ENSEMBL: ENSMUSP00000146438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208334] [ENSMUST00000208675] [ENSMUST00000215245]
Predicted Effect probably damaging
Transcript: ENSMUST00000099614
AA Change: I221V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097209
Gene: ENSMUSG00000094000
AA Change: I221V

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.7e-51 PFAM
Pfam:7tm_1 41 287 2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208334
AA Change: I221V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000208675
AA Change: I221V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000215245
Meta Mutation Damage Score 0.2690 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T A 10: 70,868,800 noncoding transcript Het
4931409K22Rik C T 5: 24,549,762 V337M possibly damaging Het
Alox5 A G 6: 116,423,330 probably benign Het
Anxa11 T A 14: 25,873,997 D203E probably damaging Het
Atp12a A T 14: 56,374,481 N371Y probably damaging Het
Bloc1s6 A G 2: 122,742,623 I39M probably benign Het
Celsr3 A C 9: 108,834,655 I1688L possibly damaging Het
Cgn T C 3: 94,774,894 probably benign Het
Chd4 A T 6: 125,102,967 I453F probably damaging Het
Dbnl A G 11: 5,797,321 T247A probably benign Het
Dpysl3 T C 18: 43,438,071 E46G possibly damaging Het
Dsg1a T C 18: 20,335,892 probably benign Het
Fbp1 C T 13: 62,871,285 E150K probably benign Het
Flnb T A 14: 7,927,352 L1854Q probably damaging Het
Gcn1l1 C T 5: 115,589,303 T714M probably benign Het
Gm12216 A T 11: 53,813,336 probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Hmbs T A 9: 44,337,360 H256L probably benign Het
Ibsp A T 5: 104,310,020 probably null Het
Ints13 A G 6: 146,552,461 V240A probably benign Het
Kalrn T C 16: 34,032,467 D343G probably damaging Het
Kin T C 2: 10,085,720 probably benign Het
Klhdc1 T C 12: 69,258,030 V192A probably benign Het
Lpar3 T A 3: 146,240,671 C35S possibly damaging Het
Lrrtm4 A G 6: 80,021,970 I122V possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mgat4c T C 10: 102,388,591 M222T probably damaging Het
Muc4 C A 16: 32,751,670 S516Y possibly damaging Het
Myo1e A T 9: 70,367,674 Q703L probably damaging Het
Neb A G 2: 52,225,558 probably benign Het
Necab3 T G 2: 154,546,303 E239A probably null Het
Npr1 G T 3: 90,461,369 N461K probably benign Het
Pcdhb2 A G 18: 37,295,490 Y172C probably damaging Het
Pcdhb7 A G 18: 37,341,901 D30G probably benign Het
Phf12 A C 11: 78,029,332 Q898P probably benign Het
Plekhn1 T C 4: 156,225,364 E132G possibly damaging Het
Ptpn3 A G 4: 57,270,075 V29A probably benign Het
Rundc3b T A 5: 8,569,529 I143F probably damaging Het
Ryr3 T G 2: 112,648,306 probably benign Het
Sash1 A G 10: 8,751,137 probably null Het
Slc4a2 A G 5: 24,431,259 D201G probably benign Het
Tecpr1 T A 5: 144,214,053 probably null Het
Timm21 T C 18: 84,949,201 H150R probably damaging Het
Tmem79 T C 3: 88,332,934 T236A probably damaging Het
Usp34 G T 11: 23,472,967 V3095F probably damaging Het
Vmn1r8 A T 6: 57,036,588 Q208L probably benign Het
Other mutations in Olfr1294
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Olfr1294 APN 2 111538014 missense probably damaging 1.00
IGL02304:Olfr1294 APN 2 111537401 missense probably benign 0.06
IGL02555:Olfr1294 APN 2 111537917 missense probably damaging 0.98
R0422:Olfr1294 UTSW 2 111537983 missense probably damaging 0.97
R0647:Olfr1294 UTSW 2 111537359 missense probably benign 0.00
R1543:Olfr1294 UTSW 2 111537797 missense probably benign 0.00
R1909:Olfr1294 UTSW 2 111538014 missense probably damaging 1.00
R3735:Olfr1294 UTSW 2 111537896 missense probably damaging 1.00
R4671:Olfr1294 UTSW 2 111537935 missense probably damaging 1.00
R4703:Olfr1294 UTSW 2 111537768 missense probably benign 0.03
R4809:Olfr1294 UTSW 2 111537611 missense probably benign 0.15
R4822:Olfr1294 UTSW 2 111537452 missense probably damaging 0.98
R4837:Olfr1294 UTSW 2 111537974 missense probably damaging 0.98
R4880:Olfr1294 UTSW 2 111537353 nonsense probably null
R5203:Olfr1294 UTSW 2 111537636 missense probably damaging 1.00
R5871:Olfr1294 UTSW 2 111537639 missense probably damaging 1.00
R5902:Olfr1294 UTSW 2 111537394 missense probably benign 0.00
R6501:Olfr1294 UTSW 2 111537779 missense probably damaging 1.00
R7354:Olfr1294 UTSW 2 111537564 missense possibly damaging 0.94
R7575:Olfr1294 UTSW 2 111538252 missense probably damaging 1.00
R7623:Olfr1294 UTSW 2 111537936 missense probably damaging 1.00
R7632:Olfr1294 UTSW 2 111538176 missense possibly damaging 0.87
Z1088:Olfr1294 UTSW 2 111537814 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGACCCAGAAAGTTGCCTATGAACC -3'
(R):5'- TGACATGTGGCTCTCCACAAACAC -3'

Sequencing Primer
(F):5'- TGAACCTTTTCATAGCATTTTTCATC -3'
(R):5'- CCTTAAGAGATGCAGCAGTTTG -3'
Posted On2013-07-30