Incidental Mutation 'R0658:Pdia3'
ID62600
Institutional Source Beutler Lab
Gene Symbol Pdia3
Ensembl Gene ENSMUSG00000027248
Gene Nameprotein disulfide isomerase associated 3
SynonymsERp61, Plca, PDI, Grp58, Erp, PDI-Q2, ERp57, ERp60
MMRRC Submission 038843-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0658 (G1)
Quality Score133
Status Validated
Chromosome2
Chromosomal Location121413775-121438687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121432377 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 275 (G275S)
Ref Sequence ENSEMBL: ENSMUSP00000028683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028683] [ENSMUST00000135079]
Predicted Effect probably damaging
Transcript: ENSMUST00000028683
AA Change: G275S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028683
Gene: ENSMUSG00000027248
AA Change: G275S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Thioredoxin 26 131 5.2e-36 PFAM
Pfam:Thioredoxin_6 160 355 2e-29 PFAM
Pfam:Thioredoxin 377 483 9.5e-33 PFAM
low complexity region 487 503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130450
Predicted Effect probably benign
Transcript: ENSMUST00000135079
SMART Domains Protein: ENSMUSP00000119337
Gene: ENSMUSG00000027248

DomainStartEndE-ValueType
Pfam:Thioredoxin 3 105 5.1e-35 PFAM
Meta Mutation Damage Score 0.4603 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of the endoplasmic reticulum that interacts with lectin chaperones calreticulin and calnexin to modulate folding of newly synthesized glycoproteins. The protein was once thought to be a phospholipase; however, it has been demonstrated that the protein actually has protein disulfide isomerase activity. It is thought that complexes of lectins and this protein mediate protein folding by promoting formation of disulfide bonds in their glycoprotein substrates. This protein also functions as a molecular chaperone that prevents the formation of protein aggregates. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele die by E13.5 with minor changes in ER calcium capacity and unfolded protein response in mouse embryonic fibroblasts. Mice homozygous for a gene trap allele die prior to birth while heterozygous mice exhibit abnormalbone volume bone morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,817,961 probably null Het
Acsl3 A G 1: 78,701,287 D520G probably damaging Het
Adgrl3 T C 5: 81,648,713 V623A probably benign Het
Ak9 G T 10: 41,347,222 V454L probably damaging Het
Alpk2 C A 18: 65,349,487 K483N probably damaging Het
Arhgef12 T C 9: 42,981,985 Y974C probably damaging Het
Armc8 C T 9: 99,536,158 probably benign Het
Atp2a2 C T 5: 122,457,633 probably benign Het
Atrn T C 2: 130,970,227 probably null Het
Caps2 T A 10: 112,204,038 probably benign Het
Cep76 A G 18: 67,623,304 S486P probably damaging Het
Cep97 C T 16: 55,914,902 R583H probably benign Het
Cog7 A G 7: 121,956,140 probably benign Het
Commd5 T A 15: 76,900,568 V55E probably damaging Het
Csmd3 A T 15: 48,011,147 D684E possibly damaging Het
Ctxn2 T C 2: 125,147,456 M1T probably null Het
Exph5 A G 9: 53,377,475 D1952G unknown Het
Fmo2 A T 1: 162,876,774 L521Q possibly damaging Het
Fryl T A 5: 73,065,359 T1960S probably damaging Het
G6pd2 T C 5: 61,809,674 L264P probably damaging Het
Gm1966 C A 7: 106,602,886 V384L possibly damaging Het
Gne A T 4: 44,039,033 V647E possibly damaging Het
Grb14 G A 2: 64,914,727 Q96* probably null Het
Gtf3c1 A G 7: 125,698,962 F146L probably damaging Het
Irak2 A G 6: 113,638,564 Y6C probably damaging Het
Kel T A 6: 41,703,031 N75I probably damaging Het
Lgr4 T A 2: 110,011,787 F706I possibly damaging Het
Lox A T 18: 52,528,883 S149R probably benign Het
