Incidental Mutation 'R0656:Cgn'
ID 62542
Institutional Source Beutler Lab
Gene Symbol Cgn
Ensembl Gene ENSMUSG00000068876
Gene Name cingulin
Synonyms 6330408J11Rik
MMRRC Submission 038841-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0656 (G1)
Quality Score 97
Status Validated
Chromosome 3
Chromosomal Location 94760069-94786492 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 94774894 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107272] [ENSMUST00000107273] [ENSMUST00000153263] [ENSMUST00000155485]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000107272
SMART Domains Protein: ENSMUSP00000102893
Gene: ENSMUSG00000068876

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
internal_repeat_1 214 229 8.06e-5 PROSPERO
low complexity region 242 260 N/A INTRINSIC
internal_repeat_1 287 302 8.06e-5 PROSPERO
low complexity region 446 462 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
low complexity region 536 549 N/A INTRINSIC
low complexity region 567 592 N/A INTRINSIC
low complexity region 660 676 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
Pfam:Myosin_tail_1 783 1140 3.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107273
SMART Domains Protein: ENSMUSP00000102894
Gene: ENSMUSG00000068876

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
internal_repeat_1 214 229 8.83e-5 PROSPERO
low complexity region 242 260 N/A INTRINSIC
internal_repeat_1 287 302 8.83e-5 PROSPERO
low complexity region 454 470 N/A INTRINSIC
low complexity region 474 489 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 575 600 N/A INTRINSIC
low complexity region 668 684 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
Pfam:Myosin_tail_1 799 1144 2.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153263
SMART Domains Protein: ENSMUSP00000143156
Gene: ENSMUSG00000068876

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
coiled coil region 337 402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155485
SMART Domains Protein: ENSMUSP00000142809
Gene: ENSMUSG00000068876

