Incidental Mutation 'Z1177:Muc5ac'
ID 625807
Institutional Source Beutler Lab
Gene Symbol Muc5ac
Ensembl Gene ENSMUSG00000037974
Gene Name mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms MGM, 2210005L13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # Z1177 ()
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 141788972-141819231 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 141809224 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 2091 (P2091T)
Ref Sequence ENSEMBL: ENSMUSP00000122353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041924
SMART Domains Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974

signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 1.6e-14 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 6.1e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1482 2.3e-25 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1692 2.2e-27 PFAM
Pfam:Mucin2_WxxW 1765 1857 8.6e-27 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000155534
AA Change: P2091T
SMART Domains Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: P2091T

signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 9.6e-15 PFAM
VWC 395 437 3.54e-1 SMART
VWD 422 586 2.35e-33 SMART
C8 623 697 8.42e-36 SMART
Pfam:TIL 703 760 3.6e-9 PFAM
VWC 762 826 6.75e-1 SMART
VWC 864 906 4.06e-1 SMART
VWD 891 1051 1.51e-45 SMART
C8 1087 1161 2.78e-36 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1334 1367 N/A INTRINSIC
low complexity region 1372 1388 N/A INTRINSIC
Pfam:Mucin2_WxxW 1395 1483 1.3e-25 PFAM
low complexity region 1522 1533 N/A INTRINSIC
low complexity region 1537 1564 N/A INTRINSIC
low complexity region 1579 1596 N/A INTRINSIC
Pfam:Mucin2_WxxW 1605 1693 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163321
SMART Domains Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974

signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 7.9e-15 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 1.9e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1481 1.1e-23 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1691 1.1e-25 PFAM
Pfam:Mucin2_WxxW 1765 1856 6.3e-24 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock <
Total: 4376 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik C A 18: 38,254,303 H199N probably benign Het
0610010F05Rik C A 11: 23,624,960 D105Y probably benign Het
1110032F04Rik C G 3: 68,869,907 P67R probably damaging Het
1110032F04Rik G T 3: 68,870,272 V189L probably benign Het
1500011B03Rik G T 5: 114,809,287 L60I possibly damaging Het
1500011B03Rik C G 5: 114,813,872 C14S possibly damaging Het
1700007G11Rik C A 5: 98,801,834 S209Y probably damaging Het
1700011L22Rik G A 8: 79,248,296 R53W probably damaging Het
1700015F17Rik C T 5: 5,457,284 probably null Het
1700018B08Rik G T 8: 121,539,982 P36H probably benign Het
1700024G13Rik T A 14: 32,388,365 probably benign Het
1700061G19Rik AT ATT 17: 56,883,463 probably null Het
1700080E11Rik G A 9: 105,144,460 P129L possibly damaging Het
1700093K21Rik T A 11: 23,518,144 probably null Het
2010111I01Rik G T 13: 63,170,990 R537L probably damaging Het
2410089E03Rik G T 15: 8,174,972 G78V probably damaging Het
2410089E03Rik C T 15: 8,209,989 L1225F probably damaging Het
2700049A03Rik G T 12: 71,164,484 G664V probably damaging Het
2810021J22Rik C G 11: 58,880,103 S137C probably damaging Het
3425401B19Rik G T 14: 32,659,808 T1400K possibly damaging Het
3425401B19Rik G T 14: 32,661,398 P870H probably damaging Het
4833420G17Rik C A 13: 119,477,808 T484K not run Het
4921504E06Rik C A 2: 19,480,532 E441D possibly damaging Het
4921507P07Rik G T 6: 50,591,692 R86S probably benign Het
4921524L21Rik G A 18: 6,635,865 G306D probably benign Het
4921530L21Rik C A 14: 95,882,130 P108T probably benign Het
4930402H24Rik C T 2: 130,710,867 R1091K probably benign Het
4930444P10Rik T A 1: 16,082,022 probably benign Het
4930452B06Rik G A 14: 8,517,953 Q289* probably null Het
4930504O13Rik G T 11: 58,446,274 N124K probably benign Het
4930516K23Rik C A 7: 104,059,418 M61I probably damaging Het
4930578C19Rik C A X: 18,420,607 M236I probably benign Het
4931406P16Rik C G 7: 34,284,755 A148P probably damaging Het
4931409K22Rik G T 5: 24,550,795 P243H probably benign Het
4931429L15Rik G A 9: 46,305,838 S213L probably damaging Het
4932411N23Rik C A X: 126,814,533 W316C probably damaging Het
4932415D10Rik G T 10: 82,285,798 H3793N possibly damaging Het
4932415D10Rik C A 10: 82,287,126 R3350M possibly damaging Het
4932415D10Rik G T 10: 82,287,417 A3253E probably damaging Het
4932415D10Rik G A 10: 82,289,686 Q2497* probably null Het
4932438A13Rik G C 3: 36,919,950 M616I probably benign Het
4932438A13Rik G C 3: 36,983,440 M2463I possibly damaging Het
4932438A13Rik A T 3: 37,036,707 S782C Het
4933402J07Rik G C 8: 87,586,117 G177R probably damaging Het
4933402N22Rik G T 5: 11,918,127 R28M probably damaging Het
4933405L10Rik C G 8: 105,709,973 S267C possibly damaging Het
4933405L10Rik A C 8: 105,709,975 S268R possibly damaging Het
4933406M09Rik G A 1: 134,390,158 V223M probably damaging Het
4933436I01Rik G T X: 67,920,992 P87Q probably damaging Het
5031439G07Rik C G 15: 84,950,642 E372Q possibly damaging Het
5430401F13Rik T G 6: 131,552,721 L93V possibly damaging Het
5430419D17Rik G T 7: 131,265,866 V1419F unknown Het
6430628N08Rik G A 4: 115,898,259 R85H unknown Het
6720489N17Rik C A 13: 62,605,310 M67I probably benign Het
6720489N17Rik C T 13: 62,607,126 R64K probably null Het
9130204L05Rik C A 3: 91,088,356 V80L probably benign Het
9130409I23Rik C A 1: 181,055,417 P248H probably damaging Het
9130409I23Rik G A 1: 181,059,771 S307N probably benign Het
9330161L09Rik C G 12: 103,407,507 R35S unknown Het
9430007A20Rik C G 4: 144,528,500 Y163* probably null Het
9430007A20Rik C A 4: 144,528,712 S234* probably null Het
9430015G10Rik A T 4: 156,122,377 M91L probably benign Het
9530003J23Rik C A 10: 117,235,641 W111L probably benign Het
9530053A07Rik C T 7: 28,139,898 P379S probably benign Het
9630041A04Rik C A 9: 101,942,813 P144Q probably damaging Het
A1bg G T 15: 60,918,074 H442N possibly damaging Het
A2ml1 G T 6: 128,545,076 P1261H probably benign Het
A2ml1 G A 6: 128,561,616 Q614* probably null Het
A2ml1 C G 6: 128,575,607 V223L possibly damaging Het
A530016L24Rik G T 12: 112,495,076 G25W probably damaging Het
A530064D06Rik G A 17: 48,166,506 S81F probably damaging Het
Abat G T 16: 8,603,753 probably null Het
Abca1 C A 4: 53,079,584 K881N probably benign Het
Abca1 C A 4: 53,080,799 V837L probably benign Het
Abca1 C A 4: 53,086,133 D457Y possibly damaging Het
Abca12 A T 1: 71,276,082 F1893L possibly damaging Het
Abca12 C A 1: 71,282,811 D1707Y probably damaging Het
Abca12 G T 1: 71,292,531 L1287I probably damaging Het
Abca13 AGTGCCTTG AG 11: 9,314,545 probably null Het
Abca14 G T 7: 120,317,987 R1458S probably damaging Het
Abca3 CGGG CGGGG 17: 24,408,236 probably null Het
Abca4 C A 3: 122,147,786 H1634Q possibly damaging Het
Abca4 G T 3: 122,173,914 M2204I probably benign Het
Abca5 C G 11: 110,279,328 V1314L probably benign Het
Abcb11 C A 2: 69,306,529 G196V probably damaging Het
Abcb11 C A 2: 69,329,269 probably null Het
Abcb1a G T 5: 8,746,544 Q1171H probably damaging Het
Abcb1b G T 5: 8,837,596 M827I probably benign Het
Abcb4 C T 5: 8,939,906 Q820* probably null Het
Abcb6 C T 1: 75,176,125 G414D probably damaging Het
Abcc1 A C 16: 14,411,493 Q363P probably damaging Het
Abcc10 C A 17: 46,307,062 R1095L probably damaging Het
Abcc12 C A 8: 86,527,384 A924S possibly damaging Het
Abcc2 T A 19: 43,803,734 V318E probably benign Het
Abcc2 G T 19: 43,803,736 V319L probably benign Het
Abcc2 G A 19: 43,823,100 W1001* probably null Het
Abcc3 C A 11: 94,357,008 G1220W probably damaging Het
Abcc8 A T 7: 46,122,885 H823Q probably benign Het
Abcc8 C T 7: 46,154,509 A414T probably benign Het
Abcc9 T A 6: 142,594,758 Q1485L probably damaging Het
Abcc9 C A 6: 142,625,982 G1140V probably benign Het
Abcc9 T A 6: 142,645,938 Q788L probably null Het
Abce1 C A 8: 79,687,469 V538F probably benign Het
Abcg1 C G 17: 31,106,166 A322G probably benign Het
Abcg5 C A 17: 84,676,271 E113D probably benign Het
Abcg8 A T 17: 84,692,006 R178W possibly damaging Het
Abcg8 G T 17: 84,695,030 E336* probably null Het
Abcg8 C A 17: 84,696,118 P460T probably damaging Het
Abhd12 T A 2: 150,904,414 K45M probably benign Het
Abhd16a G C 17: 35,099,001 probably null Het
Abhd16a G T 17: 35,102,475 G516V probably damaging Het
Abi2 G C 1: 60,437,165 R132P probably damaging Het
Abl2 A T 1: 156,641,106 R647W probably damaging Het
Abl2 CA C 1: 156,641,553 probably null Het
Ablim2 C G 5: 35,824,043 H232D probably damaging Het
Ablim2 GATCGGTCCTA GA 5: 35,841,293 probably benign Het
Abtb2 G C 2: 103,711,196 G815R probably damaging Het
Acad12 C T 5: 121,599,194 probably null Het
Acads C A 5: 115,111,129 A351S probably benign Het
Acan C T 7: 79,094,170 P650S probably damaging Het
Acan G A 7: 79,100,137 G1552E probably damaging Het
Acan A C 7: 79,111,354 H1938P probably benign Het
Acap1 T A 11: 69,882,443 T671S probably benign Het
Acap3 G T 4: 155,905,518 G748C probably damaging Het
Acat3 G T 17: 12,934,883 Q104K probably damaging Het
Accs C G 2: 93,848,153 A19P probably benign Het
Ace C A 11: 105,988,134 L1172M probably damaging Het
Acin1 C T 14: 54,642,750 R1332Q unknown Het
Aco2 T A 15: 81,895,310 M105K probably damaging Het
Aco2 G T 15: 81,895,312 A106S probably damaging Het
Acot5 G T 12: 84,069,894 R143L probably benign Het
Acox1 C A 11: 116,175,063 Q503H probably benign Het
Acox1 G T 11: 116,175,065 Q503K probably benign Het
Acox1 C A 11: 116,183,545 E117* probably null Het
Acox2 G A 14: 8,256,852 P4S probably benign Het
Acpp G T 9: 104,314,418 P223H probably damaging Het
Acr G A 15: 89,569,879 E140K possibly damaging Het
Acsbg1 C A 9: 54,614,934 G499C probably damaging Het
Acsbg1 C G 9: 54,621,966 S321T possibly damaging Het
Acsbg2 C A 17: 56,853,898 G249W probably benign Het
Acsf3 G T 8: 122,779,964 probably benign Het
Acsl6 G T 11: 54,320,172 E24* probably null Het
Acsm1 C A 7: 119,662,278 L573I probably benign Het
Acsm2 T A 7: 119,578,093 L277Q probably damaging Het
Acsm4 C A 7: 119,711,371 H494N probably damaging Het
Acss2 G T 2: 155,517,957 probably benign Het
Acss3 G C 10: 107,004,777 F374L probably damaging Het
Acta1 C A 8: 123,893,471 probably null Het
Actc1 C A 2: 114,047,513 E363* probably null Het
Actg1 G T 11: 120,348,109 L52I probably benign Het
Actl9 G T 17: 33,433,113 G49V probably damaging Het
Actn2 G T 13: 12,288,562 L451M probably damaging Het
Actn4 T G 7: 28,919,049 N62T probably damaging Het
Actr5 G A 2: 158,636,705 V492I probably benign Het
Actr8 G T 14: 29,986,401 W212L probably damaging Het
Actr8 G T 14: 29,987,242 V268L probably damaging Het
Actrt3 A T 3: 30,598,003 L314Q possibly damaging Het
Adam2 C T 14: 66,056,521 A286T probably damaging Het
Adam26b G T 8: 43,520,698 S422R probably benign Het
Adam26b G A 8: 43,521,422 T181I probably benign Het
Adam28 C A 14: 68,626,784 W523C probably damaging Het
Adam29 A G 8: 55,871,496 I641T probably damaging Het
Adam30 A T 3: 98,160,979 T43S probably damaging Het
Adam33 T A 2: 131,058,662 H86L possibly damaging Het
Adam39 C A 8: 40,825,295 T241K probably benign Het
Adamdec1 G T 14: 68,580,643 T34K probably benign Het
Adamts10 G C 17: 33,545,429 E676Q possibly damaging Het
Adamts10 G T 17: 33,545,594 R696L probably damaging Het
Adamts12 G A 15: 11,317,324 C1370Y probably damaging Het
Adamts12 G T 15: 11,336,383 C1518F not run Het
Adamts14 C A 10: 61,198,843 G1086C possibly damaging Het
Adamts15 G T 9: 30,902,491 R793S probably damaging Het
Adamts19 G T 18: 58,838,075 G244C probably damaging Het
Adamts19 G T 18: 58,890,374 R280S possibly damaging Het
Adamts3 G T 5: 89,707,864 C382* probably null Het
Adamts3 C T 5: 89,775,351 V199I not run Het
Adamts5 C A 16: 85,870,074 G510V probably damaging Het
Adamts9 C A 6: 92,854,346 G1342V probably damaging Het
Adarb2 C T 13: 8,570,200 P241S probably benign Het
Adck2 C T 6: 39,574,088 probably benign Het
Adcy1 G T 11: 7,100,642 E287* probably null Het
Adcy1 A T 11: 7,144,802 Q576L probably damaging Het
Adcy10 C A 1: 165,510,276 T153N possibly damaging Het
Adcy5 G A 16: 35,291,544 V924M not run Het
Adcy8 G T 15: 64,699,177 P1236T probably benign Het
Adgrb1 G T 15: 74,541,676 G570C probably damaging Het
Adgrb1 G T 15: 74,547,683 W791L probably damaging Het
Adgrb2 G T 4: 130,011,826 D822Y probably damaging Het
Adgrb2 G C 4: 130,019,119 G1313R probably damaging Het
Adgre1 G T 17: 57,419,374 C415F probably damaging Het
Adgre4 A T 17: 55,814,152 probably null Het
Adgrf1 G C 17: 43,310,147 G425A probably benign Het
Adgrf5 C T 17: 43,445,053 P634L probably benign Het
Adgrg1 T A 8: 95,007,630 C377S probably damaging Het
Adgrv1 C G 13: 81,419,256 W5266S possibly damaging Het
Adipor2 C A 6: 119,357,322 G309V possibly damaging Het
Adora1 C A 1: 134,203,009 R308L probably benign Het
Adora1 G C 1: 134,234,124 H78D possibly damaging Het
Adora1 G A 1: 134,234,228 A43V possibly damaging Het
Adora2b G A 11: 62,249,426 V109I probably benign Het
Adora3 G T 3: 105,907,785 A284S probably damaging Het
Adprhl1 G C 8: 13,245,476 H212Q possibly damaging Het
Adrm1 A T 2: 180,174,915 S198C unknown Het
Adrm1 G T 2: 180,175,372 G279V possibly damaging Het
Aebp2 G T 6: 140,624,094 A134S unknown Het
Aen G C 7: 78,902,766 R158P possibly damaging Het
AF529169 G T 9: 89,603,162 P61T probably damaging Het
Afap1l1 C A 18: 61,752,508 probably null Het
Aff1 G T 5: 103,783,753 R79L possibly damaging Het
Afm C A 5: 90,521,946 T44K probably benign Het
Afm C A 5: 90,531,506 N286K probably benign Het
Afm C A 5: 90,531,616 P323Q probably damaging Het
Afm C A 5: 90,551,383 T562K possibly damaging Het
Agbl1 C A 7: 76,720,206 S936R unknown Het
Agbl3 T G 6: 34,799,408 F283C probably damaging Het
Agl T A 3: 116,781,036 I40F Het
Agmat C A 4: 141,746,979 P57Q possibly damaging Het
Ago1 C A 4: 126,453,656 W433C probably damaging Het
Agrn C A 4: 156,171,544 E1447* probably null Het
Agrn C G 4: 156,179,576 V184L possibly damaging Het
Ahctf1 C G 1: 179,793,730 A157P probably damaging Het
Ahcyl1 C T 3: 107,673,435 probably null Het
Ahi1 G T 10: 21,041,007 probably benign Het
Ahnak G T 19: 9,017,468 G5372V probably damaging Het
Ahnak2 C A 12: 112,781,199 G1676V Het
Ahrr T G 13: 74,224,776 H185P probably benign Het
Ahsg C A 16: 22,899,047 P337Q probably damaging Het
AI182371 A C 2: 35,095,759 probably null Het
AI314180 C A 4: 58,861,614 D322Y probably damaging Het
AI413582 G T 17: 27,564,645 P10T probably benign Het
AI593442 G T 9: 52,677,912 P122T possibly damaging Het
AI597479 G T 1: 43,111,119 A130S probably benign Het
Aifm3 G T 16: 17,500,934 G206C probably benign Het
Aifm3 G T 16: 17,503,720 R479L probably benign Het
