Incidental Mutation 'R0656:Mgat4c'
ID62551
Institutional Source Beutler Lab
Gene Symbol Mgat4c
Ensembl Gene ENSMUSG00000019888
Gene NameMGAT4 family, member C
Synonyms9130411I17Rik
MMRRC Submission 038841-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0656 (G1)
Quality Score149
Status Validated
Chromosome10
Chromosomal Location101681487-102391469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102388591 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 222 (M222T)
Ref Sequence ENSEMBL: ENSMUSP00000135959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020039] [ENSMUST00000120748] [ENSMUST00000127504] [ENSMUST00000138522] [ENSMUST00000156751] [ENSMUST00000163753] [ENSMUST00000179929] [ENSMUST00000219195]
Predicted Effect probably damaging
Transcript: ENSMUST00000020039
AA Change: M222T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020039
Gene: ENSMUSG00000019888
AA Change: M222T

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120748
AA Change: M222T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114010
Gene: ENSMUSG00000019888
AA Change: M222T

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127504
SMART Domains Protein: ENSMUSP00000117148
Gene: ENSMUSG00000019888

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138522
SMART Domains Protein: ENSMUSP00000118056
Gene: ENSMUSG00000019888

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
Pfam:Glyco_transf_54 43 150 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156751
SMART Domains Protein: ENSMUSP00000116216
Gene: ENSMUSG00000019888

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163753
AA Change: M222T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131551
Gene: ENSMUSG00000019888
AA Change: M222T

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179929
AA Change: M222T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135959
Gene: ENSMUSG00000019888
AA Change: M222T