Lrrc66 T G 5: 73,610,944 D218A probably benign Het
Luc7l C T 17: 26,266,322 R99W probably damaging Het
Megf10 T C 18: 57,252,896 V327A probably benign Het
Mthfd1l G T 10: 4,047,976 probably null Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myh8 G T 11: 67,284,532 probably null Het
Olfr1463 A T 19: 13,235,060 D270V possibly damaging Het
Pgf C T 12: 85,169,385 R153K probably benign Het
Pramef8 A T 4: 143,417,600 Q172L probably damaging Het
Prdm2 A G 4: 143,135,265 V485A probably damaging Het
Rag1 T C 2: 101,642,683 T705A probably damaging Het
Rflna A C 5: 125,003,710 D48A possibly damaging Het
Rnf148 A T 6: 23,654,457 I180N probably damaging Het
Rtn4 T A 11: 29,706,475 S94T probably damaging Het
Scn11a G A 9: 119,811,160 T223I probably benign Het
Scube2 T A 7: 109,837,120 probably benign Het
Sept14 T C 5: 129,697,908 I68V probably benign Het
Sil1 A T 18: 35,266,857 L365Q possibly damaging Het
Sirt1 A G 10: 63,321,736 probably benign Het
Slc9a1 T C 4: 133,420,499 probably benign Het
Smpdl3a A G 10: 57,811,240 T355A probably damaging Het
Syne2 T C 12: 76,094,336 I6074T probably damaging Het
Thbs2 T A 17: 14,680,325 H540L probably benign Het
Tsc22d4 T C 5: 137,768,021 S450P probably benign Het
Tshr C A 12: 91,538,226 S54* probably null Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Uncx G T 5: 139,544,187 C65F probably damaging Het
Vmn1r87 A T 7: 13,131,829 M177K probably damaging Het
Vmn2r56 A T 7: 12,710,308 C466S probably benign Het
Wnk1 G A 6: 119,948,505 P1831S probably damaging Het
Zfp820 T C 17: 21,818,920 S476G probably benign Het
Other mutations in Pdia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Pdia3 APN 2 121414178 missense probably damaging 1.00
IGL00777:Pdia3 APN 2 121429556 missense probably damaging 1.00
IGL02020:Pdia3 APN 2 121436419 splice site probably null
IGL02437:Pdia3 APN 2 121433648 missense probably damaging 1.00
IGL02988:Pdia3 UTSW 2 121429556 missense probably damaging 1.00
PIT4812001:Pdia3 UTSW 2 121433530 missense probably damaging 1.00
R0242:Pdia3 UTSW 2 121414111 missense probably damaging 1.00
R0242:Pdia3 UTSW 2 121414111 missense probably damaging 1.00
R0606:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0612:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0724:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0730:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0880:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0882:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1157:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1160:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1238:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1619:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1853:Pdia3 UTSW 2 121431663 missense probably benign 0.20
R1854:Pdia3 UTSW 2 121431663 missense probably benign 0.20
R2014:Pdia3 UTSW 2 121434820 missense probably damaging 1.00
R2103:Pdia3 UTSW 2 121433993 missense probably damaging 1.00
R4160:Pdia3 UTSW 2 121414115 missense probably damaging 1.00
R4628:Pdia3 UTSW 2 121414139 missense possibly damaging 0.91
R5032:Pdia3 UTSW 2 121414139 missense probably benign 0.28
R5279:Pdia3 UTSW 2 121414003 unclassified probably benign
R5598:Pdia3 UTSW 2 121414130 missense possibly damaging 0.53
R5815:Pdia3 UTSW 2 121436411 nonsense probably null
R7162:Pdia3 UTSW 2 121429521 missense probably benign 0.00
R7729:Pdia3 UTSW 2 121432357 missense possibly damaging 0.77
X0012:Pdia3 UTSW 2 121435945 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTGTGGACCCATTACCTCTTACAGTG -3'
(R):5'- GCAGTTTCTGGAGCTATGTGTTCCC -3'

Sequencing Primer
(F):5'- GCATTGTGTTGATAATGACTTCCTC -3'
(R):5'- gtccagattagccacaaattcag -3'
Posted On2013-07-30