Ajap1 C A 4: 153,432,435 G150C probably benign Het
Ajap1 C A 4: 153,432,436 Q149H probably damaging Het
Akap13 G C 7: 75,615,005 G532A probably benign Het
Akap2 G A 4: 57,856,348 G559E probably damaging Het
Akap9 A T 5: 4,046,189 N2355Y probably damaging Het
Akp3 G T 1: 87,126,445 probably null Het
Akr1c12 G C 13: 4,272,954 L219V probably damaging Het
Akr1c20 G T 13: 4,523,244 S24Y probably benign Het
Alb A T 5: 90,468,512 Q292L probably damaging Het
Aldh16a1 C A 7: 45,145,903 G444V probably null Het
Aldh1a2 T A 9: 71,283,522 V349E probably benign Het
Aldh1b1 G C 4: 45,802,692 D77H probably damaging Het
Aldh1l1 C A 6: 90,564,449 A275E probably benign Het
Aldh1l2 G T 10: 83,493,480 A822D probably damaging Het
Aldh1l2 G A 10: 83,534,005 R4W probably benign Het
Aldh5a1 C G 13: 24,911,638 G499R probably damaging Het
Aldh7a1 T A 18: 56,526,991 T528S probably benign Het
Alg1 G C 16: 5,239,967 G268R probably benign Het
Alg8 G T 7: 97,371,662 A9S probably benign Het
Alg9 G C 9: 50,788,173 G166A probably damaging Het
Alk G T 17: 72,603,063 S216Y probably damaging Het
Alox12 C A 11: 70,251,479 G308C possibly damaging Het
Alox8 G A 11: 69,185,221 R635W probably damaging Het
Alpk1 C A 3: 127,685,307 W30C Het
Als2cl G A 9: 110,888,528 G279S probably benign Het
Als2cl C A 9: 110,895,817 Y786* probably null Het
Alx3 C A 3: 107,604,834 P263T probably damaging Het
Alx4 G T 2: 93,642,656 probably benign Het
Ambra1 G T 2: 91,768,999 A155S possibly damaging Het
Ambra1 G T 2: 91,875,786 W865C probably damaging Het
Ambra1 C A 2: 91,900,608 N1030K possibly damaging Het
Amer3 C A 1: 34,587,196 S172* probably null Het
Amh G C 10: 80,807,586 E535Q possibly damaging Het
Amot C A X: 145,480,458 R110S Het
Ampd3 A T 7: 110,788,780 Q131L probably damaging Het
Amph G C 13: 19,139,334 D589H possibly damaging Het
Amy1 A T 3: 113,558,353 W397R probably damaging Het
Amy2a1 C A 3: 113,530,532 A120S not run Het
Anapc15 G T 7: 101,901,039 E153D unknown Het
Angptl6 C A 9: 20,878,411 G62C probably damaging Het
Ank2 T C 3: 126,944,357 Q2626R unknown Het
Ankk1 C A 9: 49,415,944 G645V probably damaging Het
Ankk1 G T 9: 49,416,487 A464E probably damaging Het
Ankra2 G T 13: 98,272,277 V263L possibly damaging Het
Ankrd11 C A 8: 122,900,142 Q100H probably damaging Het
Ankrd17 C A 5: 90,283,505 A807S possibly damaging Het
Ankrd17 C T 5: 90,289,325 A554T possibly damaging Het
Ankrd2 A G 19: 42,040,159 I85V Het
Ankrd2 G T 19: 42,044,999 A327S Het
Ankrd22 CT CTT 19: 34,123,491 probably null Het
Ankrd26 C A 6: 118,523,532 A993S possibly damaging Het
Ankrd26 C T 6: 118,523,595 E972K probably damaging Het
Ankrd27 G T 7: 35,603,878 V228L possibly damaging Het
Ankrd33b C A 15: 31,305,133 probably null Het
Ankrd35 G T 3: 96,683,770 Q457H probably damaging Het
Ankrd36 G T 11: 5,571,117 W88C probably damaging Het
Ankrd36 G A 11: 5,629,345 S203N probably benign Het
Ankrd36 C A 11: 5,643,738 P448T probably damaging Het
Ankrd45 G T 1: 161,160,738 G189W probably damaging Het
Ankrd45 G T 1: 161,160,752 K193N possibly damaging Het
Ankrd50 C G 3: 38,455,792 A809P probably damaging Het
Ankrd53 C G 6: 83,765,783 L253V possibly damaging Het
Ankrd7 G A 6: 18,866,564 A28T possibly damaging Het
Ano2 G T 6: 126,013,207 A764S probably damaging Het
Ano2 G A 6: 126,015,647 G861E probably damaging Het
Ano7 C A 1: 93,401,527 A681E probably damaging Het
Antxrl TC T 14: 34,067,930 probably null Het
Anxa11 G T 14: 25,870,176 G55C unknown Het
Aox2 C A 1: 58,354,397 P1239T possibly damaging Het
Ap1s1 C A 5: 137,045,233 probably benign Het
Ap2b1 G T 11: 83,365,753 G713V probably damaging Het
Ap3m2 C T 8: 22,791,321 S312N probably benign Het
Ap5b1 G T 19: 5,570,928 G792V probably damaging Het
Apba2 G T 7: 64,750,235 V725L probably benign Het
Apbb1ip G T 2: 22,875,103 A599S unknown Het
Apc G T 18: 34,314,463 V1471L probably benign Het
Apc2 C A 10: 80,312,036 R975S probably damaging Het
Apcdd1 G T 18: 62,922,691 G10* probably null Het
Aplp1 C A 7: 30,438,189 R482L probably benign Het
Aplp1 T A 7: 30,438,279 probably null Het
Apoa5 G A 9: 46,269,119 A8T possibly damaging Het
Apob C A 12: 7,988,765 L406I probably benign Het
Apob GCC GC 12: 8,015,249 probably null Het
Apobec4 G T 1: 152,756,726 W168C probably damaging Het
Apod C T 16: 31,297,520 V131M probably damaging Het
Apol11b A C 15: 77,638,007 I30R probably benign Het
Aqp4 C G 18: 15,399,881 G52R possibly damaging Het
Arcn1 C G 9: 44,757,253 G229R probably damaging Het
Arf6 G T 12: 69,372,407 probably benign Het
Arfgap2 C T 2: 91,275,104 S468L probably benign Het
Arfgap3 C A 15: 83,332,688 E159* probably null Het
Arfgef3 A C 10: 18,607,776 I1400S probably damaging Het
Arfgef3 C A 10: 18,627,628 V1010L probably damaging Het
Arhgap20 C A 9: 51,824,924 L179I probably damaging Het
Arhgap30 A C 1: 171,407,908 K617Q probably benign Het
Arhgap32 G T 9: 32,260,680 Q1585H probably damaging Het
Arhgap33 C G 7: 30,522,817 R1230P probably damaging Het
Arhgef10l C A 4: 140,516,772 R852L probably benign Het
Arhgef16 G T 4: 154,281,453 S501Y probably damaging Het
Arhgef26 C A 3: 62,339,930 T145N probably benign Het
Arhgef28 C A 13: 97,899,756 G1665V probably benign Het
Arhgef33 G T 17: 80,384,230 G50V unknown Het
Arhgef38 C A 3: 133,206,961 E106* probably null Het
Arhgef4 C G 1: 34,722,921 S419R unknown Het
Arhgef4 A G 1: 34,723,366 S568G unknown Het
Arhgef4 C G 1: 34,724,259 S865R probably benign Het
Arhgef6 C A X: 57,304,624 probably benign Het
Arid1a C A 4: 133,680,916 W1708C unknown Het
Arid1b G T 17: 4,996,328 A464S possibly damaging Het
Arid2 A C 15: 96,390,986 Q1672P probably damaging Het
Arid3a A C 10: 79,949,430 Q344P probably damaging Het
Arid3c C A 4: 41,730,177 R6M possibly damaging Het
Arid4a G A 12: 71,075,637 E931K possibly damaging Het
Arid5b C T 10: 68,097,228 R948Q probably damaging Het
Arl11 CA CAA 14: 61,310,868 probably null Het
Armc1 G T 3: 19,149,574 L63I probably benign Het
Armc3 C A 2: 19,285,991 T427K probably benign Het
Armc5 G T 7: 128,240,625 G372C probably damaging Het
Armc5 C A 7: 128,240,830 T440N probably damaging Het
Armc5 G T 7: 128,244,663 R876L probably damaging Het
Armc8 C T 9: 99,497,386 A496T probably damaging Het
Armc9 G C 1: 86,176,825 E265D probably damaging Het
Armc9 G C 1: 86,196,355 R417P probably benign Het
Armcx4 C A X: 134,693,042 A1233D not run Het
Armcx6 C A X: 134,749,992 G30V probably damaging Het
Arnt2 G A 7: 84,263,207 T575I possibly damaging Het
Arsj G T 3: 126,438,909 G435C probably damaging Het
Art3 C G 5: 92,412,206 L75V unknown Het
Art4 G T 6: 136,849,583 P299T probably damaging Het
Arvcf T A 16: 18,389,299 L41Q probably damaging Het
Asb14 T C 14: 26,912,299 V487A probably benign Het
Asb3 C G 11: 31,058,965 P250A possibly damaging Het
Ascc3 A T 10: 50,718,421 H1204L probably benign Het
Asic2 G C 11: 80,894,011 I367M possibly damaging Het
Asic2 G T 11: 81,152,090 R126S probably benign Het
Asic2 G A 11: 81,152,240 R76C possibly damaging Het
Asic4 A T 1: 75,469,220 Q231L probably benign Het
Aspdh G T 7: 44,465,530 R20L probably damaging Het
Aspg G A 12: 112,121,021 V304M probably damaging Het
Asprv1 C A 6: 86,628,344 S57R probably damaging Het
Asxl2 A C 12: 3,474,589 S206R probably damaging Het
Asxl3 G T 18: 22,516,339 V462L probably benign Het
Asxl3 C G 18: 22,523,591 R1553G probably damaging Het
Atf7ip2 A T 16: 10,241,640 Q348L possibly damaging Het
Atg2b C A 12: 105,635,764 R1651L probably damaging Het
Atg9b C T 5: 24,391,787 G44R probably benign Het
Atl3 G T 19: 7,530,553 A357S probably benign Het
Atn1 C A 6: 124,745,035 G952C unknown Het
Atoh8 C A 6: 72,235,126 K13N probably damaging Het
Atp10b G C 11: 43,153,349 G134A probably benign Het
Atp11b G T 3: 35,806,854 M363I probably benign Het
Atp12a C A 14: 56,373,215 T272K probably damaging Het
Atp13a5 C A 16: 29,280,969 W761C probably damaging Het
Atp1a2 G T 1: 172,287,336 T294K probably damaging Het
Atp1a3 C A 7: 24,980,119 V904L probably benign Het
Atp1b3 C A 9: 96,333,560 L267F probably damaging Het
Atp2a3 C G 11: 72,980,327 S582R possibly damaging Het
Atp2b1 G T 10: 99,018,848 R1101L probably damaging Het
Atp2c2 C A 8: 119,734,385 T239N probably benign Het
Atp4a G T 7: 30,717,840 Q549H possibly damaging Het
Atp4b C A 8: 13,389,794 A143S probably benign Het
Atp4b GGTTCCAACAGTAGT GGT 8: 13,396,684 probably benign Het
Atp5s G A 12: 69,740,962 probably benign Het
Atp7b C A 8: 21,994,877 R1388L probably benign Het
Atp8a2 C A 14: 60,006,330 R642L possibly damaging Het
Atp8b3 A T 10: 80,531,077 V229E probably benign Het
Atp8b4 T A 2: 126,322,824 T1191S probably benign Het
Atp8b4 A T 2: 126,433,943 L123Q probably damaging Het
Atp8b5 T A 4: 43,370,669 L982I probably benign Het
Atr A T 9: 95,888,100 R1194S probably benign Het
Atrn G T 2: 130,946,042 G255C probably damaging Het
Atxn7l3b T A 10: 112,928,454 Q90L possibly damaging Het
Atxn7l3b C G 10: 112,928,479 G82R probably damaging Het
AU040320 G C 4: 126,842,633 Q836H probably benign Het
Aup1 A G 6: 83,057,524 E437G unknown Het
Axin2 G T 11: 108,923,474 G63W probably damaging Het
Axl C A 7: 25,761,526 G686V probably damaging Het
B020004C17Rik C T 14: 57,015,260 Q2* probably null Het
B230359F08Rik G A 14: 53,795,507 probably benign Het
B3galt1 G T 2: 68,117,990 W16C probably damaging Het
B3galt4 C A 17: 33,951,136 A43S unknown Het
B3galt5 C A 16: 96,315,379 R71S probably damaging Het
B3galt5 G C 16: 96,316,032 Q288H probably benign Het
B3gntl1 C T 11: 121,639,814 D144N probably benign Het
B4galt2 C A 4: 117,881,069 M113I probably benign Het
Babam1 G T 8: 71,399,563 V132F probably benign Het
Bag6 A C 17: 35,142,924 Q510P unknown Het
Bahcc1 G A 11: 120,272,921 V682M possibly damaging Het
Baz2b C G 2: 59,977,520 A132P probably benign Het
Bbox1 C A 2: 110,270,188 K221N probably benign Het
Bbs5 G A 2: 69,665,071 V288M probably benign Het
Bbs7 C T 3: 36,602,920 G253E probably damaging Het
BC016579 C A 16: 45,648,896 V70F possibly damaging Het
BC027072 C A 17: 71,750,403 G760W probably damaging Het
BC049762 G C 11: 51,253,968 A106G probably benign Het
BC051019 G T 7: 109,720,640 P72Q probably benign Het
BC055324 T A 1: 163,964,517 R611W probably damaging Het
Bcam C A 7: 19,760,107 A420S probably null Het
Bcar3 G C 3: 122,505,018 R144P probably damaging Het
Bcl11b C A 12: 107,989,740 G50V probably damaging Het
Bcl2a1a G T 9: 88,957,466 G139V probably damaging Het
Bcl2a1c A C 9: 114,330,468 T105P probably benign Het
Bcl2l11 C G 2: 128,128,995 N121K probably damaging Het
Bcl2l11 G T 2: 128,147,193 R164M probably damaging Het
Bdh1 C T 16: 31,455,175 A186V possibly damaging Het
Bdh1 A G 16: 31,455,177 K187E possibly damaging Het
Bdp1 T A 13: 100,061,396 K827M probably damaging Het
Best1 G C 19: 9,993,239 S79C probably damaging Het
Bfar G T 16: 13,688,810 V175L probably benign Het
Bid C T 6: 120,900,258 E41K probably damaging Het
Birc6 G T 17: 74,647,280 A3376S probably benign Het
Bmp2k G T 5: 97,053,156 A312S probably damaging Het
Bmpr2 G A 1: 59,847,167 R321Q not run Het
Bnc1 C A 7: 81,968,470 R949L probably damaging Het
Bpifa3 C G 2: 154,136,292 T138R possibly damaging Het
Bpifb3 C T 2: 153,925,789 P261S probably benign Het
Bpnt1 G A 1: 185,352,269 G188R probably damaging Het
Brd2 C A 17: 34,116,907 probably null Het
Brd2 C A 17: 34,116,908 probably benign Het
Brinp2 C A 1: 158,246,782 V590L possibly damaging Het
Brpf3 G T 17: 28,821,478 D958Y probably benign Het
Brsk1 G C 7: 4,704,222 C258S probably damaging Het
Bsn C T 9: 108,105,499 R913H Het
Bsn G C 9: 108,139,195 L206V probably damaging Het
Bst1 C A 5: 43,819,032 P36T probably damaging Het
Btbd10 C G 7: 113,332,689 V169L probably benign Het
Btbd18 G T 2: 84,661,568 G31V probably damaging Het
Btbd7 C T 12: 102,811,120 E483K probably damaging Het
Btla C A 16: 45,239,272 P113Q possibly damaging Het
Btnl2 G T 17: 34,363,519 R353L probably benign Het
Btnl4 C A 17: 34,470,060 probably null Het
Bud13 G C 9: 46,291,740 R487P probably damaging Het
C1qb C A 4: 136,882,281 W9C probably benign Het
C1qtnf1 G C 11: 118,443,754 W20S probably benign Het
C1qtnf12 G T 4: 155,965,649 R202L probably damaging Het
C1qtnf4 G T 2: 90,889,505 G41C probably damaging Het
C1s2 G T 6: 124,625,734 A506D possibly damaging Het
C2cd4b C G 9: 67,759,799 P26A probably damaging Het
C2cd5 C A 6: 143,029,206 E820D probably null Het
C3 G A 17: 57,217,144 A964V probably benign Het
C3 G T 17: 57,226,171 S144Y probably damaging Het
C7 C T 15: 5,015,375 D394N probably benign Het
C9 C A 15: 6,491,519 P482T probably damaging Het
Cabin1 C T 10: 75,648,123 A2043T probably benign Het
Cables1 G T 18: 11,941,317 G525V probably damaging Het
Cabp4 G T 19: 4,136,222 L227M probably damaging Het
Cacna1a C A 8: 84,579,491 D1289E probably damaging Het
Cacna1b T G 2: 24,638,677 M1609L probably damaging Het
Cacna1b G T 2: 24,661,790 P1115H probably damaging Het
Cacna1b G T 2: 24,678,988 H975N probably damaging Het
Cacna1c G T 6: 118,757,661 probably benign Het
Cacna1e G T 1: 154,442,292 A1448E probably damaging Het
Cacna1g C A 11: 94,459,596 Q474H probably benign Het
Cacna1g C A 11: 94,473,590 A10S probably benign Het
Cacna1h C A 17: 25,375,892 E2097D probably damaging Het
Cacna1h T A 17: 25,391,378 E718V probably damaging Het
Cacna1h C A 17: 25,393,584 W380L probably benign Het
Cacna1i G T 15: 80,381,179 R1544L possibly damaging Het
Cacna1i G T 15: 80,389,383 G1757C possibly damaging Het
Cacna1s G C 1: 136,117,686 A1691P probably benign Het
Cacna2d3 A C 14: 29,347,163 D232E possibly damaging Het
Cad G T 5: 31,068,421 G1017V probably damaging Het
Cad G T 5: 31,075,128 D1846Y probably benign Het
Cadps C G 14: 12,465,880 R1010P probably damaging Het
Cadps2 A T 6: 23,385,478 L782I possibly damaging Het
Cadps2 C G 6: 23,626,695 S198T probably damaging Het
Cadps2 G T 6: 23,838,818 P107H probably damaging Het
Calcb G T 7: 114,722,162 probably null Het
Calm4 G C 13: 3,838,199 V102L possibly damaging Het
Calml3 C A 13: 3,804,011 D18Y probably damaging Het
Caln1 C A 5: 130,839,314 C230* probably null Het
Calr4 G T 4: 109,235,733 W3C probably benign Het
Calu G T 6: 29,372,515 V230L probably damaging Het
Camta1 A T 4: 151,077,925 L454Q probably damaging Het
Camta2 C A 11: 70,675,221 G746* probably null Het
Capg G A 6: 72,556,230 C166Y probably damaging Het
Capn12 T A 7: 28,887,828 W380R probably damaging Het
Capn15 T A 17: 25,973,220 H16L probably benign Het
Capn8 G T 1: 182,613,346 E448D probably benign Het
Caprin1 C G 2: 103,775,934 E320D probably null Het
Car12 C A 9: 66,751,954 P39Q probably benign Het
Car3 G T 3: 14,871,636 R253M Het
Car4 C G 11: 84,963,419 P64R possibly damaging Het
Car5a C T 8: 121,916,373 M297I probably benign Het
Car8 G C 4: 8,221,594 R126G probably damaging Het
Card10 G T 15: 78,795,328 P307T probably benign Het
Card11 T A 5: 140,898,241 I428F probably benign Het
Card14 C A 11: 119,341,061 H818Q probably damaging Het
