Incidental Mutation 'R0656:Myo1e'
ID62548
Institutional Source Beutler Lab
Gene Symbol Myo1e
Ensembl Gene ENSMUSG00000032220
Gene Namemyosin IE
Synonyms2310020N23Rik, 9130023P14Rik
MMRRC Submission 038841-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0656 (G1)
Quality Score88
Status Validated
Chromosome9
Chromosomal Location70207350-70399766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70367674 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 703 (Q703L)
Ref Sequence ENSEMBL: ENSMUSP00000034745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]
PDB Structure
MYOSIN 1E SH3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034745
AA Change: Q703L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: Q703L

DomainStartEndE-ValueType
MYSc 13 693 N/A SMART
Pfam:Myosin_TH1 719 917 1e-55 PFAM
SH3 1053 1107 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214042
Meta Mutation Damage Score 0.8215 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T A 10: 70,868,800 noncoding transcript Het
4931409K22Rik C T 5: 24,549,762 V337M possibly damaging Het
Alox5 A G 6: 116,423,330 probably benign Het
Anxa11 T A 14: 25,873,997 D203E probably damaging Het
Atp12a A T 14: 56,374,481 N371Y probably damaging Het
Bloc1s6 A G 2: 122,742,623 I39M probably benign Het
Celsr3 A C 9: 108,834,655 I1688L possibly damaging Het
Cgn T C 3: 94,774,894 probably benign Het
Chd4 A T 6: 125,102,967 I453F probably damaging Het
Dbnl A G 11: 5,797,321 T247A probably benign Het
Dpysl3 T C 18: 43,438,071 E46G possibly damaging Het
Dsg1a T C 18: 20,335,892 probably benign Het
Fbp1 C T 13: 62,871,285 E150K probably benign Het
Flnb T A 14: 7,927,352 L1854Q probably damaging Het
Gcn1l1 C T 5: 115,589,303 T714M probably benign Het
Gm12216 A T 11: 53,813,336 probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Hmbs T A 9: 44,337,360 H256L probably benign Het
Ibsp A T 5: 104,310,020 probably null Het
Ints13 A G 6: 146,552,461 V240A probably benign Het
Kalrn T C 16: 34,032,467 D343G probably damaging Het
Kin T C 2: 10,085,720 probably benign Het
Klhdc1 T C 12: 69,258,030 V192A probably benign Het
Lpar3 T A 3: 146,240,671 C35S possibly damaging Het
Lrrtm4 A G 6: 80,021,970 I122V possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mgat4c T C 10: 102,388,591 M222T probably damaging Het
Muc4 C A 16: 32,751,670 S516Y possibly damaging Het
Neb A G 2: 52,225,558 probably benign Het
Necab3 T G 2: 154,546,303 E239A probably null Het
Npr1 G T 3: 90,461,369 N461K probably benign Het
Olfr1294 T C 2: 111,537,627 I221V probably damaging Het
Pcdhb2 A G 18: 37,295,490 Y172C probably damaging Het
Pcdhb7 A G 18: 37,341,901 D30G probably benign Het
Phf12 A C 11: 78,029,332 Q898P probably benign Het
Plekhn1 T C 4: 156,225,364 E132G possibly damaging Het
Ptpn3 A G 4: 57,270,075 V29A probably benign Het
Rundc3b T A 5: 8,569,529 I143F probably damaging Het
Ryr3 T G 2: 112,648,306 probably benign Het
Sash1 A G 10: 8,751,137 probably null Het
Slc4a2 A G 5: 24,431,259 D201G probably benign Het
Tecpr1 T A 5: 144,214,053 probably null Het
Timm21 T C 18: 84,949,201 H150R probably damaging Het
Tmem79 T C 3: 88,332,934 T236A probably damaging Het
Usp34 G T 11: 23,472,967 V3095F probably damaging Het
Vmn1r8 A T 6: 57,036,588 Q208L probably benign Het
Other mutations in Myo1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Myo1e APN 9 70342148 missense probably benign 0.01
IGL00833:Myo1e APN 9 70338778 missense probably damaging 0.99
IGL00973:Myo1e APN 9 70338787 missense probably damaging 1.00
IGL01011:Myo1e APN 9 70316589 splice site probably benign
IGL01401:Myo1e APN 9 70327166 missense probably damaging 0.97
