Incidental Mutation 'R0658:Acsl3'
ID62595
Institutional Source Beutler Lab
Gene Symbol Acsl3
Ensembl Gene ENSMUSG00000032883
Gene Nameacyl-CoA synthetase long-chain family member 3
Synonyms2610510B12Rik, Facl3, C85929
MMRRC Submission 038843-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R0658 (G1)
Quality Score87
Status Validated
Chromosome1
Chromosomal Location78657825-78707743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78701287 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 520 (D520G)
Ref Sequence ENSEMBL: ENSMUSP00000121695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000134566] [ENSMUST00000142704]
Predicted Effect probably damaging
Transcript: ENSMUST00000035779
AA Change: D520G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883
AA Change: D520G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134566
AA Change: D368G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883
AA Change: D368G

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142704
AA Change: D520G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883
AA Change: D520G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154777
Meta Mutation Damage Score 0.4027 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in brain, and preferentially utilizes myristate, arachidonate, and eicosapentaenoate as substrates. The amino acid sequence of this isozyme is 92% identical to that of rat homolog. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit decreased blood percentages of CD4 T cells and B cells, and a decreased IgG1 response to ovalbumin. Male mutant mice exhibit growth retardation, reduced size and reduced total tissue and lean body mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,817,961 probably null Het
Adgrl3 T C 5: 81,648,713 V623A probably benign Het
Ak9 G T 10: 41,347,222 V454L probably damaging Het
Alpk2 C A 18: 65,349,487 K483N probably damaging Het
Arhgef12 T C 9: 42,981,985 Y974C probably damaging Het
Armc8 C T 9: 99,536,158 probably benign Het
Atp2a2 C T 5: 122,457,633 probably benign Het
Atrn T C 2: 130,970,227 probably null Het
Caps2 T A 10: 112,204,038 probably benign Het
Cep76 A G 18: 67,623,304 S486P probably damaging Het
Cep97 C T 16: 55,914,902 R583H probably benign Het
Cog7 A G 7: 121,956,140 probably benign Het
Commd5 T A 15: 76,900,568 V55E probably damaging Het
Csmd3 A T 15: 48,011,147 D684E possibly damaging Het
Ctxn2 T C 2: 125,147,456 M1T probably null Het
Exph5 A G 9: 53,377,475 D1952G unknown Het
Fmo2 A T 1: 162,876,774 L521Q possibly damaging Het
Fryl T A 5: 73,065,359 T1960S probably damaging Het
G6pd2 T C 5: 61,809,674 L264P probably damaging Het
Gm1966 C A 7: 106,602,886 V384L possibly damaging Het
Gne A T 4: 44,039,033 V647E possibly damaging Het
Grb14 G A 2: 64,914,727 Q96* probably null Het
Gtf3c1 A G 7: 125,698,962 F146L probably damaging Het
Irak2 A G 6: 113,638,564 Y6C probably damaging Het
Kel T A 6: 41,703,031 N75I probably damaging Het
Lgr4 T A 2: 110,011,787 F706I possibly damaging Het
Lox A T 18: 52,528,883 S149R probably benign Het
Lrrc66 T G 5: 73,610,944 D218A probably benign Het
Luc7l C T 17: 26,266,322 R99W probably damaging Het
Megf10 T C 18: 57,252,896 V327A probably benign Het
Mthfd1l G T 10: 4,047,976 probably null Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myh8 G T 11: 67,284,532 probably null Het
Olfr1463 A T 19: 13,235,060 D270V possibly damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pgf C T 12: 85,169,385 R153K probably benign Het
Pramef8 A T 4: 143,417,600 Q172L probably damaging Het
Prdm2 A G 4: 143,135,265 V485A probably damaging Het
Rag1 T C 2: 101,642,683 T705A probably damaging Het
Rflna A C 5: 125,003,710 D48A possibly damaging Het
Rnf148 A T 6: 23,654,457 I180N probably damaging Het
Rtn4 T A 11: 29,706,475 S94T probably damaging Het
Scn11a G A 9: 119,811,160 T223I probably benign Het
Scube2 T A 7: 109,837,120 probably benign Het
Sept14 T C 5: 129,697,908 I68V probably benign Het
Sil1 A T 18: 35,266,857 L365Q possibly damaging Het
Sirt1 A G 10: 63,321,736 probably benign Het
Slc9a1 T C 4: 133,420,499 probably benign Het
Smpdl3a A G 10: 57,811,240 T355A probably damaging Het
Syne2 T C 12: 76,094,336 I6074T probably damaging Het
Thbs2 T A 17: 14,680,325 H540L probably benign Het
Tsc22d4 T C 5: 137,768,021 S450P probably benign Het
Tshr C A 12: 91,538,226 S54* probably null Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Uncx G T 5: 139,544,187 C65F probably damaging Het
Vmn1r87 A T 7: 13,131,829 M177K probably damaging Het
Vmn2r56 A T 7: 12,710,308 C466S probably benign Het
Wnk1 G A 6: 119,948,505 P1831S probably damaging Het
Zfp820 T C 17: 21,818,920 S476G probably benign Het
Other mutations in Acsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsl3 APN 1 78699759 missense possibly damaging 0.79
IGL02201:Acsl3 APN 1 78699153 missense probably damaging 1.00
IGL03162:Acsl3 APN 1 78699170 critical splice donor site probably null
R0601:Acsl3 UTSW 1 78696179 missense probably damaging 1.00
R1389:Acsl3 UTSW 1 78688282 missense probably benign
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1697:Acsl3 UTSW 1 78705397 splice site probably benign
R2083:Acsl3 UTSW 1 78699811 missense probably damaging 0.99
R2125:Acsl3 UTSW 1 78681961 missense probably damaging 0.97
R2191:Acsl3 UTSW 1 78699140 missense probably damaging 1.00
R2299:Acsl3 UTSW 1 78699110 missense probably damaging 1.00
R2395:Acsl3 UTSW 1 78705368 missense probably benign 0.00
R2964:Acsl3 UTSW 1 78694294 missense probably benign 0.01
R3403:Acsl3 UTSW 1 78696122 missense probably damaging 1.00
R4655:Acsl3 UTSW 1 78690346 missense probably damaging 1.00
R5537:Acsl3 UTSW 1 78706356 missense probably damaging 1.00
R5823:Acsl3 UTSW 1 78688286 missense probably benign
R6239:Acsl3 UTSW 1 78696465 missense probably benign 0.00
R6376:Acsl3 UTSW 1 78696465 missense possibly damaging 0.81
R6650:Acsl3 UTSW 1 78681922 missense probably benign 0.03
R7031:Acsl3 UTSW 1 78688283 missense probably benign
R7282:Acsl3 UTSW 1 78681992 missense probably damaging 0.97
R7733:Acsl3 UTSW 1 78688236 critical splice acceptor site probably null
X0025:Acsl3 UTSW 1 78692202 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTTTTCCCTGAGGGCTTTAAGCA -3'
(R):5'- GGTCAAACTCTCCAATATCTCCAGTGC -3'

Sequencing Primer
(F):5'- GGGACATAACTTTCTAAAGGCTC -3'
(R):5'- CCCATTGTCACATTTTGGCCA -3'
Posted On2013-07-30