Card9 G C 2: 26,357,551 R241G probably damaging Het
Carf A C 1: 60,136,262 probably null Het
Casd1 G T 6: 4,631,531 W549L possibly damaging Het
Caskin1 T A 17: 24,496,687 C142S probably damaging Het
Caskin2 C T 11: 115,806,781 A110T possibly damaging Het
Cass4 C T 2: 172,427,575 Q526* probably null Het
Cast C A 13: 74,725,463 K402N probably damaging Het
Casz1 C A 4: 148,933,306 P351T probably damaging Het
Casz1 T C 4: 148,944,359 L1087P probably benign Het
Catsper1 A T 19: 5,343,883 Q641L probably damaging Het
Catsperb G C 12: 101,446,048 W131C probably damaging Het
Catspere2 G T 1: 178,156,802 probably benign Het
Catsperg2 A T 7: 29,697,782 W1099R possibly damaging Het
Cbarp G C 10: 80,131,872 R512G probably damaging Het
Cbarp G T 10: 80,133,060 P367T probably damaging Het
Cbfa2t3 G A 8: 122,630,757 P605S probably benign Het
Cblc T G 7: 19,785,278 D419A probably benign Het
Cbr2 G C 11: 120,730,279 A164G possibly damaging Het
Cbs C G 17: 31,625,882 probably null Het
Cbx4 C T 11: 119,085,766 W35* probably null Het
Cbx7 G T 15: 79,933,884 L6M unknown Het
Cc2d2a C T 5: 43,703,204 P541S probably benign Het
Ccdc121 G A 1: 181,510,739 T216M probably damaging Het
Ccdc129 G T 6: 55,968,234 G647C probably damaging Het
Ccdc14 G C 16: 34,723,670 K847N probably damaging Het
Ccdc141 G T 2: 77,015,149 S1191R probably benign Het
Ccdc157 G A 11: 4,146,547 Q503* probably null Het
Ccdc162 G T 10: 41,683,195 A136D probably benign Het
Ccdc170 A C 10: 4,509,884 T5P probably benign Het
Ccdc177 G T 12: 80,757,736 A588E unknown Het
Ccdc178 G T 18: 22,109,731 R276S possibly damaging Het
Ccdc185 G T 1: 182,748,514 N203K possibly damaging Het
Ccdc191 G C 16: 43,939,122 E429Q possibly damaging Het
Ccdc25 A T 14: 65,865,128 probably null Het
Ccdc27 C A 4: 154,036,471 M289I unknown Het
Ccdc33 G T 9: 58,118,585 Q54K possibly damaging Het
Ccdc38 C A 10: 93,562,876 S172Y probably damaging Het
Ccdc40 C G 11: 119,238,107 R390G probably damaging Het
Ccdc40 C T 11: 119,254,398 S973L probably benign Het
Ccdc60 C A 5: 116,288,709 probably benign Het
Ccdc68 G T 18: 69,947,050 probably null Het
Ccdc71l G C 12: 32,379,615 R211P possibly damaging Het
Ccdc73 C A 2: 104,992,239 C16* probably null Het
Ccdc7a C A 8: 128,807,924 R1357L possibly damaging Het
Ccdc81 T A 7: 89,881,657 Q359L probably damaging Het
Ccdc85a C A 11: 28,583,491 A18S probably benign Het
Ccdc88c G T 12: 100,945,155 H807N probably benign Het
Ccdc90b G A 7: 92,568,557 M102I possibly damaging Het
Cchcr1 G T 17: 35,528,663 Q532H probably damaging Het
Ccin G T 4: 43,984,902 K436N probably benign Het
Ccl17 G T 8: 94,811,189 R35L possibly damaging Het
Ccna2 C A 3: 36,571,701 Q41H probably benign Het
Ccnt2 G T 1: 127,803,058 K557N probably damaging Het
Ccny T G 18: 9,353,494 Q93P probably benign Het
Ccr4 C G 9: 114,492,839 G53R probably damaging Het
Ccr8 C G 9: 120,094,499 L227V probably benign Het
Cct7 G T 6: 85,466,669 D340Y possibly damaging Het
Cd101 A C 3: 101,011,916 D627E probably benign Het
Cd101 G T 3: 101,017,140 Q328K probably benign Het
Cd109 G T 9: 78,691,313 Q944H probably damaging Het
Cd163 G A 6: 124,317,385 V501I probably benign Het
Cd177 C A 7: 24,760,256 G11W probably damaging Het
Cd180 C A 13: 102,706,032 H529N possibly damaging Het
Cd2 G C 3: 101,276,106 R296G probably damaging Het
Cd200 C A 16: 45,394,688 R200L possibly damaging Het
Cd209e T A 8: 3,851,181 S158C probably null Het
Cd244 T A 1: 171,574,350 C215S probably damaging Het
Cd248 G C 19: 5,069,165 G347A probably damaging Het
Cd6 G C 19: 10,791,445 R503G probably damaging Het
Cd8a G T 6: 71,374,593 R179L possibly damaging Het
Cdc42bpg A T 19: 6,309,746 E119V probably damaging Het
Cdc42bpg C A 19: 6,314,522 N593K possibly damaging Het
Cdc42bpg G A 19: 6,314,523 G594S probably damaging Het
Cdc42ep2 C A 19: 5,918,108 D190Y probably damaging Het
Cdc42ep2 G A 19: 5,918,645 R11C probably damaging Het
Cdc42ep3 C A 17: 79,334,878 M204I probably benign Het
Cdc42ep3 C A 17: 79,334,898 D198Y probably damaging Het
Cdca2 C A 14: 67,680,244 K568N probably damaging Het
Cdh1 G A 8: 106,656,839 V237M probably damaging Het
Cdh16 T G 8: 104,623,440 probably null Het
Cdh22 C A 2: 165,146,680 G252C probably damaging Het
Cdh23 C A 10: 60,323,555 R2149L possibly damaging Het
Cdh23 T A 10: 60,434,614 probably null Het
Cdh4 C A 2: 179,780,326 A81E probably benign Het
Cdh9 C T 15: 16,850,364 P528S probably benign Het
Cdhr2 C A 13: 54,715,671 P122T probably damaging Het
Cdhr2 G T 13: 54,718,564 C361F probably damaging Het
Cdhr2 A T 13: 54,726,408 R764S probably benign Het
Cdipt A T 7: 126,976,944 I24F probably benign Het
Cdk14 C A 5: 4,888,894 G461W possibly damaging Het
Cdk5rap3 C G 11: 96,912,216 probably null Het
Cdk8 G A 5: 146,299,795 R340K probably damaging Het
Cdk8 A T 5: 146,299,796 R340S probably damaging Het
Cdk8 G T 5: 146,301,637 S379I probably benign Het
Cdkl4 G T 17: 80,550,858 L111I probably damaging Het
Cdkl5 C A X: 160,824,045 V736F probably benign Het
Cdkn1c C A 7: 143,460,316 G131V probably damaging Het
Cdnf G A 2: 3,521,083 S104N possibly damaging Het
Cdon G T 9: 35,491,900 C1102F probably damaging Het
Cdyl G C 13: 35,816,070 R111S probably benign Het
Ceacam12 G C 7: 18,067,515 V140L probably damaging Het
Ceacam19 G T 7: 19,882,844 A175D probably damaging Het
Ceacam19 G T 7: 19,886,449 P86T probably damaging Het
Ceacam20 G A 7: 19,970,164 probably null Het
Cebpe C A 14: 54,710,580 E269* probably null Het
Cecr2 C A 6: 120,720,962 T74K probably damaging Het
Cela3b G T 4: 137,428,484 H37Q probably damaging Het
Celf1 G T 2: 91,004,705 C177F possibly damaging Het
Celsr1 A C 15: 85,978,851 C1327G probably damaging Het
Celsr2 C T 3: 108,412,220 R1092Q probably damaging Het
Celsr2 C T 3: 108,413,571 V642I probably benign Het
Celsr3 C A 9: 108,826,477 A53E probably benign Het
Cemip C A 7: 83,947,296 G1087C probably damaging Het
Cenpe G C 3: 135,216,385 V68L possibly damaging Het
Cenpj C G 14: 56,552,879 R571P possibly damaging Het
Cep128 C A 12: 91,289,603 M364I probably benign Het
Cep128 C A 12: 91,364,371 A75S probably damaging Het
Cep131 C A 11: 120,065,715 G936W probably damaging Het
Cep135 A T 5: 76,591,826 Q23L probably damaging Het
Cep152 C A 2: 125,614,324 V256F probably benign Het
Cep152 C T 2: 125,619,704 V151M probably damaging Het
Cep162 C A 9: 87,199,980 probably null Het
Cep250 A T 2: 155,976,467 Q854L probably benign Het
Cep290 G A 10: 100,497,944 R286Q probably benign Het
Cep290 G T 10: 100,538,997 K1368N possibly damaging Het
Cep295 C A 9: 15,330,817 D46Y Het
Cep89 G T 7: 35,397,081 probably benign Het
Ces1b T A 8: 93,076,154 T103S probably benign Het
Ces1h T A 8: 93,366,840 probably null Het
Ces2b AGG AG 8: 104,832,595 probably null Het
Ces2f G T 8: 104,948,235 G90W probably damaging Het
Ces2g C A 8: 104,963,961 L125M probably damaging Het
Ces3b G T 8: 105,085,083 R77L probably damaging Het
Cfap157 A C 2: 32,778,207 L407R probably damaging Het
Cfap221 C G 1: 119,984,743 R138P probably damaging Het
Cfap44 G T 16: 44,432,044 V839L probably benign Het
Cfap46 T A 7: 139,601,267 Q2606L unknown Het
Cfap46 G T 7: 139,630,626 P1768Q unknown Het
Cfap53 A T 18: 74,305,552 K267* probably null Het
Cfap54 G T 10: 92,979,026 P1315H probably damaging Het
Cfap57 C T 4: 118,598,956 probably null Het
Cfap61 G A 2: 146,012,162 V365M possibly damaging Het
Cfap61 G C 2: 146,153,800 C1095S probably damaging Het
Cfap69 C T 5: 5,586,384 C747Y possibly damaging Het
Cfap74 G T 4: 155,454,913 probably benign Het
Cfh G T 1: 140,144,059 P297H probably damaging Het
Chd1 G T 17: 15,747,801 G866C probably damaging Het
Chd2 C G 7: 73,468,586 A1095P possibly damaging Het
Cherp T G 8: 72,462,916 K687Q Het
Cherp C A 8: 72,475,135 probably benign Het
Chil5 G T 3: 106,028,818 H53N probably damaging Het
Chl1 C A 6: 103,693,096 Y482* probably null Het
Chl1 A T 6: 103,697,949 probably benign Het
Chmp1a C G 8: 123,206,331 V128L probably benign Het
Chmp3 C A 6: 71,543,804 probably benign Het
Chodl C A 16: 78,941,463 S106R possibly damaging Het
Chpf2 CGGG CGGGG 5: 24,591,519 probably null Het
Chrm2 G C 6: 36,524,607 R466S probably damaging Het
Chrna10 C A 7: 102,113,264 V240L probably benign Het
Chrna10 C A 7: 102,114,987 L63F possibly damaging Het
Chrna2 T A 14: 66,151,027 L497Q probably null Het
Chrna4 C A 2: 181,024,813 V611F probably damaging Het
Chrna4 G C 2: 181,028,285 H559Q possibly damaging Het
Chrna5 G A 9: 55,004,956 A347T possibly damaging Het
Chrna6 C G 8: 27,413,689 R5P probably benign Het
Chrna7 C T 7: 63,107,551 probably null Het
Chrna9 T A 5: 65,971,220 L257Q probably damaging Het
Chrnb1 G T 11: 69,794,189 A105D possibly damaging Het
Chrng C G 1: 87,205,995 S14R unknown Het
Chrng C A 1: 87,206,298 N87K probably benign Het
Chrng C A 1: 87,208,263 Q245K probably benign Het
Chrng C T 1: 87,208,303 T201I probably damaging Het
Chst2 C A 9: 95,404,841 R484L probably damaging Het
Chst3 C A 10: 60,186,260 G255V probably benign Het
Ciart G C 3: 95,879,023 P247A probably damaging Het
Cidec G C 6: 113,434,496 L8V probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cilp2 C A 8: 69,882,808 E513D probably damaging Het
Cilp2 A C 8: 69,884,542 C206G probably damaging Het
Cilp2 G T 8: 69,884,546 C204* probably null Het
Cirbp G T 10: 80,170,235 A82S probably damaging Het
Ckap5 T G 2: 91,585,798 L1023R probably damaging Het
Ckmt1 C A 2: 121,359,575 P81H probably damaging Het
Clasp2 G T 9: 113,770,221 G135C probably damaging Het
Clasp2 T A 9: 113,908,795 L1079Q probably damaging Het
Clca2 C A 3: 145,086,451 G350C probably damaging Het
Clcn4 C A 7: 7,293,040 E268* probably null Het
Clcn4 C A 7: 7,294,756 A165S probably damaging Het
Clcn6 C A 4: 148,023,370 G193* probably null Het
Clcn7 G T 17: 25,153,015 probably null Het
Clcnkb G T 4: 141,407,951 T492K probably damaging Het
Cldn1 G T 16: 26,360,864 P151H probably damaging Het
Cldn16 G T 16: 26,481,250 R146L probably damaging Het
Cldn9 G C 17: 23,683,201 P150R probably damaging Het
Cldnd1 G T 16: 58,729,681 G76W probably damaging Het
Clec1a G A 6: 129,429,907 P215L probably benign Het
Clec4a1 G T 6: 122,933,892 R235S possibly damaging Het
Clec4d G T 6: 123,268,074 W104C probably damaging Het
Clec4f C A 6: 83,645,221 R546I possibly damaging Het
Clgn T A 8: 83,397,681 M84K probably benign Het
Clic6 C T 16: 92,499,139 S229F probably benign Het
Clip1 C A 5: 123,617,350 A956S probably damaging Het
Clip2 C G 5: 134,516,835 R334P probably damaging Het
Clip2 C A 5: 134,522,999 G90C probably damaging Het
Clip4 G T 17: 71,799,097 probably null Het
Clmn C A 12: 104,781,376 K637N probably benign Het
Clp1 C A 2: 84,725,963 D58Y probably benign Het
Clptm1 C T 7: 19,637,468 probably null Het
Clpx C A 9: 65,299,997 S59* probably null Het
Clspn G A 4: 126,566,177 R399Q probably benign Het
Clstn2 C A 9: 97,461,356 M679I probably benign Het
Clstn3 C A 6: 124,449,781 G564V probably damaging Het
Clu A T 14: 65,975,921 Q252L probably damaging Het
Cluh G C 11: 74,667,754 K1217N possibly damaging Het
Cmah C A 13: 24,435,684 Y277* probably null Het
Cmbl G T 15: 31,581,965 R36L probably benign Het
Cmtr2 CGGG CGG 8: 110,221,499 probably null Het
Cmya5 C G 13: 93,063,579 A3414P probably benign Het
Cnga1 C A 5: 72,605,530 probably null Het
Cngb1 A T 8: 95,252,136 L1022Q probably damaging Het
Cnksr1 T C 4: 134,232,150 D391G probably damaging Het
Cnnm3 G A 1: 36,513,033 A375T possibly damaging Het
Cnot11 G T 1: 39,535,848 G4C probably damaging Het
Cnot3 G T 7: 3,651,495 R57L probably damaging Het
Cnpy1 C A 5: 28,207,209 V109L possibly damaging Het
Cntn1 C A 15: 92,309,970 P814H probably damaging Het
Cntn3 C A 6: 102,337,331 V141L probably benign Het
Cntn4 G T 6: 106,550,425 G423C probably damaging Het
Cntn4 C A 6: 106,662,618 H570N probably damaging Het
Cntn5 C A 9: 9,673,962 E712* probably null Het
Cntn5 C A 9: 10,090,236 G198C probably damaging Het
Cntn6 C A 6: 104,832,584 P527T probably damaging Het
Cntnap2 C T 6: 46,015,299 P387S possibly damaging Het
Cntnap3 G C 13: 64,781,892 P498A probably damaging Het
Cntnap5a A T 1: 116,412,168 Q719L probably benign Het
Cntnap5b C T 1: 100,050,706 A149V probably damaging Het
Cntrob C A 11: 69,311,449 R439L possibly damaging Het
Cog4 A T 8: 110,879,015 T570S probably benign Het
Cog5 G T 12: 31,801,985 G280C probably damaging Het
Cog6 T C 3: 53,013,864 D107G probably damaging Het
Col11a1 G T 3: 114,138,921 G902C unknown Het
Col11a1 G C 3: 114,165,235 probably null Het
Col11a2 G T 17: 34,051,666 R537M probably benign Het
Col12a1 C A 9: 79,599,986 G263V possibly damaging Het
Col12a1 C CA 9: 79,639,696 probably null Het
Col13a1 C A 10: 61,905,262 G150C probably damaging Het
Col14a1 A C 15: 55,372,570 probably null Het
Col15a1 G T 4: 47,245,807 R186L probably benign Het
Col17a1 G A 19: 47,650,304 P1141L possibly damaging Het
Col18a1 T A 10: 77,112,838 Q280L unknown Het
Col1a1 G A 11: 94,943,804 M569I probably benign Het
Col22a1 G T 15: 71,915,120 P752T unknown Het
Col24a1 G T 3: 145,342,499 G619V probably damaging Het
Col25a1 G T 3: 130,522,461 G297V probably damaging Het
Col27a1 G T 4: 63,281,289 G928W probably damaging Het
Col28a1 G T 6: 8,062,283 P669Q possibly damaging Het
Col28a1 C A 6: 8,127,352 G366C probably damaging Het
Col28a1 T A 6: 8,175,630 S73C unknown Het
Col2a1 C A 15: 97,983,973 K781N probably damaging Het
Col2a1 G T 15: 97,998,345 P162H unknown Het
Col3a1 C T 1: 45,311,800 P18L unknown Het
Col4a1 C T 8: 11,235,218 G388S unknown Het
Col4a1 C G 8: 11,239,024 G311R unknown Het
Col4a3 G T 1: 82,690,039 G1010C unknown Het
Col5a2 C G 1: 45,402,113 G664A probably damaging Het
Col5a2 C A 1: 45,403,473 G604V probably damaging Het
Col5a3 C A 9: 20,775,334 A1332S unknown Het
Col6a2 C A 10: 76,596,350 A990S possibly damaging Het
Col6a3 A T 1: 90,811,728 D866E possibly damaging Het
Col6a5 C A 9: 105,930,785 E1021D unknown Het
Col6a6 C A 9: 105,728,255 G1644C probably damaging Het
Col6a6 C A 9: 105,788,895 G21C probably null Het
Col7a1 G T 9: 108,974,923 G2198W unknown Het
Col7a1 C G 9: 108,976,051 D2322E unknown Het
Col7a1 C A 9: 108,984,077 H2897N unknown Het
Col8a1 C A 16: 57,628,238 G303V unknown Het
Col8a1 C A 16: 57,632,450 L63F probably damaging Het
Col8a2 C A 4: 126,311,543 P449T unknown Het
Colgalt1 G T 8: 71,623,208 G500C probably damaging Het
Commd4 C A 9: 57,157,131 R4L probably damaging Het
Comp G T 8: 70,377,221 R365L probably benign Het
Copa AG A 1: 172,106,123 probably null Het
Copg2 C T 6: 30,809,585 R708Q probably benign Het
Coq7 C A 7: 118,510,149 K225N unknown Het
Corin C A 5: 72,454,493 R141S probably benign Het
Coro6 C A 11: 77,469,109 A372D probably damaging Het
Cox10 C A 11: 63,976,470 L233F possibly damaging Het
Cox4i1 G T 8: 120,668,280 probably benign Het
Cpa4 G T 6: 30,574,403 V64L possibly damaging Het
Cpa6 T A 1: 10,329,559 probably null Het
