Incidental Mutation 'R0658:Fmo2'
Institutional Source Beutler Lab
Gene Symbol Fmo2
Ensembl Gene ENSMUSG00000040170
Gene Nameflavin containing monooxygenase 2
Synonyms2310008D08Rik, 2310042I22Rik
MMRRC Submission 038843-MU
Accession Numbers

Genbank: NM_018881

Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0658 (G1)
Quality Score118
Status Validated
Chromosomal Location162874317-162898726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 162876774 bp
Amino Acid Change Leucine to Glutamine at position 521 (L521Q)
Ref Sequence ENSEMBL: ENSMUSP00000107135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045902] [ENSMUST00000111510]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045902
AA Change: L521Q

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044405
Gene: ENSMUSG00000040170
AA Change: L521Q

Pfam:FMO-like 2 533 8.7e-296 PFAM
Pfam:Pyr_redox_2 3 230 6.4e-12 PFAM
Pfam:Pyr_redox_3 6 220 4.4e-10 PFAM
Pfam:K_oxygenase 69 233 2.2e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111510
AA Change: L521Q

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107135
Gene: ENSMUSG00000040170
AA Change: L521Q

Pfam:FMO-like 2 533 8.7e-296 PFAM
Pfam:Pyr_redox_2 4 446 1.3e-6 PFAM
Pfam:Pyr_redox_3 6 220 8e-17 PFAM
Pfam:NAD_binding_8 7 72 4.3e-6 PFAM
Pfam:K_oxygenase 78 333 1.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194197
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin-containing monooxygenase family member. It is an NADPH-dependent enzyme that catalyzes the N-oxidation of some primary alkylamines through an N-hydroxylamine intermediate. However, some human populations contain an allele (FMO2*2A) with a premature stop codon, resulting in a protein that is C-terminally-truncated, has no catalytic activity, and is likely degraded rapidly. This gene is found in a cluster with other related family members on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,817,961 probably null Het
Acsl3 A G 1: 78,701,287 D520G probably damaging Het
Adgrl3 T C 5: 81,648,713 V623A probably benign Het
Ak9 G T 10: 41,347,222 V454L probably damaging Het
Alpk2 C A 18: 65,349,487 K483N probably damaging Het
Arhgef12 T C 9: 42,981,985 Y974C probably damaging Het
Armc8 C T 9: 99,536,158 probably benign Het
Atp2a2 C T 5: 122,457,633 probably benign Het
Atrn T C 2: 130,970,227 probably null Het
Caps2 T A 10: 112,204,038 probably benign Het
Cep76 A G 18: 67,623,304 S486P probably damaging Het
Cep97 C T 16: 55,914,902 R583H probably benign Het
Cog7 A G 7: 121,956,140 probably benign Het
Commd5 T A 15: 76,900,568 V55E probably damaging Het
Csmd3 A T 15: 48,011,147 D684E possibly damaging Het
Ctxn2 T C 2: 125,147,456 M1T probably null Het
Exph5 A G 9: 53,377,475 D1952G unknown Het
Fryl T A 5: 73,065,359 T1960S probably damaging Het
G6pd2 T C 5: 61,809,674 L264P probably damaging Het
Gm1966 C A 7: 106,602,886 V384L possibly damaging Het
Gne A T 4: 44,039,033 V647E possibly damaging Het
Grb14 G A 2: 64,914,727 Q96* probably null Het
Gtf3c1 A G 7: 125,698,962 F146L probably damaging Het
Irak2 A G 6: 113,638,564 Y6C probably damaging Het
Kel T A 6: 41,703,031 N75I probably damaging Het
Lgr4 T A 2: 110,011,787 F706I possibly damaging Het
Lox A T 18: 52,528,883 S149R probably benign Het
Lrrc66 T G 5: 73,610,944 D218A probably benign Het
Luc7l C T 17: 26,266,322 R99W probably damaging Het
Megf10 T C 18: 57,252,896 V327A probably benign Het
Mthfd1l G T 10: 4,047,976 probably null Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myh8 G T 11: 67,284,532 probably null Het
Olfr1463 A T 19: 13,235,060 D270V possibly damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pgf C T 12: 85,169,385 R153K probably benign Het
Pramef8 A T 4: 143,417,600 Q172L probably damaging Het
Prdm2 A G 4: 143,135,265 V485A probably damaging Het
Rag1 T C 2: 101,642,683 T705A probably damaging Het
Rflna A C 5: 125,003,710 D48A possibly damaging Het
Rnf148 A T 6: 23,654,457 I180N probably damaging Het
Rtn4 T A 11: 29,706,475 S94T probably damaging Het
Scn11a G A 9: 119,811,160 T223I probably benign Het
Scube2 T A 7: 109,837,120 probably benign Het
Sept14 T C 5: 129,697,908 I68V probably benign Het
Sil1 A T 18: 35,266,857 L365Q possibly damaging Het
Sirt1 A G 10: 63,321,736 probably benign Het
Slc9a1 T C 4: 133,420,499 probably benign Het
Smpdl3a A G 10: 57,811,240 T355A probably damaging Het
Syne2 T C 12: 76,094,336 I6074T probably damaging Het
Thbs2 T A 17: 14,680,325 H540L probably benign Het
Tsc22d4 T C 5: 137,768,021 S450P probably benign Het
Tshr C A 12: 91,538,226 S54* probably null Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Uncx G T 5: 139,544,187 C65F probably damaging Het
Vmn1r87 A T 7: 13,131,829 M177K probably damaging Het
Vmn2r56 A T 7: 12,710,308 C466S probably benign Het
Wnk1 G A 6: 119,948,505 P1831S probably damaging Het
Zfp820 T C 17: 21,818,920 S476G probably benign Het
Other mutations in Fmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Fmo2 APN 1 162888713 nonsense probably null
IGL01299:Fmo2 APN 1 162878030 missense probably benign
IGL02617:Fmo2 APN 1 162876921 missense probably damaging 1.00
IGL02994:Fmo2 APN 1 162880620 missense probably damaging 1.00
IGL03270:Fmo2 APN 1 162882026 missense probably damaging 1.00
F5493:Fmo2 UTSW 1 162880532 missense probably benign 0.41
R0058:Fmo2 UTSW 1 162886324 missense probably benign 0.38
R0058:Fmo2 UTSW 1 162886324 missense probably benign 0.38
R0501:Fmo2 UTSW 1 162876928 missense probably benign 0.00
R0800:Fmo2 UTSW 1 162876814 missense probably benign 0.00
R2223:Fmo2 UTSW 1 162898244 missense probably damaging 1.00
R4360:Fmo2 UTSW 1 162882014 missense probably damaging 0.99
R4523:Fmo2 UTSW 1 162887708 missense probably benign 0.44
R4755:Fmo2 UTSW 1 162888805 missense probably damaging 1.00
R6087:Fmo2 UTSW 1 162880433 missense probably benign 0.45
R6219:Fmo2 UTSW 1 162880516 missense probably damaging 0.97
R6668:Fmo2 UTSW 1 162877048 missense probably benign 0.15
R7042:Fmo2 UTSW 1 162880657 missense probably damaging 1.00
R7291:Fmo2 UTSW 1 162887702 missense probably benign 0.06
R7560:Fmo2 UTSW 1 162888749 missense probably damaging 1.00
R7580:Fmo2 UTSW 1 162877044 missense possibly damaging 0.46
R7657:Fmo2 UTSW 1 162888844 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ctcacagagatccatctgcc -3'
Posted On2013-07-30