IGL01402:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01404:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01613:Myo1e APN 9 70341273 splice site probably benign
IGL01738:Myo1e APN 9 70359370 missense probably damaging 1.00
IGL01819:Myo1e APN 9 70343040 splice site probably benign
IGL02233:Myo1e APN 9 70383799 splice site probably benign
IGL02244:Myo1e APN 9 70367689 missense probably benign 0.00
IGL02440:Myo1e APN 9 70346740 missense probably damaging 1.00
IGL02806:Myo1e APN 9 70362270 missense probably benign 0.01
IGL02886:Myo1e APN 9 70368773 missense probably benign 0.00
IGL03178:Myo1e APN 9 70286949 missense possibly damaging 0.47
I2288:Myo1e UTSW 9 70342097 missense possibly damaging 0.80
R0036:Myo1e UTSW 9 70341308 missense probably damaging 1.00
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0399:Myo1e UTSW 9 70301793 splice site probably benign
R0526:Myo1e UTSW 9 70322398 missense probably damaging 1.00
R0599:Myo1e UTSW 9 70376660 splice site probably benign
R1078:Myo1e UTSW 9 70383999 missense probably benign
R1278:Myo1e UTSW 9 70398785 missense probably damaging 1.00
R1300:Myo1e UTSW 9 70301783 missense probably damaging 1.00
R1329:Myo1e UTSW 9 70338738 missense possibly damaging 0.96
R1349:Myo1e UTSW 9 70287069 splice site probably benign
R1463:Myo1e UTSW 9 70338756 missense possibly damaging 0.88
R1656:Myo1e UTSW 9 70395934 missense probably damaging 1.00
R1727:Myo1e UTSW 9 70376524 missense possibly damaging 0.88
R1789:Myo1e UTSW 9 70338784 missense probably damaging 1.00
R1970:Myo1e UTSW 9 70368773 missense probably benign 0.00
R2029:Myo1e UTSW 9 70368687 missense possibly damaging 0.78
R2029:Myo1e UTSW 9 70378715 splice site probably benign
R2039:Myo1e UTSW 9 70320133 missense possibly damaging 0.89
R2076:Myo1e UTSW 9 70383877 missense probably benign
R2256:Myo1e UTSW 9 70378373 splice site probably null
R2257:Myo1e UTSW 9 70378373 splice site probably null
R2323:Myo1e UTSW 9 70378758 nonsense probably null
R2443:Myo1e UTSW 9 70327172 missense probably benign
R4023:Myo1e UTSW 9 70324875 missense probably benign
R4024:Myo1e UTSW 9 70324875 missense probably benign
R4025:Myo1e UTSW 9 70324875 missense probably benign
R4026:Myo1e UTSW 9 70324875 missense probably benign
R4151:Myo1e UTSW 9 70297351 nonsense probably null
R4764:Myo1e UTSW 9 70343135 splice site probably null
R4768:Myo1e UTSW 9 70370469 missense possibly damaging 0.63
R4911:Myo1e UTSW 9 70343096 missense probably benign
R4995:Myo1e UTSW 9 70353272 missense probably benign 0.01
R4999:Myo1e UTSW 9 70353312 missense probably damaging 1.00
R5228:Myo1e UTSW 9 70322358 splice site probably null
R5414:Myo1e UTSW 9 70322358 splice site probably null
R5577:Myo1e UTSW 9 70370471 missense probably benign 0.31
R5851:Myo1e UTSW 9 70383804 missense probably benign 0.17
R6208:Myo1e UTSW 9 70376605 missense probably damaging 0.99
R6907:Myo1e UTSW 9 70327155 missense probably benign
R7084:Myo1e UTSW 9 70337801 missense probably damaging 0.96
R7313:Myo1e UTSW 9 70359385 critical splice donor site probably null
R7383:Myo1e UTSW 9 70297295 missense probably damaging 1.00
R7811:Myo1e UTSW 9 70327262 missense probably damaging 0.96
R7962:Myo1e UTSW 9 70335219 missense possibly damaging 0.64
R8309:Myo1e UTSW 9 70346763 missense possibly damaging 0.90
R8510:Myo1e UTSW 9 70335265 missense probably damaging 1.00
R8513:Myo1e UTSW 9 70320088 missense probably damaging 1.00
X0021:Myo1e UTSW 9 70378273 missense probably damaging 0.99
X0065:Myo1e UTSW 9 70378294 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCACTGAGCCTCCTTGGAAGAAC -3'
(R):5'- CACATTGATTCTCAAGCTTTGTCCACTG -3'

Sequencing Primer
(F):5'- agctcacaactatccttaactctac -3'
(R):5'- ctgagcctgatgacccac -3'
Posted On2013-07-30