Cpn1 C A 19: 43,973,976 G178V probably damaging Het
Cpne5 C G 17: 29,159,182 R541P probably damaging Het
Cpsf7 G T 19: 10,535,518 S322I probably null Het
Cpt1a A T 19: 3,366,370 Q307L probably damaging Het
Cpt1a G T 19: 3,370,727 R395L probably damaging Het
Cpxm2 C G 7: 132,055,001 A511P probably benign Het
Cpz G T 5: 35,511,761 S342* probably null Het
Cracr2a G T 6: 127,607,244 A89S probably benign Het
Cracr2a A T 6: 127,669,063 D706V probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Crb1 T A 1: 139,248,901 Q448L possibly damaging Het
Crb1 A T 1: 139,337,028 probably null Het
Crb2 G A 2: 37,787,365 G290R probably damaging Het
Crb2 G C 2: 37,790,824 R588P possibly damaging Het
Crebl2 G A 6: 134,830,433 D2N probably damaging Het
Crispld1 TCC TC 1: 17,764,092 probably null Het
Crmp1 G T 5: 37,278,124 V308L probably benign Het
Crnn T G 3: 93,149,296 V463G probably damaging Het
Crocc2 A T 1: 93,213,595 R1157W probably damaging Het
Crocc2 A T 1: 93,226,692 Q1603L probably benign Het
Crybb2 C A 5: 113,058,435 G178V probably damaging Het
Crybb2 C A 5: 113,058,436 G178W probably damaging Het
Crybg3 C A 16: 59,555,393 E119* probably null Het
Crybg3 C T 16: 59,556,478 S1471N probably benign Het
Csf1 C A 3: 107,749,080 A212S possibly damaging Het
Csf2ra C T 19: 61,225,153 D373N probably benign Het
Csmd1 G T 8: 15,984,708 P2488T probably damaging Het
Csmd1 C A 8: 16,200,019 D982Y probably damaging Het
Csmd2 C T 4: 128,530,797 L2872F Het
Csmd3 C G 15: 47,675,734 G1536R Het
Csmd3 A T 15: 47,733,417 S1097R Het
Csnk1g1 A T 9: 66,012,750 T335S probably benign Het
Cspp1 GAA GA 1: 10,095,878 probably null Het
Cstf2 G C X: 134,062,488 probably null Het
Ctag2 C A X: 65,047,929 P82H probably damaging Het
Ctcfl A C 2: 173,102,036 M507R probably benign Het
Ctdsp2 G T 10: 126,996,072 R183L probably damaging Het
Ctla2a C A 13: 60,936,000 E39D probably damaging Het
Ctnna2 G C 6: 76,973,781 A569G possibly damaging Het
Ctnna2 G T 6: 76,980,740 L509I probably damaging Het
Ctnna2 G C 6: 77,641,417 N187K probably benign Het
Ctnna2 G A 6: 77,758,554 S60F probably benign Het
Ctnnd1 C A 2: 84,615,172 G507V probably damaging Het
Ctrb1 A T 8: 111,686,674 S235R probably damaging Het
Cts3 A T 13: 61,568,747 L25* probably null Het
Cts7 T A 13: 61,355,632 T173S probably benign Het
Ctse G A 1: 131,672,444 probably null Het
Ctsq C T 13: 61,037,096 G259R probably damaging Het
Cul7 AGGGG AGGG 17: 46,652,805 probably null Het
Cul7 A T 17: 46,658,738 Q977L probably damaging Het
Cul7 G T 17: 46,659,569 R1071L probably damaging Het
Cul9 C A 17: 46,537,797 R671L probably benign Het
Cux2 C T 5: 121,873,680 R564H probably damaging Het
Cux2 G T 5: 121,877,129 P234T probably benign Het
Cwf19l2 G T 9: 3,428,782 G256V probably damaging Het
Cwh43 C G 5: 73,430,470 N477K probably damaging Het
Cxxc4 G T 3: 134,240,050 A131S unknown Het
Cyfip1 G T 7: 55,898,320 G586V possibly damaging Het
Cyfip2 G A 11: 46,222,615 S968F not run Het
Cylc1 C G X: 111,122,279 P110A probably benign Het
Cyp17a1 G A 19: 46,672,659 P62L possibly damaging Het
Cyp1a1 G A 9: 57,700,514 A142T probably damaging Het
Cyp20a1 G T 1: 60,353,010 R75M probably damaging Het
Cyp26b1 C G 6: 84,577,119 W172S probably damaging Het
Cyp27a1 C T 1: 74,737,335 R477W probably damaging Het
Cyp2ab1 C A 16: 20,313,881 W222C possibly damaging Het
Cyp2b9 A T 7: 26,201,163 N409Y probably benign Het
Cyp2c54 G A 19: 40,073,757 L19F probably benign Het
Cyp2c66 T A 19: 39,186,626 I490N probably damaging Het
Cyp2c67 C T 19: 39,643,679 A82T possibly damaging Het
Cyp2d11 G T 15: 82,392,499 P80T probably damaging Het
Cyp2f2 C A 7: 27,121,907 Q82K possibly damaging Het
Cyp2j5 C A 4: 96,659,480 probably null Het
Cyp2r1 T A 7: 114,553,339 R128* probably null Het
Cyp2t4 T A 7: 27,158,240 L426Q probably damaging Het
Cyp3a57 C A 5: 145,365,633 P80T probably damaging Het
Cyp4a14 C T 4: 115,491,453 D305N possibly damaging Het
Cyp4a32 G T 4: 115,611,345 E341D probably benign Het
Cyp4f18 G T 8: 71,998,283 R180S probably benign Het
Cyp4f40 G T 17: 32,671,159 D268Y probably benign Het
Cyp4f40 G C 17: 32,676,449 R515P probably damaging Het
Cyp4x1 G T 4: 115,110,103 D425E probably damaging Het
Cyp4x1 C T 4: 115,127,525 A79T probably damaging Het
Cyp8b1 A T 9: 121,915,531 L245Q probably benign Het
Cyp8b1 G A 9: 121,916,146 P40L probably damaging Het
Cypt14 G A X: 39,863,558 P9L probably damaging Het
Cypt15 C A X: 39,346,330 A15E probably damaging Het
Cyr61 C A 3: 145,648,655 S167I probably benign Het
Cyth4 G T 15: 78,619,919 R363L probably damaging Het
D130043K22Rik C A 13: 24,856,709 P38H probably damaging Het
D130043K22Rik G C 13: 24,856,834 V80L probably benign Het
D130043K22Rik C A 13: 24,872,248 T521N possibly damaging Het
D130043K22Rik G T 13: 24,880,847 G749C probably damaging Het
D430041D05Rik C T 2: 104,241,191 A571T possibly damaging Het
D8Ertd738e C A 8: 84,249,646 A20S probably benign Het
D930020B18Rik C A 10: 121,689,912 A573D probably damaging Het
Daam2 C G 17: 49,464,620 A833P probably damaging Het
Daam2 G A 17: 49,489,016 R268W probably damaging Het
Dab1 G T 4: 104,727,740 G359V probably benign Het
Dact1 G C 12: 71,310,051 R23P possibly damaging Het
Daglb G C 5: 143,473,118 S140T probably null Het
Dand5 C T 8: 84,816,337 R170K probably benign Het
Dand5 C A 8: 84,816,523 R108M probably damaging Het
Dapk3 GC GCC 10: 81,191,769 probably null Het
Daw1 G T 1: 83,210,214 R318S unknown Het
Dbt G C 3: 116,546,091 R376P probably damaging Het
Dcaf12l1 G T X: 44,788,824 H366N probably damaging Het
Dcaf7 G T 11: 106,053,795 C268F probably benign Het
Dchs1 T A 7: 105,757,693 S2202C probably damaging Het
Dchs1 G C 7: 105,758,551 Q2025E probably benign Het
Dchs2 T A 3: 83,271,140 S1167T possibly damaging Het
Dclk1 G T 3: 55,256,013 E175D probably benign Het
Dcstamp G T 15: 39,759,596 G438W probably benign Het
Ddb1 G C 19: 10,608,396 R158P probably damaging Het
Ddc G T 11: 11,880,552 P31T probably damaging Het
Ddhd1 C A 14: 45,657,594 A140S possibly damaging Het
Ddhd2 C A 8: 25,754,374 A75S probably benign Het
Ddhd2 G T 8: 25,754,385 T71N unknown Het
Ddr2 C A 1: 169,990,622 D439Y possibly damaging Het
Ddx1 C A 12: 13,229,259 G460W probably damaging Het
Ddx10 C A 9: 53,204,511 A508S probably damaging Het
Ddx17 T A 15: 79,530,172 Q600L probably benign Het
Ddx21 C A 10: 62,587,538 probably null Het
Ddx27 G C 2: 167,033,841 E697D probably benign Het
Ddx56 C G 11: 6,267,445 M65I probably benign Het
Ddx60 G C 8: 62,000,588 R1247P possibly damaging Het
Defa17 G T 8: 21,656,594 G79W probably damaging Het
Defb11 A T 8: 21,906,346 C12S probably null Het
Defb37 G T 8: 18,986,383 N40K unknown Het
Degs2 G T 12: 108,692,597 P41H probably benign Het
Dek C A 13: 47,105,626 E35* probably null Het
Dennd1a C A 2: 37,800,257 G944W probably damaging Het
Dennd1c G T 17: 57,074,330 Q131K probably benign Het
Dennd2a C A 6: 39,523,474 Q52H probably benign Het
Dennd5a C G 7: 109,934,024 G180R probably benign Het
Deptor G T 15: 55,133,459 probably benign Het
Deup1 C A 9: 15,600,903 Q181H probably null Het
Deup1 G A 9: 15,607,832 S126F probably benign Het
Dgcr14 C G 16: 17,909,922 G131A probably benign Het
Dgka C G 10: 128,720,468 M716I probably benign Het
Dgka C T 10: 128,731,165 R275Q possibly damaging Het
Dgkd G A 1: 87,916,886 S258N probably damaging Het
Dgkg G T 16: 22,558,084 H508Q probably benign Het
Dgki G T 6: 36,975,225 L740M probably damaging Het
Dgkz C T 2: 91,942,334 V370I probably damaging Het
Dhtkd1 C G 2: 5,942,628 R15P unknown Het
Dhx29 G A 13: 112,955,517 R896Q probably null Het
Dhx37 C T 5: 125,424,980 R484Q possibly damaging Het
Dhx37 C A 5: 125,425,472 S449I probably benign Het
Dhx38 C T 8: 109,556,085 V650I probably benign Het
Dhx8 C A 11: 101,757,660 T928K probably damaging Het
Dhx9 C T 1: 153,456,575 G1216R unknown Het
Diaph3 C A 14: 87,002,814 G278V probably damaging Het
Diexf C A 1: 193,114,675 V583L probably damaging Het
Dio2 C A 12: 90,729,912 E101* probably null Het
Dip2a C A 10: 76,266,322 S1446I possibly damaging Het
Dip2a C A 10: 76,296,400 V545L probably damaging Het
Diras1 C A 10: 81,022,282 R45L possibly damaging Het
Disp2 G T 2: 118,789,702 R305L probably damaging Het
Disp2 C A 2: 118,790,827 P680H probably damaging Het
Disp3 G T 4: 148,249,746 P1030Q probably damaging Het
Disp3 G C 4: 148,249,847 S996R probably benign Het
Disp3 G C 4: 148,250,714 P958A probably damaging Het
Disp3 C A 4: 148,270,567 E331* probably null Het
Dlec1 C A 9: 119,134,473 L952I probably benign Het
Dlec1 T A 9: 119,147,409 S1677R probably damaging Het
Dlgap1 G T 17: 70,662,743 V515L probably benign Het
Dlgap2 G T 8: 14,727,659 W301C probably damaging Het
Dlgap3 C G 4: 127,194,984 D124E probably damaging Het
Dlgap3 G T 4: 127,235,498 K895N probably damaging Het
Dlgap5 T A 14: 47,388,063 R794* probably null Het
Dll3 G T 7: 28,301,383 S82R probably damaging Het
Dlst C T 12: 85,110,893 probably benign Het
Dlx1 G T 2: 71,530,015 E8* probably null Het
Dlx3 C G 11: 95,120,392 A24G probably benign Het
Dmbt1 A T 7: 131,082,485 probably null Het
Dmd C A X: 83,627,271 T220N probably damaging Het
Dmgdh G T 13: 93,677,183 A79S probably damaging Het
Dmgdh G T 13: 93,709,288 W483C probably damaging Het
Dmp1 C A 5: 104,211,652 H65N probably benign Het
Dmrta1 G T 4: 89,688,408 V34L probably damaging Het
Dmrta1 G A 4: 89,688,454 G49D probably benign Het
Dmrta1 G A 4: 89,688,498 A64T probably benign Het
Dmxl2 GC G 9: 54,382,034 probably null Het
Dna2 G C 10: 62,962,424 M635I probably benign Het
Dnaaf5 G C 5: 139,177,975 W662C probably damaging Het
Dnaaf5 G A 5: 139,185,542 D820N probably benign Het
Dnaaf5 G T 5: 139,185,585 R834L probably damaging Het
Dnah10 G C 5: 124,741,955 R435P probably damaging Het
Dnah10 C T 5: 124,747,619 A613V possibly damaging Het
Dnah10 G T 5: 124,817,988 probably null Het
Dnah12 G T 14: 26,875,215 W3510C probably damaging Het
Dnah14 G A 1: 181,690,320 G2073E probably benign Het
Dnah14 T C 1: 181,763,334 L3264P probably damaging Het
Dnah14 G T 1: 181,766,304 R3404L probably damaging Het
Dnah17 G T 11: 118,078,563 P2257T possibly damaging Het
Dnah17 C A 11: 118,086,960 G1849C probably damaging Het
Dnah17 C A 11: 118,127,142 E176* probably null Het
Dnah2 G T 11: 69,463,453 R2290S possibly damaging Het
Dnah2 C T 11: 69,544,557 probably null Het
Dnah3 G C 7: 119,967,901 S2367R probably damaging Het
Dnah3 C A 7: 120,007,862 R1840L probably benign Het
Dnah5 T G 15: 28,270,354 L934R probably benign Het
Dnah5 G T 15: 28,270,403 E950D probably benign Het
Dnah5 C T 15: 28,295,311 P1397S probably damaging Het
Dnah5 T A 15: 28,387,763 S3123T possibly damaging Het
Dnah6 C A 6: 73,021,237 L4067F probably benign Het
Dnah6 G T 6: 73,032,526 Q3813K probably damaging Het
Dnah6 G T 6: 73,041,138 P3566H probably damaging Het
Dnah6 C A 6: 73,155,272 R1149L possibly damaging Het
Dnah7a C G 1: 53,411,656 V3872L probably benign Het
Dnah7a C A 1: 53,559,102 A1425S probably benign Het
Dnah7a A C 1: 53,643,457 W285G possibly damaging Het
Dnah7c C A 1: 46,654,103 L1961I possibly damaging Het
Dnah8 C A 17: 30,694,033 T1067N probably benign Het
Dnah8 A T 17: 30,713,095 Q1479L probably null Het
Dnah9 C A 11: 66,126,650 D379Y probably damaging Het
Dnaic1 C T 4: 41,569,809 probably benign Het
Dnaja2 C A 8: 85,540,071 W342C probably benign Het
Dnajb11 G A 16: 22,865,496 G90S probably damaging Het
Dnajb11 G A 16: 22,866,961 R122H probably benign Het
Dnajc10 G C 2: 80,319,233 R93P probably damaging Het
Dnajc12 A T 10: 63,397,260 Q60L probably damaging Het
Dnajc6 G T 4: 101,639,428 V931L possibly damaging Het
Dner C T 1: 84,405,989 C558Y probably damaging Het
Dner C G 1: 84,445,430 S484T probably damaging Het
Dner C A 1: 84,445,433 R483L probably damaging Het
Dnhd1 C A 7: 105,682,841 R102S possibly damaging Het
Dntt A T 19: 41,055,815 D473V probably damaging Het
Doc2g C A 19: 4,004,105 P112T probably damaging Het
Dock1 G T 7: 134,782,400 E667* probably null Het
Dock10 C G 1: 80,559,200 M989I probably benign Het
Dock2 T G 11: 34,312,553 H934P possibly damaging Het
Dock4 G C 12: 40,817,641 Q1405H possibly damaging Het
Dock5 C A 14: 67,813,933 A696S possibly damaging Het
Dock8 G T 19: 25,132,123 A890S probably benign Het
Dock8 C T 19: 25,155,972 T1161I probably benign Het
Donson G A 16: 91,688,472 R81W probably benign Het
Dopey2 G T 16: 93,763,895 V874L probably damaging Het
Dpp6 C A 5: 27,712,642 F610L probably damaging Het
Dpp8 CTGTGTGT CTGTGT 9: 65,063,866 probably null Het
Dpp8 G T 9: 65,066,485 G664C probably damaging Het
Dpy19l2 C A 9: 24,646,359 M373I probably benign Het
Dpys A T 15: 39,842,099 M206K probably benign Het
Dpysl2 C A 14: 66,862,490 G99V probably damaging Het
Drc1 A T 5: 30,345,507 N125Y possibly damaging Het
Drc1 C A 5: 30,348,697 S238Y probably benign Het
Drd1 G T 13: 54,052,857 T446N possibly damaging Het
Drd5 C T 5: 38,320,386 R241C possibly damaging Het
Drosha G T 15: 12,842,092 G327V probably benign Het
Drp2 A G X: 134,437,042 E359G probably damaging Het
Dsc3 C T 18: 19,966,315 V715I probably benign Het
Dscam C G 16: 96,608,189 E1845Q probably damaging Het
Dscaml1 C A 9: 45,672,791 T518N probably damaging Het
Dsel C A 1: 111,861,716 R363L probably damaging Het
Dsg1c C A 18: 20,264,949 P69T probably damaging Het
Dsg2 G T 18: 20,602,249 E1095* probably null Het
Dsp G C 13: 38,151,689 G34A probably benign Het
Dsp CAAA CAAAA 13: 38,192,854 probably null Het
Dst G T 1: 34,181,232 G2039V probably benign Het
Dst A C 1: 34,194,518 K3436Q probably damaging Het
Dtx1 C A 5: 120,681,351 G594V probably damaging Het
Duox2 G T 2: 122,293,452 P417Q probably damaging Het
Dusp1 CT C 17: 26,507,195 probably null Het
Dusp10 G C 1: 184,068,992 E319Q probably damaging Het
Dusp4 G T 8: 34,808,090 S121I probably benign Het
Dvl1 G T 4: 155,847,637 probably benign Het
Dvl3 G T 16: 20,517,088 probably benign Het
Dynap C A 18: 70,241,030 V142L unknown Het
Dync1h1 G A 12: 110,637,554 D2304N probably damaging Het
Dync1h1 G GT 12: 110,641,177 probably null Het
Dync1h1 G T 12: 110,658,517 E3793* probably null Het
Dync1i1 G A 6: 5,767,057 V46I probably benign Het
Dync2h1 C A 9: 7,102,427 G2658C probably damaging Het
Dyrk1a G T 16: 94,691,580 probably null Het
Dysf G A 6: 84,064,523 M171I probably benign Het
Dysf G T 6: 84,087,817 V478L probably benign Het
Dytn G A 1: 63,633,454 R597* probably null Het
Dyx1c1 G T 9: 72,961,964 R152L possibly damaging Het
Dzip1 T A 14: 118,911,376 K297I probably damaging Het
Dzip1l G T 9: 99,665,854 Q720H probably null Het
E130308A19Rik T A 4: 59,720,223 I585K probably benign Het
E2f8 A T 7: 48,875,546 I226K probably benign Het
Eaf2 A T 16: 36,824,662 I66K probably damaging Het
Ear6 C G 14: 51,854,255 C86W probably damaging Het
Ear6 A AT 14: 51,854,403 probably null Het
Ecd C T 14: 20,337,019 G216S possibly damaging Het