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 52 330 1.1e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219195
Meta Mutation Damage Score 0.3776 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (92/94)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T A 10: 70,868,800 noncoding transcript Het
4931409K22Rik C T 5: 24,549,762 V337M possibly damaging Het
Alox5 A G 6: 116,423,330 probably benign Het
Anxa11 T A 14: 25,873,997 D203E probably damaging Het
Atp12a A T 14: 56,374,481 N371Y probably damaging Het
Bloc1s6 A G 2: 122,742,623 I39M probably benign Het
Celsr3 A C 9: 108,834,655 I1688L possibly damaging Het
Cgn T C 3: 94,774,894 probably benign Het
Chd4 A T 6: 125,102,967 I453F probably damaging Het
Dbnl A G 11: 5,797,321 T247A probably benign Het
Dpysl3 T C 18: 43,438,071 E46G possibly damaging Het
Dsg1a T C 18: 20,335,892 probably benign Het
Fbp1 C T 13: 62,871,285 E150K probably benign Het
Flnb T A 14: 7,927,352 L1854Q probably damaging Het
Gcn1l1 C T 5: 115,589,303 T714M probably benign Het
Gm12216 A T 11: 53,813,336 probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Hmbs T A 9: 44,337,360 H256L probably benign Het
Ibsp A T 5: 104,310,020 probably null Het
Ints13 A G 6: 146,552,461 V240A probably benign Het
Kalrn T C 16: 34,032,467 D343G probably damaging Het
Kin T C 2: 10,085,720 probably benign Het
Klhdc1 T C 12: 69,258,030 V192A probably benign Het
Lpar3 T A 3: 146,240,671 C35S possibly damaging Het
Lrrtm4 A G 6: 80,021,970 I122V possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Muc4 C A 16: 32,751,670 S516Y possibly damaging Het
Myo1e A T 9: 70,367,674 Q703L probably damaging Het
Neb A G 2: 52,225,558 probably benign Het
Necab3 T G 2: 154,546,303 E239A probably null Het
Npr1 G T 3: 90,461,369 N461K probably benign Het
Olfr1294 T C 2: 111,537,627 I221V probably damaging Het
Pcdhb2 A G 18: 37,295,490 Y172C probably damaging Het
Pcdhb7 A G 18: 37,341,901 D30G probably benign Het
Phf12 A C 11: 78,029,332 Q898P probably benign Het
Plekhn1 T C 4: 156,225,364 E132G possibly damaging Het
Ptpn3 A G 4: 57,270,075 V29A probably benign Het
Rundc3b T A 5: 8,569,529 I143F probably damaging Het
Ryr3 T G 2: 112,648,306 probably benign Het
Sash1 A G 10: 8,751,137 probably null Het
Slc4a2 A G 5: 24,431,259 D201G probably benign Het
Tecpr1 T A 5: 144,214,053 probably null Het
Timm21 T C 18: 84,949,201 H150R probably damaging Het
Tmem79 T C 3: 88,332,934 T236A probably damaging Het
Usp34 G T 11: 23,472,967 V3095F probably damaging Het
Vmn1r8 A T 6: 57,036,588 Q208L probably benign Het
Other mutations in Mgat4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mgat4c APN 10 102388720 missense probably damaging 1.00
IGL01293:Mgat4c APN 10 102388225 missense probably benign 0.00
IGL01394:Mgat4c APN 10 102385114 missense possibly damaging 0.62
IGL01525:Mgat4c APN 10 102378196 missense probably damaging 0.97
IGL02023:Mgat4c APN 10 102378184 nonsense probably null
IGL02150:Mgat4c APN 10 102389122 missense probably benign 0.08
IGL02296:Mgat4c APN 10 102385160 splice site probably benign
IGL02946:Mgat4c APN 10 102389253 missense probably benign 0.14
IGL03062:Mgat4c APN 10 102388461 missense probably damaging 1.00
R0001:Mgat4c UTSW 10 102388956 missense probably benign 0.01
R0326:Mgat4c UTSW 10 102388704 missense probably damaging 1.00
R0480:Mgat4c UTSW 10 102389119 missense probably damaging 0.97
R0746:Mgat4c UTSW 10 102388687 missense probably damaging 1.00
R1639:Mgat4c UTSW 10 102378281 missense probably damaging 1.00
R1989:Mgat4c UTSW 10 102378159 start codon destroyed probably null 0.66
R2148:Mgat4c UTSW 10 102388929 missense probably benign
R2437:Mgat4c UTSW 10 102388575 missense probably damaging 1.00
R2567:Mgat4c UTSW 10 102378262 missense probably benign 0.38
R3780:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3781:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3782:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3786:Mgat4c UTSW 10 102385070 missense probably damaging 1.00
R3806:Mgat4c UTSW 10 102388360 missense probably benign 0.10
R4596:Mgat4c UTSW 10 102388561 missense probably damaging 1.00
R4718:Mgat4c UTSW 10 102388606 missense probably damaging 1.00
R4740:Mgat4c UTSW 10 102388404 missense probably damaging 1.00
R4872:Mgat4c UTSW 10 102388738 missense probably damaging 1.00
R5305:Mgat4c UTSW 10 102389279 missense possibly damaging 0.82
R5740:Mgat4c UTSW 10 102389321 missense possibly damaging 0.49
R5841:Mgat4c UTSW 10 102388965 missense probably damaging 0.98
R6367:Mgat4c UTSW 10 102385154 critical splice donor site probably null
R6459:Mgat4c UTSW 10 102385127 missense probably damaging 1.00
R7021:Mgat4c UTSW 10 102388428 missense possibly damaging 0.82
R7122:Mgat4c UTSW 10 102378209 nonsense probably null
R7146:Mgat4c UTSW 10 102388496 missense probably damaging 1.00
R7629:Mgat4c UTSW 10 102389070 missense probably benign 0.03
RF020:Mgat4c UTSW 10 102389067 missense probably benign
X0020:Mgat4c UTSW 10 102388390 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGCAGACTTCAATTCATCATGGCGAG -3'
(R):5'- CAATAGCCAATCGCAGGGCATTTC -3'

Sequencing Primer
(F):5'- GCCCATCATATTATTGCAGGAAG -3'
(R):5'- CGCAGGGCATTTCTTGATAGAAC -3'
Posted On2013-07-30