Incidental Mutation 'R0657:Hmgcs2'
ID62567
Institutional Source Beutler Lab
Gene Symbol Hmgcs2
Ensembl Gene ENSMUSG00000027875
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
SynonymsmHS
MMRRC Submission 038842-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0657 (G1)
Quality Score81
Status Validated
Chromosome3
Chromosomal Location98280435-98310738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98291053 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 91 (T91A)
Ref Sequence ENSEMBL: ENSMUSP00000113296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090746] [ENSMUST00000120541]
Predicted Effect probably benign
Transcript: ENSMUST00000090746
AA Change: T91A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088249
Gene: ENSMUSG00000027875
AA Change: T91A

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 2.9e-111 PFAM
Pfam:HMG_CoA_synt_C 224 506 6.6e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120541
AA Change: T91A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113296
Gene: ENSMUSG00000027875
AA Change: T91A

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 7.2e-108 PFAM
Pfam:HMG_CoA_synt_C 224 506 1.8e-131 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196040
Meta Mutation Damage Score 0.0801 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HMG-CoA synthase family. It is a mitochondrial enzyme that catalyzes the first reaction of ketogenesis, a metabolic pathway that provides lipid-derived energy for various organs during times of carbohydrate deprivation, such as fasting. Mutations in this gene are associated with HMG-CoA synthase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Aldh7a1 C T 18: 56,537,197 probably benign Het
BC049730 T A 7: 24,713,447 D93E probably benign Het
Bfsp1 A C 2: 143,827,650 probably benign Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Chd7 T C 4: 8,753,141 V546A probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
F13a1 A T 13: 36,968,105 D237E probably damaging Het
F8 T C X: 75,211,416 Q2124R possibly damaging Het
Hivep2 T C 10: 14,131,878 S1407P probably benign Het
Huwe1 T C X: 151,919,928 I3463T probably benign Het
Iars T C 13: 49,702,519 Y289H probably damaging Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Itgb1 T G 8: 128,722,854 Y585D possibly damaging Het
Kif14 C T 1: 136,469,102 T382I probably benign Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mgat4b T C 11: 50,231,081 V143A possibly damaging Het
Mroh2a C A 1: 88,255,565 L1292I probably damaging Het
Nek8 C T 11: 78,171,207 S237N probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfatc2ip A G 7: 126,391,335 S165P probably benign Het
Olfr394 T C 11: 73,887,785 M196V probably benign Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Patj C A 4: 98,667,648 Q297K probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Ptch1 A G 13: 63,513,751 V1054A possibly damaging Het
Slc17a5 G A 9: 78,578,674 A43V probably damaging Het
Spata20 T A 11: 94,480,609 D643V probably damaging Het
Tars2 A T 3: 95,748,557 V289E probably benign Het
Tmem135 A T 7: 89,144,682 I384N probably damaging Het
Trip12 C T 1: 84,759,050 M816I probably benign Het
Ulk2 T C 11: 61,808,054 probably benign Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Hmgcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0579:Hmgcs2 UTSW 3 98290948 missense probably damaging 1.00
R0724:Hmgcs2 UTSW 3 98297001 nonsense probably null
R2024:Hmgcs2 UTSW 3 98299214 missense probably damaging 1.00
R2109:Hmgcs2 UTSW 3 98297021 nonsense probably null
R2202:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2203:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2204:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2205:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R3758:Hmgcs2 UTSW 3 98291090 missense probably damaging 1.00
R3779:Hmgcs2 UTSW 3 98299112 splice site probably benign
R3958:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3959:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3960:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3962:Hmgcs2 UTSW 3 98291038 missense possibly damaging 0.91
R4788:Hmgcs2 UTSW 3 98291084 missense probably damaging 1.00
R5102:Hmgcs2 UTSW 3 98280470 start gained probably benign
R5708:Hmgcs2 UTSW 3 98291162 missense probably damaging 1.00
R5742:Hmgcs2 UTSW 3 98297516 missense probably benign
R7268:Hmgcs2 UTSW 3 98297480 missense probably benign 0.02
R7294:Hmgcs2 UTSW 3 98290895 missense probably benign 0.09
R7503:Hmgcs2 UTSW 3 98302624 missense probably damaging 1.00
R7767:Hmgcs2 UTSW 3 98291266 missense probably damaging 1.00
R8043:Hmgcs2 UTSW 3 98291128 missense probably damaging 1.00
Z1176:Hmgcs2 UTSW 3 98290945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGAAAGTCGGACAGACTACCATAC -3'
(R):5'- GCCTTGGACTTGTCAATGATGGTCTC -3'

Sequencing Primer
(F):5'- acataccttcaaaacatactaagacg -3'
(R):5'- AATGATGGTCTCGGTGCCC -3'
Posted On2013-07-30