Ecm1 T C 3: 95,734,876 I466V probably benign Het
Ect2l C A 10: 18,172,672 R267L probably null Het
Eddm3b G A 14: 51,116,722 V56I probably damaging Het
Eddm3b C A 14: 51,116,989 L145I probably benign Het
Edil3 G T 13: 88,822,012 V11F probably benign Het
Edn1 C A 13: 42,303,631 P47T possibly damaging Het
Eed C A 7: 89,980,514 R4S probably benign Het
Eed C A 7: 89,980,515 R4M probably benign Het
Eef1d C A 15: 75,902,878 A311S possibly damaging Het
Eef2k G A 7: 120,858,453 G12S probably damaging Het
Efcab14 G T 4: 115,738,702 G15V probably damaging Het
Efcab8 G T 2: 153,798,680 D354Y probably null Het
Efemp1 A T 11: 28,867,909 E129D probably benign Het
Efhb C A 17: 53,437,126 R479L possibly damaging Het
Efhb G C 17: 53,437,183 A460G probably benign Het
Efhd2 C A 4: 141,874,683 R62L probably damaging Het
Efnb1 G T X: 99,147,504 A339S probably damaging Het
Efnb2 C A 8: 8,623,147 probably null Het
Egfem1 C A 3: 29,148,453 P66T probably benign Het
Egfr A T 11: 16,862,954 I145F probably benign Het
Egfr G T 11: 16,869,319 G283V probably damaging Het
Egln2 C T 7: 27,164,990 S170N probably benign Het
Egr1 G C 18: 34,863,230 R355P probably damaging Het
Ehbp1l1 C A 19: 5,718,762 G838W probably damaging Het
Ehbp1l1 C A 19: 5,719,101 A725S probably benign Het
Ehbp1l1 C T 19: 5,719,102 M724I probably benign Het
Ehbp1l1 C G 19: 5,719,434 A614P probably benign Het
Ehd2 T A 7: 15,957,905 probably null Het
Ehd3 G T 17: 73,830,105 G423V probably benign Het
Ehhadh C A 16: 21,762,288 W651C probably damaging Het
Eif2a G T 3: 58,531,120 G21V probably damaging Het
Eif2b2 G C 12: 85,219,564 M1I probably null Het
Eif2b2 G C 12: 85,223,415 G243A probably damaging Het
Eif3b G T 5: 140,430,128 G401C probably damaging Het
Eif3h C A 15: 51,865,438 G7V probably damaging Het
Eif3m C T 2: 105,001,274 D314N probably damaging Het
Eif4g1 G A 16: 20,683,905 D988N probably benign Het
Eif4g1 GT GTT 16: 20,686,366 probably null Het
Elfn1 G T 5: 139,972,308 V356L probably benign Het
Elmod2 T A 8: 83,317,777 S186C possibly damaging Het
Elmod2 C A 8: 83,321,501 D111Y probably damaging Het
Elmod3 T A 6: 72,566,689 H373L probably benign Het
Elmsan1 G C 12: 84,152,991 A985G probably benign Het
Elmsan1 C A 12: 84,162,358 E657* probably null Het
Eln C T 5: 134,718,026 G420E unknown Het
Elovl2 C A 13: 41,189,978 W158L probably damaging Het
Elovl6 G T 3: 129,605,112 R54L probably damaging Het
Emilin3 T A 2: 160,907,801 Q676L probably damaging Het
Eml1 G T 12: 108,423,139 probably benign Het
Eml1 G T 12: 108,534,656 G637W probably damaging Het
Eml3 A T 19: 8,937,561 probably null Het
En1 G T 1: 120,603,453 A141S probably benign Het
En1 G T 1: 120,603,663 A211S unknown Het
En1 G T 1: 120,607,005 R341L unknown Het
Engase G T 11: 118,485,757 R473S possibly damaging Het
Enox1 C T 14: 77,668,747 T522I probably benign Het
Enpep C A 3: 129,276,680 W859C probably damaging Het
Enpp1 C A 10: 24,661,942 V382F probably damaging Het
Entpd7 G T 19: 43,725,497 G432C probably damaging Het
Ep300 ACCC ACCCC 15: 81,630,097 probably null Het
Ep400 C A 5: 110,683,364 K2181N unknown Het
Ep400 C A 5: 110,733,743 R793S unknown Het
Epb41 G T 4: 132,006,083 T172N probably benign Het
Epb41l1 G T 2: 156,508,827 E347D probably benign Het
Epb41l2 G T 10: 25,479,741 C481F probably damaging Het
Epb41l4b A T 4: 57,063,191 F500I probably benign Het
Epb41l5 C A 1: 119,609,211 V317L probably damaging Het
Epb42 T A 2: 121,027,725 I251F probably damaging Het
Epha10 G T 4: 124,881,960 R29L probably damaging Het
Epha2 A G 4: 141,318,998 T503A probably benign Het
Ephb4 G T 5: 137,361,359 R397L probably benign Het
Ephx1 C A 1: 180,999,769 Q106H possibly damaging Het
Ephx2 G T 14: 66,085,325 P500T probably damaging Het
Epn2 C G 11: 61,546,424 K107N probably damaging Het
Epo C G 5: 137,485,732 probably null Het
Eps15l1 T A 8: 72,373,078 probably null Het
Eps15l1 G T 8: 72,381,437 Q414K probably benign Het
Eps8 C A 6: 137,499,581 probably null Het
Eps8l2 G C 7: 141,342,095 A29P probably benign Het
Eps8l3 G T 3: 107,881,666 probably null Het
Epx C G 11: 87,869,261 R509P probably damaging Het
Epx C A 11: 87,869,894 R404M possibly damaging Het
Epx C T 11: 87,872,767 R209H probably benign Het
Eqtn C A 4: 94,907,551 E304D probably benign Het
Erbb4 CTGT CT 1: 68,259,183 probably null Het
Erbb4 C A 1: 68,290,476 G627C probably damaging Het
Erbb4 C A 1: 68,309,643 R525L probably benign Het
Ercc3 G T 18: 32,254,161 D476Y probably damaging Het
Ergic1 G A 17: 26,654,887 V94I Het
Ermap G T 4: 119,185,561 T255K probably benign Het
Erp27 C A 6: 136,911,646 probably null Het
Esco2 C G 14: 65,824,936 probably null Het
Espnl T A 1: 91,323,555 L124H probably damaging Het
Esrrg G C 1: 188,043,555 G93A probably benign Het
Etfbkmt G C 6: 149,144,337 R63P probably damaging Het
Evi5 C A 5: 107,748,379 G733* probably null Het
Evx1 C A 6: 52,316,687 P280H probably benign Het
Exoc3l2 G T 7: 19,480,028 V460L unknown Het
Exoc8 C A 8: 124,897,186 E147D possibly damaging Het
Exog G T 9: 119,445,080 G44W unknown Het
Exog G T 9: 119,448,498 M165I probably damaging Het
Exosc10 G T 4: 148,565,386 W424C probably damaging Het
Exph5 A T 9: 53,374,213 S865C probably benign Het
Exph5 G T 9: 53,377,419 E1933D probably benign Het
Ext2 ACC AC 2: 93,703,275 probably benign Het
Eya1 C A 1: 14,184,429 G422V probably damaging Het
Eya1 G T 1: 14,253,090 T185N possibly damaging Het
Eya2 C A 2: 165,685,593 A61E probably damaging Het
F10 G A 8: 13,037,845 S15N probably benign Het
Fabp1 G T 6: 71,201,736 G66W probably damaging Het
Fam114a2 T G 11: 57,513,258 E126D probably benign Het
Fam117a G T 11: 95,375,025 R169L probably damaging Het
Fam122a T G 19: 24,476,803 Q185P probably damaging Het
Fam124b C G 1: 80,200,088 R398P probably benign Het
Fam131b C T 6: 42,318,920 V181I possibly damaging Het
Fam135b C T 15: 71,622,076 M1I probably null Het
Fam160b2 G T 14: 70,586,204 S575R not run Het
Fam168b C A 1: 34,819,882 E64* probably null Het
Fam171a1 G T 2: 3,224,934 R368L possibly damaging Het
Fam174b G A 7: 73,740,581 A27T unknown Het
Fam184a C A 10: 53,699,086 M142I probably damaging Het
Fam196b C A 11: 34,402,725 P256T probably benign Het
Fam196b G A 11: 34,403,188 C410Y probably damaging Het
Fam208a C T 14: 27,448,250 P379S probably damaging Het
Fam208b C A 13: 3,574,234 R1905S probably damaging Het
Fam221b G T 4: 43,666,039 P191T probably benign Het
Fam234b A T 6: 135,198,008 probably benign Het
Fam26e C A 10: 34,096,329 V37L probably damaging Het
Fam35a C A 14: 34,241,471 A713S probably benign Het
Fam35a T G 14: 34,268,598 Q117P probably damaging Het
Fam3b C T 16: 97,512,487 R8Q probably benign Het
Fam53a C A 5: 33,607,817 A182S probably benign Het
Fam53c G T 18: 34,770,850 E392* probably null Het
Fam71e2 G T 7: 4,757,728 L662I Het
Fam83d A T 2: 158,785,188 S266C probably damaging Het
Fam83h G A 15: 76,002,962 P842L probably benign Het
Fam83h G T 15: 76,006,541 R3S probably damaging Het
Fam90a1b C A X: 94,357,042 A61S possibly damaging Het
Fam91a1 C A 15: 58,432,548 S371Y possibly damaging Het
Fanca C T 8: 123,312,629 R181H probably benign Het
Fancb G T X: 164,982,555 C11F probably damaging Het
Fancd2 A T 6: 113,545,025 M194L probably benign Het
Fap G T 2: 62,502,446 A726E probably damaging Het
Fars2 C A 13: 36,204,731 Q68K probably benign Het
Fasn C A 11: 120,815,471 probably null Het
Fastkd2 G T 1: 63,734,836 probably null Het
Fastkd2 T C 1: 63,734,837 probably null Het
Fat2 G T 11: 55,278,966 S2989* probably null Het
Fat3 C A 9: 15,923,026 C4090F possibly damaging Het
Fat3 C A 9: 15,947,538 C3794F probably damaging Het
Fat3 G T 9: 15,965,991 T3442K possibly damaging Het
Fat3 C A 9: 15,969,835 G3247V probably damaging Het
Fat4 G T 3: 38,888,584 R542L probably damaging Het
Fat4 G T 3: 38,890,347 G1130W probably damaging Het
Fat4 C A 3: 38,981,838 T3213N probably damaging Het
Fbl G A 7: 28,174,832 G81R unknown Het
Fbn1 C A 2: 125,389,231 G472C probably damaging Het
Fbn2 G T 18: 58,010,379 T2868N probably benign Het
Fbn2 G C 18: 58,055,482 T1620S probably benign Het
Fbn2 C A 18: 58,069,190 G1297V probably damaging Het
Fbxl2 C G 9: 113,989,345 G183R probably benign Het
Fbxo15 C A 18: 84,958,308 Y57* probably null Het
Fbxo16 C A 14: 65,299,358 T227N probably damaging Het
Fbxo2 G T 4: 148,165,062 A190S possibly damaging Het
Fbxo21 G T 5: 117,989,171 D263Y probably damaging Het
Fbxo24 G C 5: 137,621,299 R222G probably damaging Het
Fbxo38 C T 18: 62,515,464 E668K probably damaging Het
Fbxo40 C A 16: 36,970,262 G162V possibly damaging Het
Fbxw11 G T 11: 32,738,480 R447L probably null Het
Fbxw14 G T 9: 109,276,246 P284T probably benign Het
Fbxw20 AC A 9: 109,225,887 probably null Het
Fbxw21 T C 9: 109,145,537 H305R probably benign Het
Fbxw27 C A 9: 109,772,178 W291C probably damaging Het
Fcrl1 A T 3: 87,389,363 Q284L probably damaging Het
Fer1l4 C G 2: 156,048,429 Q228H probably null Het
Fer1l5 G T 1: 36,409,194 W1046L probably benign Het
Fermt3 C A 19: 7,014,679 R111L probably benign Het
Fes T A 7: 80,378,030 R791W probably damaging Het
Fez1 G T 9: 36,867,759 R244L probably benign Het
Fezf2 G C 14: 12,344,765 L141V probably benign Het
Fgb G T 3: 83,045,056 Q169K probably benign Het
Fgd2 C A 17: 29,378,326 A540E probably benign Het
Fgfr1 G T 8: 25,563,398 A230S probably benign Het
Fgfr1 G T 8: 25,570,768 Q485H possibly damaging Het
Fgfr2 C T 7: 130,198,457 G368E probably damaging Het
Fgfr4 G T 13: 55,161,707 D492Y probably damaging Het
Fgfr4 A C 13: 55,165,929 E517A probably damaging Het
Fhit G C 14: 9,870,128 H51D probably benign Het
Fhod3 C A 18: 25,020,706 P415H probably damaging Het
Fign C G 2: 63,979,385 G514R probably damaging Het
Fign C T 2: 63,979,690 G412E probably damaging Het
Fitm1 G A 14: 55,576,649 A201T probably benign Het
Fjx1 C A 2: 102,450,997 A198S probably benign Het
Fkbp4 T A 6: 128,433,111 N343Y probably damaging Het
Flg2 G T 3: 93,202,420 G585V unknown Het
Flg2 G T 3: 93,202,738 G691V unknown Het
Flnc G C 6: 29,447,545 G1116R probably damaging Het
Flnc G T 6: 29,457,130 G2344C probably damaging Het
Flt3 G T 5: 147,383,401 P51Q probably benign Het
Fmo4 G T 1: 162,803,720 P226H probably benign Het
Fn3k C G 11: 121,440,274 Q197E unknown Het
Fnbp1 C A 2: 31,083,059 R143L probably damaging Het
Folh1 A T 7: 86,744,447 F385L probably damaging Het
Folh1 A T 7: 86,761,822 F237L probably benign Het
Fosl2 G C 5: 32,152,933 R242P probably damaging Het
Foxa1 G T 12: 57,542,417 T339K probably benign Het
Foxc1 G T 13: 31,807,308 G34V probably benign Het
Foxd2 C A 4: 114,907,887 G312V unknown Het
Foxf1 G T 8: 121,084,435 G13W probably damaging Het
Foxh1 G C 15: 76,669,021 N164K probably benign Het
Foxi1 G T 11: 34,207,710 P105H probably damaging Het
Foxi2 G A 7: 135,410,415 A11T probably benign Het
Foxi2 C A 7: 135,411,958 P306T probably benign Het
Foxj1 A T 11: 116,332,267 W237R probably benign Het
Foxn3 T A 12: 99,388,597 M103L probably benign Het
Foxp1 C A 6: 98,978,161 V312F unknown Het
Fras1 G T 5: 96,691,457 G1612C probably damaging Het
Fras1 G T 5: 96,700,251 E1773D possibly damaging Het
Fras1 C A 5: 96,740,811 R2739S probably benign Het
Fras1 C A 5: 96,740,983 A2796D possibly damaging Het
Fras1 T C 5: 96,758,142 L3135P probably benign Het
Frat2 C G 19: 41,847,287 A209P probably damaging Het
Frem1 C T 4: 82,940,315 probably null Het
Frem1 C A 4: 83,000,269 V479L probably benign Het
Frem1 C T 4: 83,016,464 D87N probably damaging Het
Frem2 T A 3: 53,535,166 Q2650L probably null Het
Frem2 C A 3: 53,655,607 S493I probably benign Het
Frem3 G T 8: 80,616,129 G1684C possibly damaging Het
Frk T C 10: 34,584,005 Y199H probably benign Het
Frmpd1 C A 4: 45,275,272 S475Y probably damaging Het
Frmpd2 G T 14: 33,530,451 A657S possibly damaging Het
Frmpd2 G T 14: 33,530,504 Q674H probably damaging Het
Frmpd2 A T 14: 33,530,505 K675* probably null Het
Frmpd2 A C 14: 33,543,026 M921L probably benign Het
Frmpd3 C A X: 140,362,232 D27E possibly damaging Het
Frrs1 G A 3: 116,881,818 A132T probably damaging Het
Frs2 C A 10: 117,074,379 W359C probably damaging Het
Fry C G 5: 150,310,437 R30G possibly damaging Het
Fryl T C 5: 73,041,595 probably null Het
Fscb G A 12: 64,472,628 A688V unknown Het
Fsd1 A C 17: 55,996,083 I351L probably benign Het
Fsd2 C T 7: 81,559,752 R114Q probably damaging Het
Fsip2 G C 2: 82,946,960 K110N probably damaging Het
Fsip2 G T 2: 82,984,524 D3534Y probably damaging Het
Fsip2 C A 2: 82,987,203 L4427I possibly damaging Het
Fstl3 G T 10: 79,780,108 E143* probably null Het
Fut1 C A 7: 45,619,229 S202R probably benign Het
Fyco1 C A 9: 123,828,323 E929D probably benign Het
Fyttd1 G T 16: 32,877,784 probably benign Het
Fzd4 CTT CT 7: 89,407,250 probably null Het
Fzd6 G T 15: 39,007,561 G59W possibly damaging Het
Fzd6 G A 15: 39,031,341 V301M probably damaging Het
Gabarapl1 G T 6: 129,541,221 R42L unknown Het
Gabbr1 G C 17: 37,048,424 R97P possibly damaging Het
Gabra2 C T 5: 71,007,992 G212S probably benign Het
Gad1 C A 2: 70,579,130 N188K probably damaging Het
Gad2 T G 2: 22,635,014 V270G probably benign Het
Gak AG A 5: 108,585,352 probably null Het
Galns C T 8: 122,598,523 E297K probably benign Het
Galns C A 8: 122,605,206 D57Y probably damaging Het
Galnt10 G C 11: 57,737,000 E142Q probably benign Het
Galnt15 G T 14: 32,052,365 W486L probably damaging Het
Galnt16 G A 12: 80,572,347 A76T probably benign Het
Galnt16 G T 12: 80,601,810 W552L probably damaging Het
Galnt18 G T 7: 111,485,151 P536T probably damaging Het
Galnt2 G A 8: 124,343,318 E525K probably benign Het
Galr1 C A 18: 82,405,772 A127S probably benign Het
Ganc G T 2: 120,433,794 W409C probably damaging Het
Gapvd1 T A 2: 34,699,864 K980I possibly damaging Het
Gata4 G T 14: 63,200,382 T441N probably damaging Het
Gata4 A C 14: 63,241,265 probably benign Het
Gatb G T 3: 85,636,973 R416M probably damaging Het
Gbf1 G T 19: 46,259,142 K226N probably damaging Het
Gbgt1 C A 2: 28,505,188 C279* probably null Het
Gbp2b C A 3: 142,604,316 P289Q possibly damaging Het
Gbp4 T A 5: 105,119,449 R535* probably null Het
Gbp4 C A 5: 105,125,135 G215C probably null Het
Gchfr A T 2: 119,169,745 K36* probably null Het
Gck G T 11: 5,910,958 Q38K possibly damaging Het
Gclc G T 9: 77,786,739 S325I probably benign Het
Gcn1l1 A T 5: 115,614,149 H2108L probably damaging Het
Gcnt4 G A 13: 96,946,453 G86S probably damaging Het
Gcnt7 G T 2: 172,454,886 T6N possibly damaging Het
Gdf2 G T 14: 33,945,317 R332M probably damaging Het
Gdf5 C T 2: 155,942,072 G320D possibly damaging Het
Gdpd2 T A X: 100,733,982 C214S probably damaging Het
Gfer TCCC TCC 17: 24,695,887 probably null Het
Gfm2 C A 13: 97,162,992 T407K possibly damaging Het
Gfm2 G T 13: 97,162,993 probably null Het
Gfra2 A T 14: 70,978,492 Q464L not run Het
Gfral G C 9: 76,205,389 L87V probably benign Het
Gfy CGGG CGG 7: 45,176,464 probably null Het
