Mutagenetix > Incidental Mutation

Incidental Mutation 'R0658:Atrn'

62602

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

038843-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0658 (G1)

Quality Score

118

Status

Validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 130970227 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

probably null
Transcript: ENSMUST00000028781

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134964

Meta Mutation Damage Score

0.9488

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abraxas1	C	T	5: 100,817,961		probably null	Het
Acsl3	A	G	1: 78,701,287	D520G	probably damaging	Het
Adgrl3	T	C	5: 81,648,713	V623A	probably benign	Het
Ak9	G	T	10: 41,347,222	V454L	probably damaging	Het
Alpk2	C	A	18: 65,349,487	K483N	probably damaging	Het
Arhgef12	T	C	9: 42,981,985	Y974C	probably damaging	Het
Armc8	C	T	9: 99,536,158		probably benign	Het
Atp2a2	C	T	5: 122,457,633		probably benign	Het
Caps2	T	A	10: 112,204,038		probably benign	Het
Cep76	A	G	18: 67,623,304	S486P	probably damaging	Het
Cep97	C	T	16: 55,914,902	R583H	probably benign	Het
Cog7	A	G	7: 121,956,140		probably benign	Het
Commd5	T	A	15: 76,900,568	V55E	probably damaging	Het
Csmd3	A	T	15: 48,011,147	D684E	possibly damaging	Het
Ctxn2	T	C	2: 125,147,456	M1T	probably null	Het
Exph5	A	G	9: 53,377,475	D1952G	unknown	Het
Fmo2	A	T	1: 162,876,774	L521Q	possibly damaging	Het
Fryl	T	A	5: 73,065,359	T1960S	probably damaging	Het
G6pd2	T	C	5: 61,809,674	L264P	probably damaging	Het
Gm1966	C	A	7: 106,602,886	V384L	possibly damaging	Het
Gne	A	T	4: 44,039,033	V647E	possibly damaging	Het
Grb14	G	A	2: 64,914,727	Q96*	probably null	Het
Gtf3c1	A	G	7: 125,698,962	F146L	probably damaging	Het
Irak2	A	G	6: 113,638,564	Y6C	probably damaging	Het
Kel	T	A	6: 41,703,031	N75I	probably damaging	Het
Lgr4	T	A	2: 110,011,787	F706I	possibly damaging	Het
Lox	A	T	18: 52,528,883	S149R	probably benign	Het
Lrrc66	T	G	5: 73,610,944	D218A	probably benign	Het
Luc7l	C	T	17: 26,266,322	R99W	probably damaging	Het
Megf10	T	C	18: 57,252,896	V327A	probably benign	Het
Mthfd1l	G	T	10: 4,047,976		probably null	Het
Myh11	C	A	16: 14,224,019	Q720H	probably damaging	Het
Myh8	G	T	11: 67,284,532		probably null	Het
Olfr1463	A	T	19: 13,235,060	D270V	possibly damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Pgf	C	T	12: 85,169,385	R153K	probably benign	Het
Pramef8	A	T	4: 143,417,600	Q172L	probably damaging	Het
Prdm2	A	G	4: 143,135,265	V485A	probably damaging	Het
Rag1	T	C	2: 101,642,683	T705A	probably damaging	Het
Rflna	A	C	5: 125,003,710	D48A	possibly damaging	Het
Rnf148	A	T	6: 23,654,457	I180N	probably damaging	Het
Rtn4	T	A	11: 29,706,475	S94T	probably damaging	Het
Scn11a	G	A	9: 119,811,160	T223I	probably benign	Het
Scube2	T	A	7: 109,837,120		probably benign	Het
Sept14	T	C	5: 129,697,908	I68V	probably benign	Het
Sil1	A	T	18: 35,266,857	L365Q	possibly damaging	Het
Sirt1	A	G	10: 63,321,736		probably benign	Het
Slc9a1	T	C	4: 133,420,499		probably benign	Het
Smpdl3a	A	G	10: 57,811,240	T355A	probably damaging	Het
Syne2	T	C	12: 76,094,336	I6074T	probably damaging	Het
Thbs2	T	A	17: 14,680,325	H540L	probably benign	Het
Tsc22d4	T	C	5: 137,768,021	S450P	probably benign	Het
Tshr	C	A	12: 91,538,226	S54*	probably null	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Uncx	G	T	5: 139,544,187	C65F	probably damaging	Het
Vmn1r87	A	T	7: 13,131,829	M177K	probably damaging	Het
Vmn2r56	A	T	7: 12,710,308	C466S	probably benign	Het
Wnk1	G	A	6: 119,948,505	P1831S	probably damaging	Het
Zfp820	T	C	17: 21,818,920	S476G	probably benign	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGTGTTCGGCGGCTTCAACAG -3'
(R):5'- CCAGACCAGGAGTTGGTACACAAAG -3'

Sequencing Primer
(F):5'- AACAGCCTCCTCCTCAGTG -3'
(R):5'- GGTACACAAAGCCTGTGTAATTC -3'

Posted On

2013-07-30