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
coiled coil region 381 447 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (92/94)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to the ulcerogenic action of cysteamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T A 10: 70,868,800 noncoding transcript Het
4931409K22Rik C T 5: 24,549,762 V337M possibly damaging Het
Alox5 A G 6: 116,423,330 probably benign Het
Anxa11 T A 14: 25,873,997 D203E probably damaging Het
Atp12a A T 14: 56,374,481 N371Y probably damaging Het
Bloc1s6 A G 2: 122,742,623 I39M probably benign Het
Celsr3 A C 9: 108,834,655 I1688L possibly damaging Het
Chd4 A T 6: 125,102,967 I453F probably damaging Het
Dbnl A G 11: 5,797,321 T247A probably benign Het
Dpysl3 T C 18: 43,438,071 E46G possibly damaging Het
Dsg1a T C 18: 20,335,892 probably benign Het
Fbp1 C T 13: 62,871,285 E150K probably benign Het
Flnb T A 14: 7,927,352 L1854Q probably damaging Het
Gcn1l1 C T 5: 115,589,303 T714M probably benign Het
Gm12216 A T 11: 53,813,336 probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Hmbs T A 9: 44,337,360 H256L probably benign Het
Ibsp A T 5: 104,310,020 probably null Het
Ints13 A G 6: 146,552,461 V240A probably benign Het
Kalrn T C 16: 34,032,467 D343G probably damaging Het
Kin T C 2: 10,085,720 probably benign Het
Klhdc1 T C 12: 69,258,030 V192A probably benign Het
Lpar3 T A 3: 146,240,671 C35S possibly damaging Het
Lrrtm4 A G 6: 80,021,970 I122V possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mgat4c T C 10: 102,388,591 M222T probably damaging Het
Muc4 C A 16: 32,751,670 S516Y possibly damaging Het
Myo1e A T 9: 70,367,674 Q703L probably damaging Het
Neb A G 2: 52,225,558 probably benign Het
Necab3 T G 2: 154,546,303 E239A probably null Het
Npr1 G T 3: 90,461,369 N461K probably benign Het
Olfr1294 T C 2: 111,537,627 I221V probably damaging Het
Pcdhb2 A G 18: 37,295,490 Y172C probably damaging Het
Pcdhb7 A G 18: 37,341,901 D30G probably benign Het
Phf12 A C 11: 78,029,332 Q898P probably benign Het
Plekhn1 T C 4: 156,225,364 E132G possibly damaging Het
Ptpn3 A G 4: 57,270,075 V29A probably benign Het
Rundc3b T A 5: 8,569,529 I143F probably damaging Het
Ryr3 T G 2: 112,648,306 probably benign Het
Sash1 A G 10: 8,751,137 probably null Het
Slc4a2 A G 5: 24,431,259 D201G probably benign Het
Tecpr1 T A 5: 144,214,053 probably null Het
Timm21 T C 18: 84,949,201 H150R probably damaging Het
Tmem79 T C 3: 88,332,934 T236A probably damaging Het
Usp34 G T 11: 23,472,967 V3095F probably damaging Het
Vmn1r8 A T 6: 57,036,588 Q208L probably benign Het
Other mutations in Cgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Cgn APN 3 94765548 missense probably benign 0.00
IGL00823:Cgn APN 3 94767209 missense probably damaging 1.00
IGL01349:Cgn APN 3 94767176 nonsense probably null
IGL01433:Cgn APN 3 94779459 missense probably damaging 0.99
IGL01467:Cgn APN 3 94779588 missense probably damaging 1.00
IGL01781:Cgn APN 3 94773205 missense probably benign
IGL01789:Cgn APN 3 94776218 missense possibly damaging 0.63
IGL01879:Cgn APN 3 94774364 nonsense probably null
IGL02805:Cgn APN 3 94774377 missense probably damaging 0.96
IGL02814:Cgn APN 3 94774240 missense probably benign 0.00
IGL02926:Cgn APN 3 94778016 missense probably benign 0.01
IGL03113:Cgn APN 3 94779234 missense probably benign
IGL03340:Cgn APN 3 94778095 intron probably benign
R0054:Cgn UTSW 3 94762592 missense possibly damaging 0.95
R0310:Cgn UTSW 3 94765653 missense possibly damaging 0.88
R0355:Cgn UTSW 3 94774932 missense probably benign
R0615:Cgn UTSW 3 94770714 unclassified probably benign
R1491:Cgn UTSW 3 94763228 missense probably damaging 1.00
R1509:Cgn UTSW 3 94774258 missense probably benign 0.00
R1794:Cgn UTSW 3 94762557 critical splice donor site probably null
R2113:Cgn UTSW 3 94779806 missense probably damaging 1.00
R3121:Cgn UTSW 3 94778482 splice site probably benign
R4655:Cgn UTSW 3 94779249 nonsense probably null
R4703:Cgn UTSW 3 94776095 utr 3 prime probably benign
R4714:Cgn UTSW 3 94779438 missense probably damaging 1.00
R4715:Cgn UTSW 3 94779438 missense probably damaging 1.00
R4959:Cgn UTSW 3 94778254 missense probably benign 0.06
R4973:Cgn UTSW 3 94778254 missense probably benign 0.06
R4995:Cgn UTSW 3 94779936 missense probably damaging 1.00
R5011:Cgn UTSW 3 94776145 missense probably null 1.00
R5329:Cgn UTSW 3 94779990 start codon destroyed probably null 0.02
R5524:Cgn UTSW 3 94779989 start codon destroyed probably null 0.56
R5695:Cgn UTSW 3 94773635 missense probably benign 0.00
R5839:Cgn UTSW 3 94774393 missense probably damaging 0.99
R5987:Cgn UTSW 3 94779522 missense probably benign 0.00
R6146:Cgn UTSW 3 94767125 missense possibly damaging 0.94
R6311:Cgn UTSW 3 94778176 intron probably benign
R6948:Cgn UTSW 3 94773221 missense probably benign 0.06
R7038:Cgn UTSW 3 94763085 missense possibly damaging 0.80
R7231:Cgn UTSW 3 94773192 missense probably damaging 0.99
R7251:Cgn UTSW 3 94776199 missense possibly damaging 0.82
R7408:Cgn UTSW 3 94763055 nonsense probably null
R7828:Cgn UTSW 3 94769179 missense probably damaging 0.97
R7882:Cgn UTSW 3 94762634 missense probably damaging 1.00
R7975:Cgn UTSW 3 94764529 missense probably benign 0.03
R8082:Cgn UTSW 3 94763061 missense probably benign 0.21
R8090:Cgn UTSW 3 94779953 missense probably damaging 1.00
R8128:Cgn UTSW 3 94769381 missense probably benign 0.06
R8275:Cgn UTSW 3 94774953 missense possibly damaging 0.52
R8774:Cgn UTSW 3 94773500 missense probably damaging 1.00
R8774-TAIL:Cgn UTSW 3 94773500 missense probably damaging 1.00
R9036:Cgn UTSW 3 94767241 missense possibly damaging 0.90
R9060:Cgn UTSW 3 94779855 missense probably damaging 1.00
R9434:Cgn UTSW 3 94765530 missense probably damaging 0.99
R9616:Cgn UTSW 3 94763025 missense probably damaging 0.97
R9720:Cgn UTSW 3 94779311 missense probably benign 0.10
Z1176:Cgn UTSW 3 94774273 missense possibly damaging 0.81
Z1176:Cgn UTSW 3 94774346 missense probably damaging 1.00
Z1176:Cgn UTSW 3 94776178 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGCCAGAATGGACAACTTAGCCAAG -3'
(R):5'- GCGGTAGATGTGTAACTGCCTGAC -3'

Sequencing Primer
(F):5'- TCTAAGCTGCCCATAGAATAAAGG -3'
(R):5'- GTGTAACTGCCTGACACAGTATC -3'
Posted On 2013-07-30