Ggcx G C 6: 72,426,519 G350R probably benign Het
Ggt6 C A 11: 72,436,599 R103S probably benign Het
Gimap5 G T 6: 48,752,885 V130L possibly damaging Het
Gimap7 AG A 6: 48,724,321 probably null Het
Gimd1 G T 3: 132,635,070 V116L probably benign Het
Gipr G T 7: 19,157,565 Q396K probably benign Het
Gja8 G C 3: 96,920,236 L37V probably damaging Het
Gjb4 T A 4: 127,352,127 Q7L possibly damaging Het
Gjc2 A T 11: 59,177,617 L13Q probably damaging Het
Gjc3 C A 5: 137,957,561 G154V probably damaging Het
Glb1 G C 9: 114,420,422 E106D probably damaging Het
Glb1l3 A T 9: 26,818,245 L642Q probably damaging Het
Gldc C A 19: 30,110,778 G827C probably damaging Het
Gldc C A 19: 30,110,779 M826I probably damaging Het
Gldc A T 19: 30,145,748 V249D possibly damaging Het
Gldn C G 9: 54,286,660 A46G probably benign Het
Gli1 T A 10: 127,334,257 K343M probably damaging Het
Gli1 G C 10: 127,335,998 R296G probably damaging Het
Gli1 G T 10: 127,336,691 P194Q probably benign Het
Glipr1l1 C A 10: 112,078,390 H219N probably benign Het
Glra4 C A X: 136,757,817 R417L possibly damaging Het
Glrp1 C T 1: 88,509,802 G29R not run Het
Glud1 C T 14: 34,310,869 probably benign Het
Glyr1 C A 16: 5,031,973 D179Y probably null Het
Gm10324 A G 13: 66,122,394 K458R probably damaging Het
Gm10378 G T 14: 42,657,124 M76I Het
Gm10382 C A 5: 125,389,424 P35T unknown Het
Gm10696 G T 3: 94,176,102 P134Q probably benign Het
Gm11397 C A 13: 33,404,510 F359L possibly damaging Het
Gm11492 C G 11: 87,567,922 T374R probably benign Het
Gm11559 CTGTGTGT CTGTGT 11: 99,864,763 probably null Het
Gm11639 C A 11: 104,739,338 S965* probably null Het
Gm11639 C A 11: 104,820,518 T1860K probably benign Het
Gm11639 C A 11: 104,924,019 A3243D unknown Het
Gm11808 G C 4: 3,973,193 P123R probably benign Het
Gm12185 C T 11: 48,916,302 V21M probably benign Het
Gm12394 G C 4: 42,793,428 P235A probably damaging Het
Gm12394 C T 4: 42,793,520 R204H probably damaging Het
Gm12666 C A 4: 92,191,236 S116I possibly damaging Het
Gm12666 A T 4: 92,191,703 F16Y probably damaging Het
Gm12695 C A 4: 96,749,223 K352N probably damaging Het
Gm12794 A T 4: 101,941,125 K98* probably null Het
Gm12886 A T 4: 121,416,719 L100* probably null Het
Gm13023 C A 4: 143,794,981 A389D probably damaging Het
Gm13083 C T 4: 143,616,160 T279I probably benign Het
Gm13084 C A 4: 143,812,018 V128F probably benign Het
Gm13101 C A 4: 143,965,591 G280V probably benign Het
Gm13101 T A 4: 143,965,775 T219S probably benign Het
Gm13102 G C 4: 144,109,302 M513I unknown Het
Gm13119 A G 4: 144,362,973 H287R possibly damaging Het
Gm13128 C A 4: 144,331,193 D123E probably benign Het
Gm13178 G C 4: 144,703,646 L258V possibly damaging Het
Gm13889 C G 2: 93,956,825 E101D unknown Het
Gm13941 T A 2: 111,094,778 D160V unknown Het
Gm14124 C G 2: 150,268,317 A309G possibly damaging Het
Gm14124 G T 2: 150,268,324 K311N possibly damaging Het
Gm14569 G T X: 36,433,871 P395Q probably benign Het
Gm15557 G T 2: 155,942,468 A226S probably benign Het
Gm15737 G T 6: 92,879,891 W100C unknown Het
Gm16486 C G 8: 70,717,103 R1281G possibly damaging Het
Gm17019 A C 5: 15,032,931 L3W probably damaging Het
Gm17067 A C 7: 42,708,298 V260G probably benign Het
Gm17455 G T 10: 60,403,015 A20S probably benign Het
Gm18596 C T 10: 77,742,621 M6I unknown Het
Gm19410 A T 8: 35,808,965 Q1592L possibly damaging Het
Gm20379 C G 13: 92,306,159 P60R unknown Het
Gm21083 T G 5: 15,577,458 V41G probably benign Het
Gm21149 G T 5: 15,472,148 A236D probably damaging Het
Gm21149 G C 5: 15,476,412 R18G not run Het
Gm21188 C T 13: 120,034,952 C127Y possibly damaging Het
Gm21190 G A 5: 15,524,894 P242L probably benign Het
Gm21190 A C 5: 15,524,974 D215E not run Het
Gm21190 G T 5: 15,525,807 Q184K probably benign Het
Gm21680 A T 5: 25,972,495 S32T probably benign Het
Gm21731 C A 13: 120,241,172 P168Q unknown Het
Gm281 G T 14: 13,823,754 T807N Het
Gm281 G T 14: 13,845,421 P497Q Het
Gm28710 C A 5: 16,835,979 H591Q possibly damaging Het
Gm28710 G T 5: 16,856,724 D823Y probably damaging Het
Gm28729 C A 9: 96,497,007 probably null Het
Gm29776 C G 14: 54,696,508 D205H probably damaging Het
Gm30302 G T 13: 49,787,175 P353H probably benign Het
Gm32742 T A 9: 51,149,306 H899L probably benign Het
Gm32742 C T 9: 51,158,276 probably null Het
Gm3327 G T 14: 44,124,800 G52V Het
Gm3404 C A 5: 146,526,216 Y69* probably null Het
Gm35339 G A 15: 76,354,930 R69H Het
Gm35339 G T 15: 76,363,130 E1530D Het
Gm38394 C A 1: 133,659,116 G161V probably damaging Het
Gm40460 A T 7: 142,240,772 C103S unknown Het
Gm40460 C T 7: 142,240,906 S58N unknown Het
Gm4131 T A 14: 62,481,022 H45L possibly damaging Het
Gm42669 C A 5: 107,578,590 Q558K unknown Het
Gm43302 T A 5: 105,276,796 Q326L probably damaging Het
Gm44511 T A 6: 128,820,338 probably null Het
Gm4559 C A 7: 142,274,034 Q110H unknown Het
Gm45837 G A 7: 101,451,465 A51T probably benign Het
Gm45861 G C 8: 27,535,369 E772Q unknown Het
Gm45861 G T 8: 27,569,951 G1147C unknown Het
Gm4756 C A 12: 72,628,738 G39V probably damaging Het
Gm4847 G C 1: 166,634,773 L383V probably damaging Het
Gm4869 G C 5: 140,446,422 Q39H probably damaging Het
Gm4869 A T 5: 140,460,860 probably null Het
Gm4869 G C 5: 140,478,985 R619P probably damaging Het
Gm4884 G T 7: 41,032,737 probably benign Het
Gm4894 C T 9: 49,278,779 A118V unknown Het
Gm49358 G T 10: 86,811,582 G88V Het
Gm49368 G T 7: 128,113,067 G825V probably damaging Het
Gm4951 C G 18: 60,246,296 T301S probably benign Het
Gm5114 G T 7: 39,409,326 Q290K probably benign Het
Gm5145 G T 17: 20,571,052 G231C probably damaging Het
Gm5148 G A 3: 37,715,005 A22V probably benign Het
Gm5157 C T 7: 21,185,316 E101K probably benign Het
Gm5294 G T 5: 138,821,495 S176I probably damaging Het
Gm5346 C A 8: 43,626,546 V214L probably damaging Het
Gm5460 C G 14: 34,045,834 C191W probably benign Het
Gm5678 C A 16: 93,629,932 S140R probably damaging Het
Gm5737 G T 7: 120,814,534 D97Y probably damaging Het
Gm5797 G A 14: 7,329,383 Q202* probably null Het
Gm5868 G T 5: 72,586,346 H10N probably benign Het
Gm5936 G A X: 74,842,553 A520T possibly damaging Het
Gm6358 T A 16: 89,141,087 C71* probably null Het
Gm6583 G C 5: 112,354,918 H307D probably damaging Het
Gm6588 C A 5: 112,450,006 L140M probably damaging Het
Gm6588 TACACA TACA 5: 112,450,961 probably null Het
Gm6592 C A X: 8,846,184 S120R probably benign Het
Gm6614 A T 6: 141,994,202 S192T probably damaging Het
Gm6970 G A 19: 47,171,131 P2S probably benign Het
Gm7102 CGGGG CGGG 19: 61,175,750 probably null Het
Gm7168 G C 17: 13,949,082 G237A probably damaging Het
Gm7168 G A 17: 13,949,670 C433Y probably damaging Het
Gm7168 A T 17: 13,949,757 K462M probably benign Het
Gm7361 C G 5: 26,261,188 H183D probably benign Het
Gm765 G C 6: 98,238,240 H141D probably benign Het
Gm8297 G T 14: 4,986,822 R150L probably benign Het
Gm8332 G C 12: 88,249,802 A100G possibly damaging Het
Gm8765 C A 13: 50,702,144 P606H probably damaging Het
Gm8909 C A 17: 36,165,712 G262V probably damaging Het
Gm8947 C A 1: 151,192,584 S56Y possibly damaging Het
Gm9195 C A 14: 72,443,002 L2207F possibly damaging Het
Gm9195 AGGGGG AGGGGGGG 14: 72,453,434 probably null Het
Gm9573 G T 17: 35,620,925 P790T unknown Het
Gm9573 G T 17: 35,621,059 P745H unknown Het
Gm973 C T 1: 59,541,330 A124V probably damaging Het
Gm9758 C T 5: 14,910,585 A212T Het
Gm9758 T A 5: 14,911,458 Q169L possibly damaging Het
Gm9758 C G 5: 14,913,539 V92L probably benign Het
Gm9805 A G 17: 22,689,871 Y34C probably benign Het
Gm9958 G T 5: 90,367,998 R52M unknown Het
Gna13 G T 11: 109,396,202 V284F probably damaging Het
Gnai1 C A 5: 18,308,552 probably null Het
Gnas G T 2: 174,284,887 A72S unknown Het
Gnat2 T A 3: 108,100,044 F259L Het
Gnat3 C A 5: 18,015,313 C224* probably null Het
Gnaz G T 10: 75,014,960 K272N Het
Gnpat G A 8: 124,863,296 S20N probably benign Het
Gnptab G T 10: 88,440,270 A1140S probably damaging Het
Golga5 A T 12: 102,472,005 probably benign Het
Gon4l C T 3: 88,859,036 P461S probably damaging Het
Gopc C T 10: 52,350,663 G277S probably damaging Het
Gp1ba C G 11: 70,639,407 probably benign Het
Gpatch2 G T 1: 187,225,691 W81L probably damaging Het
Gpc1 G T 1: 92,857,486 K382N probably damaging Het
Gpha2 C G 19: 6,227,023 H51Q probably damaging Het
Gpi1 C A 7: 34,205,645 probably null Het
Gpkow C T X: 7,697,292 R23C probably damaging Het
Gpr1 G T 1: 63,183,639 H146N probably benign Het
Gpr108 C A 17: 57,237,316 G365C probably damaging Het
Gpr139 C A 7: 119,144,513 R283L possibly damaging Het
Gpr141 C A 13: 19,752,444 A54S possibly damaging Het
Gpr149 CA C 3: 62,603,959 probably null Het
Gpr150 G T 13: 76,056,150 Y225* probably null Het
Gpr156 G T 16: 38,004,863 A481S probably benign Het
Gpr158 A T 2: 21,827,272 D1061V possibly damaging Het
Gpr17 C A 18: 31,947,664 M115I possibly damaging Het
Gpr174 T A X: 107,293,193 C204S possibly damaging Het
Gpr179 G T 11: 97,351,239 L260I probably damaging Het
Gpr180 G T 14: 118,148,201 G142W probably damaging Het
Gpr35 G T 1: 92,983,016 W150L probably benign Het
Gpr62 A T 9: 106,465,489 V80E possibly damaging Het
Gpr87 C A 3: 59,180,070 V6L probably benign Het
Gprc6a C A 10: 51,615,209 V815L probably damaging Het
Gprin2 G A 14: 34,195,123 P230L probably damaging Het
Greb1 C A 12: 16,702,491 G950V probably damaging Het
Grem1 C G 2: 113,749,649 R169T possibly damaging Het
Grhl2 G T 15: 37,333,287 G429W unknown Het
Grhl3 G C 4: 135,552,686 I352M possibly damaging Het
Grid2 T A 6: 64,345,856 Y613* probably null Het
Grid2 G T 6: 64,345,857 G614W probably damaging Het
Grik1 C T 16: 87,946,684 G537S Het
Grik3 C A 4: 125,650,506 A340E possibly damaging Het
Grik5 T A 7: 25,015,825 T674S probably damaging Het
Grin2a C A 16: 9,663,577 K453N possibly damaging Het
Grin2d C A 7: 45,833,177 G1192V unknown Het
Grip1 G T 10: 119,986,444 M437I probably benign Het
Grm2 C A 9: 106,645,065 V580F possibly damaging Het
Grm4 C A 17: 27,450,194 E367* probably null Het
Grm4 G T 17: 27,450,221 R358S probably benign Het
Grm6 G C 11: 50,851,262 V41L probably benign Het
Grm6 C T 11: 50,851,500 A120V probably benign Het
Grm6 A T 11: 50,859,867 Y619F probably damaging Het
Grpel2 C T 18: 61,719,772 G53E possibly damaging Het
Grrp1 G T 4: 134,251,570 T199K probably benign Het
Gsap G T 5: 21,251,032 R409I probably damaging Het
Gse1 A C 8: 120,229,852 T361P unknown Het
Gsg1l C A 7: 126,082,242 probably benign Het
Gsk3a C A 7: 25,237,528 G45C unknown Het
Gsta1 G T 9: 78,232,242 M1I probably null Het
Gstp2 C T 19: 4,041,583 probably null Het
Gstp3 C G 19: 4,058,154 V90L probably benign Het
Gtf3c1 C T 7: 125,667,122 S1014N probably benign Het
Gtf3c4 T A 2: 28,835,073 S216C probably damaging Het
Gtpbp3 A T 8: 71,489,069 probably null Het
Gtse1 G T 15: 85,875,737 A710S probably damaging Het
Guca1a T C 17: 47,400,410 I4V probably benign Het
Gucy1a2 C T 9: 3,797,245 T565I probably damaging Het
Gucy1b1 G T 3: 82,061,112 A29E probably damaging Het
Gucy1b2 C A 14: 62,453,453 G42C unknown Het
Gucy2c C A 6: 136,719,687 R704L probably damaging Het
Gucy2c G T 6: 136,767,196 T135K probably benign Het
Gucy2g C T 19: 55,210,377 R778H probably benign Het
Gusb C T 5: 130,002,736 M27I probably benign Het
Gykl1 G T 18: 52,695,132 V471L possibly damaging Het
Gypa C A 8: 80,500,998 H92N unknown Het
Gzmm TGG T 10: 79,695,006 probably null Het
H1fnt G T 15: 98,257,247 P7H probably damaging Het
H2afy2 T G 10: 61,739,350 S356R probably damaging Het
H2-M10.3 G T 17: 36,366,579 A269D probably damaging Het
H2-M10.3 C A 17: 36,367,544 G130W probably damaging Het
H2-Q2 C G 17: 35,342,342 R4G unknown Het
H2-Q5 G T 17: 35,394,504 R71L Het
H2-Q7 G T 17: 35,439,162 probably benign Het
H2-Q7 G T 17: 35,442,500 V282L probably damaging Het
H3f3b C G 11: 116,023,907 G35R probably benign Het
Habp2 G GT 19: 56,319,553 probably null Het
Habp4 T G 13: 64,174,068 V173G probably benign Het
Habp4 G C 13: 64,174,070 D174H probably damaging Het
Hal G T 10: 93,489,335 E69* probably null Het
Hand2 G A 8: 57,322,013 S36N probably benign Het
Hao2 C A 3: 98,881,942 Q143H probably benign Het
Hao2 G T 3: 98,882,041 S110R probably damaging Het
Hars2 A T 18: 36,789,575 E387V probably damaging Het
Hars2 G T 18: 36,790,598 V481L possibly damaging Het
Has2 C A 15: 56,681,583 V208L probably benign Het
Has3 C G 8: 106,874,018 H37Q probably benign Het
Haus4 C A 14: 54,549,960 L44F probably damaging Het
Havcr1 C T 11: 46,775,498 L263F probably benign Het
Hbb-bt G C 7: 103,813,589 I55M possibly damaging Het
Hc T A 2: 35,013,610 S1011C probably damaging Het
Hcar2 G T 5: 123,865,206 P78Q probably damaging Het
Hcrtr1 C A 4: 130,133,873 E263* probably null Het
Hdac11 G T 6: 91,167,834 R148L possibly damaging Het
Hdac3 C A 18: 37,945,751 E102D probably benign Het
Hdac4 C A 1: 91,956,047 D870Y probably damaging Het
Hdac4 A T 1: 91,987,611 N303K probably damaging Het
Hdac6 C A X: 7,937,985 E450* probably null Het
Hdgfl2 G T 17: 56,099,343 G576V unknown Het
Heatr4 C G 12: 83,980,478 A2P probably benign Het
Heatr6 G T 11: 83,766,081 A390S probably benign Het
Heatr6 G T 11: 83,781,382 R1072L probably damaging Het
Hectd3 G T 4: 116,998,760 D419Y probably damaging Het
Hectd4 T A 5: 121,358,320 M3925K probably benign Het
Hecw2 T A 1: 53,923,943 Q803L possibly damaging Het
Heg1 G T 16: 33,720,687 G405C probably damaging Het
Helb T G 10: 120,092,690 probably null Het
Helz2 C A 2: 181,235,961 G1015C probably damaging Het
Hemgn G A 4: 46,400,693 L56F possibly damaging Het
Hepacam2 G T 6: 3,483,352 T219N probably benign Het
Hephl1 A C 9: 15,090,054 D258E probably damaging Het
Herc1 G A 9: 66,458,425 S354N probably null Het
Herc1 G A 9: 66,471,911 S3493N probably damaging Het
Herc2 G T 7: 56,121,589 R1033L possibly damaging Het
Herc2 G A 7: 56,131,292 G1235D probably benign Het
Herpud2 C G 9: 25,130,622 V85L not run Het
Hes5 G T 4: 154,961,442 G91C probably damaging Het
Hfe C A 13: 23,706,037 W251L probably damaging Het
Hfe2 G A 3: 96,527,197 R84Q possibly damaging Het
Hfe2 G T 3: 96,528,087 M220I probably benign Het
Hfm1 C G 5: 106,871,820 D1116H probably benign Het
Hgd T G 16: 37,589,719 L39R probably damaging Het
Hgs A T 11: 120,478,565 Q360L probably benign Het
Hhat C A 1: 192,661,492 probably null Het
Hhip GCCCC GCCCCC 8: 80,057,251 probably null Het
Hhla1 G A 15: 65,941,775 T236I probably damaging Het
Hibadh C A 6: 52,619,995 D155Y probably damaging Het
Hid1 G T 11: 115,352,725 S499Y probably damaging Het
Hip1 C A 5: 135,428,606 R722I probably benign Het
Hira G T 16: 18,912,149 K199N probably damaging Het
Hist1h1c G T 13: 23,739,219 G124V unknown Het
Hist1h2ag C A 13: 22,042,804 E42* probably null Het
Hist1h2ah C G 13: 22,035,350 G68A probably damaging Het
Hist1h3a C T 13: 23,762,022 C111Y probably damaging Het
Hist1h3a C A 13: 23,762,250 G35V possibly damaging Het
Hist1h3f G T 13: 23,544,556 K24N probably damaging Het
