Mutagenetix > Incidental Mutations

Incidental Mutation 'R0658:Prdm2'

62605

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

038843-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0658 (G1)

Quality Score

176

Status

Not validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 143135265 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 485 (V485A)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

Predicted Effect

probably damaging
Transcript: ENSMUST00000105778
AA Change: V485A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: V485A

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197026

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abraxas1	C	T	5: 100,817,961		probably null	Het
Acsl3	A	G	1: 78,701,287	D520G	probably damaging	Het
Adgrl3	T	C	5: 81,648,713	V623A	probably benign	Het
Ak9	G	T	10: 41,347,222	V454L	probably damaging	Het
Alpk2	C	A	18: 65,349,487	K483N	probably damaging	Het
Arhgef12	T	C	9: 42,981,985	Y974C	probably damaging	Het
Armc8	C	T	9: 99,536,158		probably benign	Het
Atp2a2	C	T	5: 122,457,633		probably benign	Het
Atrn	T	C	2: 130,970,227		probably null	Het
Caps2	T	A	10: 112,204,038		probably benign	Het
Cep76	A	G	18: 67,623,304	S486P	probably damaging	Het
Cep97	C	T	16: 55,914,902	R583H	probably benign	Het
Cog7	A	G	7: 121,956,140		probably benign	Het
Commd5	T	A	15: 76,900,568	V55E	probably damaging	Het
Csmd3	A	T	15: 48,011,147	D684E	possibly damaging	Het
Ctxn2	T	C	2: 125,147,456	M1T	probably null	Het
Exph5	A	G	9: 53,377,475	D1952G	unknown	Het
Fmo2	A	T	1: 162,876,774	L521Q	possibly damaging	Het
Fryl	T	A	5: 73,065,359	T1960S	probably damaging	Het
G6pd2	T	C	5: 61,809,674	L264P	probably damaging	Het
Gm1966	C	A	7: 106,602,886	V384L	possibly damaging	Het
Gne	A	T	4: 44,039,033	V647E	possibly damaging	Het
Grb14	G	A	2: 64,914,727	Q96*	probably null	Het
Gtf3c1	A	G	7: 125,698,962	F146L	probably damaging	Het
Irak2	A	G	6: 113,638,564	Y6C	probably damaging	Het
Kel	T	A	6: 41,703,031	N75I	probably damaging	Het
Lgr4	T	A	2: 110,011,787	F706I	possibly damaging	Het
Lox	A	T	18: 52,528,883	S149R	probably benign	Het
Lrrc66	T	G	5: 73,610,944	D218A	probably benign	Het
Luc7l	C	T	17: 26,266,322	R99W	probably damaging	Het
Megf10	T	C	18: 57,252,896	V327A	probably benign	Het
Mthfd1l	G	T	10: 4,047,976		probably null	Het
Myh11	C	A	16: 14,224,019	Q720H	probably damaging	Het
Myh8	G	T	11: 67,284,532		probably null	Het
Olfr1463	A	T	19: 13,235,060	D270V	possibly damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Pgf	C	T	12: 85,169,385	R153K	probably benign	Het
Pramef8	A	T	4: 143,417,600	Q172L	probably damaging	Het
Rag1	T	C	2: 101,642,683	T705A	probably damaging	Het
Rflna	A	C	5: 125,003,710	D48A	possibly damaging	Het
Rnf148	A	T	6: 23,654,457	I180N	probably damaging	Het
Rtn4	T	A	11: 29,706,475	S94T	probably damaging	Het
Scn11a	G	A	9: 119,811,160	T223I	probably benign	Het
Scube2	T	A	7: 109,837,120		probably benign	Het
Sept14	T	C	5: 129,697,908	I68V	probably benign	Het
Sil1	A	T	18: 35,266,857	L365Q	possibly damaging	Het
Sirt1	A	G	10: 63,321,736		probably benign	Het
Slc9a1	T	C	4: 133,420,499		probably benign	Het
Smpdl3a	A	G	10: 57,811,240	T355A	probably damaging	Het
Syne2	T	C	12: 76,094,336	I6074T	probably damaging	Het
Thbs2	T	A	17: 14,680,325	H540L	probably benign	Het
Tsc22d4	T	C	5: 137,768,021	S450P	probably benign	Het
Tshr	C	A	12: 91,538,226	S54*	probably null	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Uncx	G	T	5: 139,544,187	C65F	probably damaging	Het
Vmn1r87	A	T	7: 13,131,829	M177K	probably damaging	Het
Vmn2r56	A	T	7: 12,710,308	C466S	probably benign	Het
Wnk1	G	A	6: 119,948,505	P1831S	probably damaging	Het
Zfp820	T	C	17: 21,818,920	S476G	probably benign	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GATATACACATCATCTGCGTCCCCG -3'
(R):5'- AAGAGAAGACCCAGCATGGCATTAC -3'

Sequencing Primer
(F):5'- GTCCTCCTCGGGCTCTG -3'
(R):5'- TGGCATTACAATCCTCAGAGGAC -3'

Posted On

2013-07-30