Hist1h3i C T 13: 21,783,103 V90I probably benign Het
Hist2h3c2 G T 3: 96,238,548 R132S probably damaging Het
Hivep1 G T 13: 42,159,981 R1899M possibly damaging Het
Hivep2 G A 10: 14,131,786 G1376E probably damaging Het
Hivep2 G T 10: 14,143,307 V1941F probably damaging Het
Hivep3 G T 4: 120,095,946 R486S possibly damaging Het
Hivep3 G T 4: 120,131,778 E1809* probably null Het
Hk3 C A 13: 55,010,708 G615C probably damaging Het
Hk3 A G 13: 55,010,710 L614P probably damaging Het
Hmces G T 6: 87,936,130 W289L possibly damaging Het
Hmcn2 G T 2: 31,344,506 G311V probably damaging Het
Hmcn2 C A 2: 31,426,824 S3805Y probably damaging Het
Hmox2 G T 16: 4,757,128 probably benign Het
Hmx2 GC G 7: 131,555,534 probably null Het
Hmx3 G T 7: 131,543,120 R53L probably benign Het
Hnrnpa2b1 C A 6: 51,464,529 S247I unknown Het
Hnrnpc C A 14: 52,077,429 R180M possibly damaging Het
Hnrnpll C A 17: 80,048,610 R316L probably benign Het
Hnrnpm C A 17: 33,646,745 G637V probably damaging Het
Hnrnpm C A 17: 33,658,401 M368I probably benign Het
Hoxa11 C A 6: 52,245,110 E204* probably null Het
Hoxa4 G A 6: 52,191,636 P18L unknown Het
Hoxb2 C A 11: 96,351,989 A60D probably damaging Het
Hoxd11 G T 2: 74,682,415 G8V probably damaging Het
Hoxd9 C A 2: 74,698,525 P157Q probably benign Het
Hp1bp3 C T 4: 138,221,673 L16F not run Het
Hpf1 A G 8: 60,895,635 H128R probably damaging Het
Hps1 C A 19: 42,755,696 V693L probably benign Het
Hps1 C A 19: 42,759,831 G552C probably damaging Het
Hps1 T G 19: 42,766,218 probably null Het
Hps3 C A 3: 20,008,901 G833C probably damaging Het
Hps4 G T 5: 112,370,377 G412V probably damaging Het
Hrc C T 7: 45,336,970 P515L probably benign Het
Hrg G T 16: 22,953,712 W90C probably damaging Het
Hsd17b1 G T 11: 101,079,745 D209Y probably damaging Het
Hsd17b4 G A 18: 50,181,980 V605M probably benign Het
Hsf5 G T 11: 87,638,133 G565* probably null Het
Hsp90aa1 G A 12: 110,693,466 P396L probably damaging Het
Hspa1l C T 17: 34,978,016 R344C probably benign Het
Hspa8 A C 9: 40,802,802 K159Q probably damaging Het
Hspa8 G A 9: 40,802,805 D160N probably damaging Het
Hspa9 C A 18: 34,943,145 Q371H possibly damaging Het
Hspd1 T G 1: 55,080,266 T351P probably damaging Het
Hspg2 G T 4: 137,550,467 G2959V probably damaging Het
Hspg2 C A 4: 137,564,518 L3975I probably damaging Het
Hspg2 G T 4: 137,568,373 Q4239H possibly damaging Het
Htatsf1 A G X: 57,065,713 E378G probably damaging Het
Htr1a T G 13: 105,444,876 L208R probably damaging Het
Htr4 C G 18: 62,437,608 Q245E probably benign Het
Htr5b C T 1: 121,527,739 D151N probably damaging Het
Htra2 C T 6: 83,053,756 D190N probably damaging Het
Htt G T 5: 34,852,231 A1519S probably null Het
Hunk G T 16: 90,481,321 K415N possibly damaging Het
Hus1b C A 13: 30,946,992 R228L probably benign Het
Hydin C A 8: 110,380,610 P473Q probably damaging Het
Hydin C A 8: 110,450,232 H973Q possibly damaging Het
Hydin CG C 8: 110,587,142 probably null Het
Hydin T A 8: 110,609,989 C5133S probably benign Het
Hykk G T 9: 54,946,429 W345L possibly damaging Het
Iars2 T A 1: 185,315,895 R547* probably null Het
Icam5 G T 9: 21,035,548 L457F possibly damaging Het
Idh3a G T 9: 54,596,149 R164L probably damaging Het
Idi1 G T 13: 8,888,019 R167L probably damaging Het
Idua G C 5: 108,679,584 G128R probably null Het
Idua AGG AG 5: 108,680,623 probably null Het
Ifi207 C A 1: 173,729,579 G531V probably damaging Het
Ifi27l2b C A 12: 103,455,860 V82F probably damaging Het
Ifi44 G T 3: 151,749,438 T50N probably damaging Het
Ifi47 G T 11: 49,096,275 E290* probably null Het
Ifna13 C A 4: 88,644,378 R3M probably benign Het
Igf2bp3 G T 6: 49,214,428 P15H possibly damaging Het
Igf2r G T 17: 12,697,399 L1691M probably damaging Het
Igfn1 C A 1: 135,955,809 G2653V probably damaging Het
Igfn1 C A 1: 135,969,567 W1087L probably benign Het
Igfn1 C T 1: 135,982,426 C140Y possibly damaging Het
Ighg2c C A 12: 113,287,680 L238F Het
Ighmbp2 C A 19: 3,265,635 R595L probably damaging Het
Ighmbp2 C A 19: 3,267,242 Q543H probably null Het
Ighmbp2 C A 19: 3,271,665 E365* probably null Het
Ighv1-23 A C 12: 114,764,685 L39R probably damaging Het
Ighv1-4 G T 12: 114,487,404 A28D possibly damaging Het
Ighv1-58 C T 12: 115,312,324 E65K possibly damaging Het
Ighv16-1 T C 12: 114,069,125 E19G possibly damaging Het
Ighv1-64 G A 12: 115,507,666 T77I probably benign Het
Ighv1-69 A C 12: 115,623,253 S87A probably benign Het
Ighv1-72 C T 12: 115,758,201 G45D probably damaging Het
Ighv1-9 C A 12: 114,583,699 S74I probably benign Het
Ighv2-3 G C 12: 113,611,591 C9W possibly damaging Het
Ighv7-3 C G 12: 114,153,288 V85L probably benign Het
Igkv1-117 C A 6: 68,121,594 C42* probably null Het
Igkv13-84 AGG AG 6: 68,939,860 probably null Het
Igkv3-2 G T 6: 70,699,015 E103* probably null Het
Igkv3-2 A T 6: 70,699,046 Q113L probably benign Het
Igkv3-5 C A 6: 70,663,670 A45D probably damaging Het
Igkv4-79 C T 6: 69,043,059 G91R probably damaging Het
Igkv8-19 T A 6: 70,340,921 E107V probably damaging Het
Igkv8-19 C T 6: 70,340,922 E107K possibly damaging Het
Iglv3 G A 16: 19,241,452 T42I probably damaging Het
Igsf10 C A 3: 59,329,605 E1052* probably null Het
Igsf5 C A 16: 96,378,333 Q209K probably benign Het
Igsf9 C A 1: 172,494,872 P545T probably damaging Het
Igsf9b C A 9: 27,334,292 P1185H probably damaging Het
Ikzf4 C A 10: 128,642,640 R92L possibly damaging Het
Il10 G C 1: 131,021,395 A98P probably damaging Het
Il17rd A C 14: 27,100,261 H648P probably damaging Het
Il17re G T 6: 113,464,792 R216L possibly damaging Het
Il1b C A 2: 129,369,745 E18D probably benign Het
Il1rapl1 C A X: 86,748,464 D417Y probably damaging Het
Il20 C T 1: 130,911,387 probably benign Het
Il22ra1 C A 4: 135,737,406 P141H probably damaging Het
Il25 G T 14: 54,935,207 G120C probably damaging Het
Il27ra TCCC TCC 8: 84,040,975 probably null Het
Il31 C A 5: 123,480,579 W111L probably benign Het
Il31 G T 5: 123,480,705 S69* probably null Het
Il5ra C A 6: 106,741,134 G120* probably null Het
Il7r C T 15: 9,508,057 G393D probably benign Het
Il7r G T 15: 9,510,229 T246N probably benign Het
Ildr2 G T 1: 166,309,049 G486C probably damaging Het
Ilvbl A T 10: 78,581,124 N374Y probably damaging Het
Impa1 C A 3: 10,316,074 Q249H probably benign Het
Impa2 G T 18: 67,309,052 R114S probably benign Het
Impact G T 18: 12,988,366 R246L probably damaging Het
Ina G T 19: 47,014,911 A53S Het
Inafm1 C G 7: 16,273,217 G25A unknown Het
Incenp C A 19: 9,899,364 probably benign Het
Inpp5a T G 7: 139,525,775 L214R probably damaging Het
Inpp5j G T 11: 3,502,191 P353Q probably damaging Het
Insm2 C T 12: 55,600,356 P295L probably benign Het
Insrr C G 3: 87,800,827 S192W possibly damaging Het
Ints1 C A 5: 139,771,638 V375L possibly damaging Het
Ints3 C T 3: 90,406,356 G322S probably damaging Het
Ints5 G T 19: 8,894,935 R86L probably benign Het
Ints5 G T 19: 8,894,973 G99C probably damaging Het
Ints7 G T 1: 191,610,458 S522I probably benign Het
Intu A T 3: 40,697,516 H801L possibly damaging Het
Ipo8 T G 6: 148,796,712 K604Q probably damaging Het
Iqcf1 AC A 9: 106,502,114 probably null Het
Iqcg G A 16: 33,029,020 Q299* probably null Het
Iqgap3 G T 3: 88,088,971 probably null Het
Irf4 T G 13: 30,750,661 L28V probably damaging Het
Irf4 G C 13: 30,750,663 L28F probably damaging Het
Irgc1 C A 7: 24,432,955 V146L probably benign Het
Irs1 C G 1: 82,288,996 A500P possibly damaging Het
Irs1 C A 1: 82,290,394 A34S probably benign Het
Irx2 C T 13: 72,629,089 Q10* probably null Het
Ism2 A T 12: 87,280,035 W377R probably damaging Het
Isx GCCCC GCCC 8: 74,891,859 probably null Het
Itch A T 2: 155,209,059 R555S probably damaging Het
Itga1 C T 13: 114,985,071 probably null Het
Itga2 C G 13: 114,853,701 probably null Het
Itga2b C A 11: 102,467,076 G200V probably damaging Het
Itga3 C T 11: 95,056,774 G668E probably damaging Het
Itga7 G T 10: 128,943,214 W369C probably damaging Het
Itga8 C A 2: 12,300,933 S82I possibly damaging Het
Itgad C T 7: 128,189,501 P467S probably damaging Het
Itgax G T 7: 128,148,062 W982C probably benign Het
Itgb2l G T 16: 96,437,356 P81H probably damaging Het
Itgb4 T A 11: 115,986,811 L552Q probably damaging Het
Itgb4 C G 11: 115,998,058 R1076G probably benign Het
Itih1 C G 14: 30,929,572 D892H possibly damaging Het
Itm2a C A X: 107,399,128 D137Y probably damaging Het
Itpka C A 2: 119,749,421 H214N probably benign Het
Itpka C T 2: 119,750,775 R430W probably damaging Het
Itpkc TC T 7: 27,227,781 probably null Het
Itpr3 G C 17: 27,114,929 R2020P probably damaging Het
Itpr3 G A 17: 27,119,987 D2581N probably damaging Het
Jade2 C T 11: 51,816,990 D799N probably damaging Het
Jade2 C A 11: 51,848,994 G20C probably null Het
Jag1 C A 2: 137,085,019 S940I probably benign Het
Jakmip1 C T 5: 37,091,583 R196C probably damaging Het
Jakmip1 AG A 5: 37,175,307 probably null Het
Jmjd1c T C 10: 67,238,174 L1896P probably benign Het
Jmjd1c A G 10: 67,246,125 I2161M probably damaging Het
Jmjd4 G T 11: 59,450,274 E10D probably benign Het
Jph2 T A 2: 163,376,377 probably null Het
Jph4 C A 14: 55,114,926 G117C probably damaging Het
Kalrn C A 16: 34,035,506 G1920V probably damaging Het
Kank2 T A 9: 21,795,249 T158S probably damaging Het
Kat6a G T 8: 22,940,166 G1846W unknown Het
Kazn G T 4: 142,154,504 H142N Het
Kbtbd11 G C 8: 15,027,694 E98Q probably benign Het
Kbtbd12 C A 6: 88,618,668 C60F probably damaging Het
Kcna5 G T 6: 126,533,990 R392S probably damaging Het
Kcna7 G C 7: 45,409,183 R298P probably damaging Het
Kcnab1 C A 3: 65,266,510 L81I probably damaging Het
Kcnab1 C A 3: 65,357,133 H268N probably benign Het
Kcnb2 G T 1: 15,710,958 G685C possibly damaging Het
Kcnc1 C G 7: 46,397,852 R59G probably damaging Het
Kcnc2 G T 10: 112,272,306 G201W probably damaging Het
Kcnc3 G T 7: 44,596,106 G607W probably damaging Het
Kcnd2 G T 6: 21,216,416 D40Y probably damaging Het
Kcnd3 ACC A 3: 105,459,570 probably null Het
Kcnh5 G T 12: 75,007,797 L458I possibly damaging Het
Kcnh5 G C 12: 75,114,522 P204R probably damaging Het
Kcnh8 G C 17: 52,803,471 V237L probably damaging Het
Kcnh8 C G 17: 52,978,093 C1030W possibly damaging Het
Kcnip3 C A 2: 127,510,881 A73S probably benign Het
Kcnj1 C T 9: 32,397,359 L360F probably damaging Het
Kcnj10 C A 1: 172,369,135 S72Y possibly damaging Het
Kcnj10 C A 1: 172,369,221 P101T probably benign Het
Kcnj14 G T 7: 45,819,909 C57* probably null Het
Kcnj16 G T 11: 111,024,553 D14Y possibly damaging Het
Kcnj16 G A 11: 111,025,770 M419I probably benign Het
Kcnj4 C G 15: 79,485,169 W203C probably damaging Het
Kcnj5 G T 9: 32,317,698 P381H possibly damaging Het
Kcnj9 G T 1: 172,323,183 Q288K possibly damaging Het
Kcnk1 A C 8: 126,029,653 T305P probably benign Het
Kcnk12 G A 17: 87,746,043 P397L probably benign Het
Kcnk13 A T 12: 100,061,529 N288Y possibly damaging Het
Kcnk18 C CA 19: 59,225,479 probably null Het
Kcnk3 G T 5: 30,588,274 probably benign Het
Kcnk3 G C 5: 30,622,493 A296P probably benign Het
Kcnk3 G T 5: 30,622,704 G366V possibly damaging Het
Kcnk5 G C 14: 20,145,050 P124R probably damaging Het
Kcnk5 C A 14: 20,181,374 E27* probably null Het
Kcnn3 G A 3: 89,520,923 G152E probably damaging Het
Kcnn3 G T 3: 89,661,136 A574S possibly damaging Het
Kcnq1 G T 7: 143,108,464 probably benign Het
Kcnq3 G C 15: 65,995,452 R781G possibly damaging Het
Kcnt1 G T 2: 25,901,228 E528* probably null Het
Kcnt1 C T 2: 25,909,265 R949* probably null Het
Kcnt2 C A 1: 140,609,648 P1115H possibly damaging Het
Kcnu1 G T 8: 25,849,764 G37W probably damaging Het
Kcnv1 C A 15: 45,114,435 G69V probably damaging Het
Kcnv2 C A 19: 27,323,241 A164E probably benign Het
Kcp C A 6: 29,485,525 V1157L probably benign Het
Kctd12 C G 14: 102,981,918 G175R not run Het
Kctd19 G T 8: 105,388,517 H471N probably damaging Het
Kdelr1 G T 7: 45,872,948 probably benign Het
Kdm2b C A 5: 122,880,797 R860L probably damaging Het
Kdm4a C T 4: 118,147,169 D691N probably benign Het
Kdm5b AGG AG 1: 134,595,798 probably null Het
Kdm6b T A 11: 69,403,866 Q1162L unknown Het
Kdr C A 5: 75,968,475 K170N probably benign Het
Kel T A 6: 41,689,559 Q446L probably benign Het
Khdrbs2 C G 1: 32,243,967 I53M probably benign Het
Khdrbs3 G T 15: 68,928,831 R29L probably benign Het
Kif11 G T 19: 37,413,287 G904V possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif14 G T 1: 136,478,365 A556S probably benign Het
Kif15 G T 9: 122,951,051 probably benign Het
Kif16b C G 2: 142,711,824 R1018P probably damaging Het
Kif17 G T 4: 138,287,930 E463D probably benign Het
Kif18a G T 2: 109,294,957 D240Y probably damaging Het
Kif19a C A 11: 114,781,315 Q243K probably benign Het
Kif19a C G 11: 114,784,904 R401G probably benign Het
Kif1c G T 11: 70,702,893 G32C probably damaging Het
Kif20b G T 19: 34,950,466 E1043* probably null Het
Kif21b C G 1: 136,148,312 R280G probably damaging Het
Kif23 C G 9: 61,924,163 Q708H possibly damaging Het
Kif26a G T 12: 112,177,611 R1433L probably damaging Het
Kif26b C G 1: 178,821,548 A411G probably benign Het
Kif26b G T 1: 178,821,550 E412* probably null Het
Kif26b C A 1: 178,915,405 S1022* probably null Het
Kif28 C T 1: 179,728,219 R333Q not run Het
Kif3c G T 12: 3,367,245 G422V probably damaging Het
Kif5a G T 10: 127,229,823 D1013E probably benign Het
Kif5a T A 10: 127,236,967 K685* probably null Het
Kif6 G A 17: 49,715,100 A343T probably damaging Het
Kifap3 G T 1: 163,862,062 W538C probably damaging Het
Kifc2 G T 15: 76,661,288 E78D possibly damaging Het
Kirrel C A 3: 87,083,875 E629* probably null Het
Kirrel2 C A 7: 30,452,746 G479V probably benign Het
Kiz C A 2: 146,935,827 H468Q possibly damaging Het
Klb G T 5: 65,348,741 W110C probably damaging Het
Klc4 C T 17: 46,635,409 probably null Het
Klf6 G T 13: 5,864,882 E107* probably null Het
Klhdc3 C A 17: 46,676,751 R292L probably damaging Het
Klhdc7a G T 4: 139,965,662 T658N probably benign Het
Klhdc7a G C 4: 139,967,000 T212R probably benign Het
Klhl11 T A 11: 100,463,966 Q343L probably benign Het
Klhl14 G C 18: 21,652,104 Q89E probably benign Het
Klhl15 A T X: 94,252,872 R151W probably damaging Het
Klhl25 G C 7: 75,866,122 D259H possibly damaging Het
Klhl29 C A 12: 5,081,152 *876L probably null Het
Klhl3 C A 13: 58,009,409 V588L probably benign Het
Klhl38 T A 15: 58,314,936 Y546F possibly damaging Het
Klhl4 C A X: 114,551,602 S560R probably damaging Het
Klhl40 G T 9: 121,780,693 A515S probably benign Het
Klhl6 C A 16: 19,982,961 E15* probably null Het
Klhl8 C A 5: 103,886,039 R37S probably benign Het
Klk11 C A 7: 43,778,335 L183M possibly damaging Het
Klkb1 G A 8: 45,275,472 H417Y probably damaging Het
Klra3 C A 6: 130,330,121 probably null Het
Klrb1c G T 6: 128,788,447 P60Q probably damaging Het
Klrb1f G C 6: 129,052,503 G44R possibly damaging Het
Klrc2 A T 6: 129,660,417 L47Q probably benign Het
Klrg2 G A 6: 38,636,916 R51C probably damaging Het
Kmo C A 1: 175,649,186 L162I probably damaging Het
Kmt2a G T 9: 44,819,121 P3300T unknown Het
Kmt2b C A 7: 30,575,024 G2085V probably benign Het
Kmt2b G A 7: 30,584,163 P924L probably damaging Het
Kmt2b C A 7: 30,586,416 R350S unknown Het
Kmt2c C G 5: 25,295,397 probably null Het
Kmt2c C A 5: 25,300,003 A3436S probably benign Het
Kmt2c C A 5: 25,366,197 probably null Het
Kmt2e G T 5: 23,481,208 probably null Het
Kmt5c G T 7: 4,746,700 V406L probably damaging Het
Kndc1 G T 7: 139,921,912 S955I possibly damaging Het
Kng1 T G 16: 23,073,389 M234R probably benign Het
Kras C A 6: 145,246,772 G12C probably damaging Het
Krba1 G T 6: 48,413,256 W686C probably damaging Het
Krba1 G T 6: 48,415,894 R914L probably damaging Het
Krt1 C A 15: 101,846,016 G600C unknown Het
Krt1 T A 15: 101,850,535 S65C unknown Het
Krt10 G T 11: 99,386,232 H460N unknown Het
Krt12 C A 11: 99,422,104 G38V unknown Het
Krt17 A G 11: 100,259,196 Y217H probably damaging Het
Krt17 C T 11: 100,259,711 D167N possibly damaging Het
Krt2 C A 15: 101,811,550 G562* probably null Het
Krt32 G T 11: 100,084,069 R351S possibly damaging Het
Krt35 G T 11: 100,096,057 R44S probably benign Het
Krt42 C A 11: 100,267,068 R190L probably damaging Het
Krt6b C G 15: 101,678,332 E283Q probably damaging Het
Krt7 G T 15: 101,423,467 K388N probably damaging Het
Krt72 A T 15: 101,778,308 L401Q probably damaging Het
Krt73 C A 15: 101,793,811 R539I probably damaging Het
Krt75 G T 15: 101,571,054 D280E probably benign Het
Krt78 C T 15: 101,947,660 G572E probably benign Het
Krt8 T A 15: 101,999,435 E235V probably damaging Het
Krt84 TG T 15: 101,525,982 probably null Het
Krt86 G C 15: 101,476,897 R316P probably damaging Het
Krtap1-5 G C 11: 99,580,857 P37A unknown Het
Krtap28-10 C A 1: 83,042,159 G87C unknown Het
Krtap5-1 C G 7: 142,296,960 G37A unknown Het
Krtap5-2 C A 7: 142,175,781 G54V unknown Het
Krtap5-3 G T 7: 142,202,053 C209F unknown Het
Ksr2 G C 5: 117,708,200 E711Q probably damaging Het
Ksr2 C A 5: 117,747,408 Q766K probably damaging Het
Ktn1 G T 14: 47,692,438 probably null Het
L3mbtl3 C A 10: 26,280,402 E636* probably null Het
L3mbtl3 C A 10: 26,302,663 G551C unknown Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lama3 A T 18: 12,429,879 probably null Het
Lama4 G T 10: 39,005,424 G70* probably null Het
Lama4 G T 10: 39,005,425 G70V probably damaging Het
Lama5 G C 2: 180,183,630 D2450E probably benign Het
Lama5 C A 2: 180,189,419 V1816L probably damaging Het
Lama5 C A 2: 180,190,714 A1681S possibly damaging Het
Lama5 C T 2: 180,198,810 G599R probably damaging Het
Lao1 C A 4: 118,968,371 P463T probably damaging Het
Larp1 G T 11: 58,049,787 E580* probably null Het
Lars2 G T 9: 123,454,782 R705M probably damaging Het
Lbp C T 2: 158,320,306 P263S probably benign Het
Lce1b A T 3: 92,656,035 C64S unknown Het
Lce1f C T 3: 92,719,198 G51S unknown Het
Lcn12 C A 2: 25,492,241 G151C probably benign Het
Ldb3 G A 14: 34,544,103 R512W probably damaging Het
Ldlr G A 9: 21,739,830 A515T probably benign Het
Ldlrad2 G T 4: 137,574,533 R13S probably benign Het
Lef1 C A 3: 131,193,181 P257T probably damaging Het
Lefty2 C A 1: 180,894,778 P227Q possibly damaging Het
Lep T A 6: 29,071,096 Y140N probably damaging Het
Lep A C 6: 29,071,097 Y140S probably damaging Het
Lepr G T 4: 101,735,595 D136Y probably damaging Het
Lgals12 T A 19: 7,598,080 Q297L probably benign Het
Lgals4 G C 7: 28,841,497 R282P probably damaging Het
Lgr5 C G 10: 115,456,669 A511P probably benign Het
Lhcgr C A 17: 88,753,905 Q239H probably benign Het
Lhcgr C A 17: 88,764,981 probably null Het
Lhfpl1 T G X: 145,291,165 D215A probably benign Het
Lhx9 G T 1: 138,831,498 P355T probably damaging Het
Lilr4b G T 10: 51,481,349 G94C probably damaging Het
Lilra6 G T 7: 3,912,581 T385K possibly damaging Het
Limch1 G T 5: 67,028,799 W647C probably damaging Het
Limd1 G C 9: 123,480,021 A262P probably damaging Het
Lims1 T A 10: 58,409,656 I169K probably benign Het
Lin28b C A 10: 45,420,606 G99C probably damaging Het
Lin9 G C 1: 180,650,802 W58S probably benign Het
Lingo1 C T 9: 56,620,942 R127H possibly damaging Het
Lingo2 C A 4: 35,709,656 R108L probably benign Het
Lingo4 C A 3: 94,402,994 P413H probably damaging Het
Lipg T A 18: 74,941,340 probably null Het
Lipi G T 16: 75,550,287 R415S probably benign Het
Lmcd1 C A 6: 112,310,674 T107N possibly damaging Het
Lmcd1 G C 6: 112,310,676 G108R probably benign Het
Lmna G C 3: 88,486,236 L302V probably benign Het
Lmo3 C A 6: 138,416,496 C42F probably damaging Het
Lmo3 C A 6: 138,416,500 A41S probably benign Het
Lmo7 G T 14: 101,896,518 Q666H possibly damaging Het
Lmo7 G A 14: 101,898,557 D689N probably damaging Het
Lnpk C T 2: 74,573,562 M1I probably null Het
Lnx1 G T 5: 74,627,441 L73I possibly damaging Het
Loxl3 G T 6: 83,038,578 G222* probably null Het
Loxl3 A T 6: 83,048,160 T290S probably benign Het
Lpar5 T G 6: 125,082,018 L234R probably damaging Het
Lpin1 C A 12: 16,579,947 D75Y Het
Lpp G T 16: 24,661,712 D77Y probably damaging Het
Lrat G T 3: 82,903,490 P75T probably damaging Het
Lrba G C 3: 86,540,049 G2067R probably null Het
Lrfn2 CAA CAAA 17: 49,070,012 probably null Het
Lrfn2 G C 17: 49,070,095 G68A probably benign Het
Lrfn2 C A 17: 49,096,715 S622Y probably damaging Het
Lrfn3 C A 7: 30,360,659 G47V possibly damaging Het
Lrfn5 G T 12: 61,839,817 L130F probably damaging Het
Lrmp C A 6: 145,148,074 Q121K probably benign Het
Lrp10 A T 14: 54,467,561 Q107L possibly damaging Het
Lrp1b C G 2: 40,637,749 G4367R Het
Lrp1b C T 2: 41,188,848 G1864E Het
Lrp2 C T 2: 69,451,280 D3916N probably damaging Het
Lrp2 G T 2: 69,472,453 D2977E probably benign Het
Lrp2 C A 2: 69,496,468 R1753I probably damaging Het
Lrp2 C A 2: 69,501,641 R1590L probably damaging Het
Lrp2 G C 2: 69,509,289 L1093V probably benign Het
Lrp3 C A 7: 35,203,012 E568* probably null Het
Lrp5 C T 19: 3,628,345 W503* probably null Het
Lrp6 C A 6: 134,462,541 C1243F probably damaging Het
Lrp8 G C 4: 107,843,332 G156R probably benign Het
Lrrc18 T A 14: 33,008,888 L128Q probably damaging Het
Lrrc37a A T 11: 103,499,967 L1544Q possibly damaging Het
Lrrc37a A T 11: 103,500,520 S1360T probably benign Het
Lrrc37a G T 11: 103,500,598 P1334T probably benign Het
Lrrc37a G T 11: 103,503,027 P524H probably benign Het
Lrrc3c T G 11: 98,599,314 C166G probably damaging Het
Lrrc45 G T 11: 120,718,653 R414L probably benign Het
Lrrc45 A C 11: 120,718,665 E418A possibly damaging Het
Lrrc49 C T 9: 60,598,093 D632N possibly damaging Het
Lrrc4b G T 7: 44,444,979 G24W unknown Het
Lrrc4b G T 7: 44,444,980 G24V unknown Het
Lrrc4b C A 7: 44,461,911 N402K probably damaging Het
Lrrc4b G T 7: 44,462,617 G638* probably null Het
Lrrc4c G T 2: 97,630,483 E485* probably null Het
Lrrc6 T A 15: 66,469,899 K116M probably damaging Het
Lrrc71 G T 3: 87,742,821 H291N probably benign Het
Lrrc72 T A 12: 36,247,693 probably null Het
Lrrc74b C A 16: 17,558,168 probably null Het
Lrrc74b C T 16: 17,558,172 A205T probably damaging Het
Lrrc8a G T 2: 30,256,313 D380Y probably damaging Het
Lrrfip1 G T 1: 91,122,494 G516C possibly damaging Het
Lrriq4 C G 3: 30,649,996 Q58E probably benign Het
Lrrn2 G T 1: 132,937,898 E234* probably null Het
Lrrn2 T A 1: 132,938,978 W594R probably benign Het
Lrrtm4 C G 6: 80,022,717 R371G probably benign Het
Lrwd1 T A 5: 136,131,541 Q313L possibly damaging Het
Lsg1 C A 16: 30,573,289 Q221H probably damaging Het
Ltbp2 C T 12: 84,829,316 V506M possibly damaging Het
Ltbp3 A G 19: 5,747,730 T466A probably damaging Het
Ltf G T 9: 111,021,005 V68L probably benign Het
Ltf C G 9: 111,024,393 P237R probably damaging Het
Ltn1 C T 16: 87,402,037 C1158Y probably benign Het
Luc7l G T 17: 26,281,661 W337C unknown Het
Luc7l3 GC G 11: 94,321,775 probably null Het
Ly6g6f C T 17: 35,083,032 V149M possibly damaging Het
Ly75 C A 2: 60,350,004 E610* probably null Het
Ly75 C A 2: 60,352,133 R566L possibly damaging Het
Lypd5 A C 7: 24,352,613 N118H probably damaging Het
Lypd6 TC T 2: 50,190,807 probably null Het
Lypd6b C A 2: 49,942,596 P58T probably damaging Het
Lyst G T 13: 13,680,134 R2363L possibly damaging Het
Macf1 C A 4: 123,471,475 E3164D probably benign Het
Mad1l1 C A 5: 140,105,582 G510V probably benign Het
Mad2l1bp C T 17: 46,147,941 R221H probably damaging Het
Madd C G 2: 91,142,831 Q1526H probably damaging Het
Mafb T A 2: 160,366,505 T58S possibly damaging Het
Magel2 G T 7: 62,379,607 R753L unknown Het
Magi2 G T 5: 20,702,412 G1342V probably benign Het
Magix G C X: 7,675,850 R226G probably benign Het
Malt1 G T 18: 65,431,373 G68C probably damaging Het
Malt1 G T 18: 65,448,284 G261V probably damaging Het
Maml2 G T 9: 13,706,590 G411* probably null Het
Man2a1 A C 17: 64,659,020 K318Q probably damaging Het
Man2a1 G C 17: 64,735,054 S989T probably benign Het
Man2b2 C G 5: 36,813,797 D742H probably damaging Het
Mansc4 G A 6: 147,086,961 R2W unknown Het
Map10 G T 8: 125,670,070 K67N probably damaging Het
Map1a G T 2: 121,305,279 C2192F probably damaging Het
Map1s G T 8: 70,914,517 D689Y probably damaging Het
Map2 G A 1: 66,380,680 A57T probably benign Het
Map2 G T 1: 66,438,361 V1756L probably damaging Het
Map3k1 C A 13: 111,755,946 G925V probably benign Het
Map3k19 G T 1: 127,822,034 S1193R probably benign Het
Map3k20 C T 2: 72,298,315 R32* probably null Het
Map3k4 C A 17: 12,271,697 Q282H probably damaging Het
Map3k9 G C 12: 81,722,279 S998R probably damaging Het
Map3k9 C A 12: 81,780,846 C10F unknown Het
Map4 G C 9: 110,068,523 probably null Het
Map4k1 G C 7: 29,000,008 R614P probably damaging Het
Map7d1 C A 4: 126,234,377 R617L unknown Het
Mapk15 C A 15: 75,998,461 S441* probably null Het
Mapk7 C A 11: 61,491,362 Q241H probably damaging Het
Marc1 G T 1: 184,803,937 P203Q possibly damaging Het
March4 C A 1: 72,428,957 Q305H probably damaging Het
March8 G T 6: 116,338,272 probably benign Het
Mast1 C A 8: 84,920,446 R650L probably benign Het
Mast3 T A 8: 70,789,038 probably null Het
Maz C A 7: 127,025,896 A151S unknown Het
Mbd1 G T 18: 74,276,939 K501N probably null Het
Mbl2 C A 19: 30,233,997 S6Y probably damaging Het
Mblac2 C G 13: 81,750,167 R221G probably benign Het
Mboat1 C T 13: 30,226,378 H273Y probably benign Het
Mbp C A 18: 82,513,010 P27T unknown Het
Mbp A T 18: 82,561,845 H80L probably benign Het
Mbtd1 G C 11: 93,912,459 probably null Het
Mc2r T A 18: 68,407,712 H170L possibly damaging Het
Mc3r C A 2: 172,249,816 S319R probably benign Het
Mcam G T 9: 44,134,590 probably benign Het
Mcc C A 18: 44,491,246 A411S probably benign Het
Mcf2l G T 8: 13,009,654 E720* probably null Het
Mcm4 C A 16: 15,629,454 D549Y probably damaging Het
Mcm4 A C 16: 15,632,216 D317E possibly damaging Het
Mcm5 G T 8: 75,121,672 M516I possibly damaging Het
Mcoln2 A T 3: 146,175,704 Q233L probably damaging Het
Mcpt8 C G 14: 56,082,336 C219S probably benign Het
Mcu C A 10: 59,456,771 V29L probably benign Het
Mcub C A 3: 129,916,942 A227S unknown Het
Mcub C T 3: 129,916,943 R280Q probably damaging Het
Mdm1 G T 10: 118,158,496 R470M possibly damaging Het
Mecr A T 4: 131,854,583 probably null Het
Med10 A G 13: 69,809,970 K14E probably benign Het
Med12l G T 3: 59,247,875 G1159W probably damaging Het
Med15 T A 16: 17,653,232 H698L possibly damaging Het
Mef2c C A 13: 83,625,266 T87K probably benign Het
Mef2d G A 3: 88,158,128 R118Q possibly damaging Het
Megf11 T G 9: 64,680,326 C469G probably damaging Het
Megf6 C A 4: 154,237,826 P37T probably benign Het
Megf6 G C 4: 154,250,849 G255A probably damaging Het
Megf6 G T 4: 154,267,681 K1214N possibly damaging Het
Megf6 G T 4: 154,267,682 D1215Y probably damaging Het
Megf6 C A 4: 154,267,747 C1236* probably null Het
Megf6 C A 4: 154,269,741 C1367* probably null Het
Megf8 G T 7: 25,346,162 G1403C probably damaging Het
Megf8 G T 7: 25,347,369 G1559V probably damaging Het
Meioc TCC TC 11: 102,666,364 probably null Het
Meltf G T 16: 31,880,234 C54F probably damaging Het
Mep1a T A 17: 43,486,297 Q293L probably damaging Het
Mep1a C G 17: 43,486,306 G290A probably damaging Het
Mest C A 6: 30,723,575 probably benign Het
Mettl21e G T 1: 44,206,550 L179M probably damaging Het
Mettl8 C G 2: 70,973,338 D202H probably damaging Het
Mettl9 G T 7: 121,057,330 V228F probably damaging Het
Mex3d C G 10: 80,381,350 A678P unknown Het
Mfge8 G T 7: 79,145,737 F27L probably benign Het
Mfhas1 G T 8: 35,590,385 Q671H possibly damaging Het
Mfn1 G T 3: 32,564,291 E550* probably null Het
Mfrp G C 9: 44,102,519 G109R probably damaging Het
Mfsd2b G A 12: 4,865,794 S406L probably damaging Het
Mfsd5 G A 15: 102,281,255 C354Y possibly damaging Het
Mfsd6 C G 1: 52,658,501 Q742H probably benign Het
Mfsd6l G T 11: 68,556,982 V220F possibly damaging Het
Mfsd6l A T 11: 68,557,714 S464C probably damaging Het
Mfsd8 C A 3: 40,846,861 probably benign Het
Mgam G T 6: 40,740,071 L229F probably damaging Het
Mgat4a G T 1: 37,490,372 P142H probably damaging Het
Mgat4c C A 10: 102,388,450 P175H probably damaging Het
Mgat4c G T 10: 102,388,602 D226Y probably damaging Het
Mgat5 G C 1: 127,482,692 K730N probably damaging Het
Mgme1 G T 2: 144,276,476 V223F probably damaging Het
Mgrn1 A T 16: 4,922,724 Q309L probably benign Het
Mgst2 C G 3: 51,661,270 L8V probably damaging Het
Mib1 G T 18: 10,763,309 R453I probably damaging Het
Mib2 C G 4: 155,655,521 probably null Het
Mical1 G T 10: 41,481,705 R436L probably null Het
Mical3 C G 6: 120,959,728 R1279P possibly damaging Het
Micall2 C T 5: 139,710,302 E844K unknown Het
Micu1 G T 10: 59,728,041 Q28H probably benign Het
Micu3 G T 8: 40,308,224 W58C probably damaging Het
Midn G A 10: 80,150,240 E55K probably damaging Het
Mier2 C A 10: 79,540,461 G210V unknown Het
Mindy4 G A 6: 55,224,341 R337H probably benign Het
Miox G T 15: 89,335,644 D112Y probably damaging Het
Mitf A T 6: 98,006,121 probably null Het
Mkl2 G T 16: 13,385,606 G161V probably benign Het
Mkrn1 T A 6: 39,400,456 N282Y probably null Het
Mks1 GCCC GCC 11: 87,860,723 probably null Het
Mkx G T 18: 6,937,195 P283Q probably benign Het
Mlf2 G T 6: 124,934,306 G95W probably damaging Het
Mllt10 G C 2: 18,171,076 probably null Het
Mllt6 G T 11: 97,676,425 G676C possibly damaging Het
Mmd G T 11: 90,259,888 W57L probably damaging Het
Mmel1 G T 4: 154,894,074 probably null Het
Mmgt2 A C 11: 62,665,074 T83P probably damaging Het
Mmp13 C T 9: 7,277,953 P282L probably damaging Het
Mmp13 C A 9: 7,280,200 P377T possibly damaging Het
Mmp17 G A 5: 129,595,661 D226N possibly damaging Het
Mmp1a G T 9: 7,464,230 A12S probably benign Het
Mmp1a C T 9: 7,467,033 T237M possibly damaging Het
Mmp1b C A 9: 7,369,322 probably null Het
Mmp20 G T 9: 7,644,062 Q250H probably benign Het
Mmp21 G T 7: 133,674,933 P447H probably damaging Het
Mmp25 G C 17: 23,644,137 A100G possibly damaging Het
Mmp7 C A 9: 7,695,178 P47H probably benign Het
Mmrn1 G T 6: 60,987,098 S1028I possibly damaging Het
Mms19 C A 19: 41,957,140