Incidental Mutation 'R0709:Slc19a2'
ID62637
Institutional Source Beutler Lab
Gene Symbol Slc19a2
Ensembl Gene ENSMUSG00000040918
Gene Namesolute carrier family 19 (thiamine transporter), member 2
SynonymsTRMA, DDA1, THTR1
MMRRC Submission 038892-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R0709 (G1)
Quality Score129
Status Validated
Chromosome1
Chromosomal Location164249046-164265385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 164256798 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 86 (F86I)
Ref Sequence ENSEMBL: ENSMUSP00000123870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044021] [ENSMUST00000159230] [ENSMUST00000169394]
Predicted Effect probably damaging
Transcript: ENSMUST00000044021
AA Change: F86I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037561
Gene: ENSMUSG00000040918
AA Change: F86I

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 459 2.7e-180 PFAM
Pfam:MFS_1 34 441 2.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159230
AA Change: F86I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123870
Gene: ENSMUSG00000040918
AA Change: F86I

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 421 1.6e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169394
SMART Domains Protein: ENSMUSP00000131327
Gene: ENSMUSG00000040918

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 70 3.7e-17 PFAM
Pfam:Folate_carrier 65 258 6.7e-85 PFAM
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the thiamin transporter protein. Mutations in this gene cause thiamin-responsive megaloblastic anemia syndrome (TRMA), which is an autosomal recessive disorder characterized by diabetes mellitus, megaloblastic anemia and sensorineural deafness. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for targeted null alleles exhibit a grossly normal phenotype except for reduced testis size and male infertility. On a low-thiamine diet, mutants show premature death and sensorineural deafness, while homozygotes for one targeted allele also display diabetes mellitus and megaloblastosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,494 D137V probably damaging Het
Aar2 C T 2: 156,567,010 P378L probably damaging Het
Abcc5 A T 16: 20,376,592 H718Q possibly damaging Het
Ace G T 11: 105,981,538 L319F probably damaging Het
Angpt4 C A 2: 151,934,514 P321T possibly damaging Het
Atrip T C 9: 109,067,103 N282S probably benign Het
AW554918 A C 18: 25,463,654 S525R probably damaging Het
Casc4 T A 2: 121,867,425 V74E probably damaging Het
Ccdc136 T A 6: 29,414,970 I644N possibly damaging Het
Ccdc178 A G 18: 22,067,662 Y413H probably damaging Het
Ccdc7b A G 8: 129,136,646 H223R probably benign Het
Cd109 T C 9: 78,671,978 V634A possibly damaging Het
Col7a1 T A 9: 108,961,548 probably benign Het
Copb2 A T 9: 98,563,167 probably benign Het
Csrnp3 C T 2: 66,022,563 S445L probably damaging Het
Cxcl13 G T 5: 95,958,671 C34F probably damaging Het
Dars2 T C 1: 161,046,928 E397G probably benign Het
Dlg5 C T 14: 24,146,255 V1625M probably damaging Het
Dnah12 T G 14: 26,884,265 probably benign Het
Eif4a1 C A 11: 69,670,252 A76S probably damaging Het
Fam162b T A 10: 51,587,251 I107L probably damaging Het
Fbxo30 G T 10: 11,291,313 C593F possibly damaging Het
Fut9 A G 4: 25,620,359 F152L probably damaging Het
Galnt2 G A 8: 124,343,346 G534D probably benign Het
Gm973 C T 1: 59,558,234 probably benign Het
Gprc5a T A 6: 135,078,950 S132T probably damaging Het
Hk3 G A 13: 55,014,730 R47C probably damaging Het
Hrnr A T 3: 93,332,508 Q3351L unknown Het
Icam1 T A 9: 21,019,127 F92L probably damaging Het
Ifi213 C T 1: 173,589,800 V349I possibly damaging Het
Il12rb2 T C 6: 67,298,904 probably benign Het
Irx3 A G 8: 91,799,420 V487A possibly damaging Het
Kalrn A G 16: 34,035,554 V204A probably damaging Het
Krt16 T C 11: 100,246,454 probably benign Het
Loxhd1 G A 18: 77,404,969 V1369I probably benign Het
Med13 T A 11: 86,319,596 K573N possibly damaging Het
Mnat1 A G 12: 73,188,188 R204G possibly damaging Het
Myt1l A T 12: 29,827,733 D461V unknown Het
Nek6 T A 2: 38,557,846 S41T probably damaging Het
Nudt22 T C 19: 6,993,506 E232G probably damaging Het
Numbl C A 7: 27,273,990 F192L probably damaging Het
Olfr1202 C T 2: 88,817,882 T237I probably benign Het
Olfr834 T A 9: 18,988,126 I46K probably damaging Het
P2rx4 T C 5: 122,714,404 V47A probably damaging Het
Phka1 T A X: 102,586,104 I478F probably damaging Het
Pkn2 G A 3: 142,830,520 T200I probably damaging Het
Plcg1 T A 2: 160,751,778 probably null Het
Polg2 C T 11: 106,768,413 G425R probably damaging Het
Ptprm G T 17: 66,944,332 probably null Het
Reg1 G A 6: 78,428,118 R108H possibly damaging Het
Slc26a11 T C 11: 119,374,777 L372P probably damaging Het
Slc2a4 C T 11: 69,946,159 V28M possibly damaging Het
Snap29 A G 16: 17,406,148 N9S probably damaging Het
Snd1 C G 6: 28,545,470 probably benign Het
Sorcs3 G A 19: 48,487,406 A235T probably benign Het
Sp100 T A 1: 85,694,281 N362K probably damaging Het
Sqor A T 2: 122,799,855 I32F probably benign Het
Stx6 C T 1: 155,193,294 R189C probably damaging Het
Tchp T C 5: 114,717,453 I298T probably damaging Het
Themis A G 10: 28,761,574 I225V probably benign Het
Timm50 A T 7: 28,306,941 V245E probably damaging Het
Tnxb A G 17: 34,689,354 E1327G probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Tradd T C 8: 105,260,644 E10G possibly damaging Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Ttn T C 2: 76,899,403 probably benign Het
Ttr A T 18: 20,669,977 probably null Het
Ubp1 A G 9: 113,944,931 Y66C probably damaging Het
Vmn2r102 A T 17: 19,677,619 M299L probably benign Het
Vmn2r104 A T 17: 20,042,904 N98K probably damaging Het
Yipf5 A G 18: 40,207,772 S176P probably benign Het
Zpbp2 C T 11: 98,553,937 T97I probably damaging Het
Other mutations in Slc19a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Slc19a2 APN 1 164260861 missense probably damaging 1.00
IGL03231:Slc19a2 APN 1 164260880 missense probably damaging 1.00
R0324:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R1117:Slc19a2 UTSW 1 164263456 missense possibly damaging 0.86
R1165:Slc19a2 UTSW 1 164263445 missense probably damaging 1.00
R1463:Slc19a2 UTSW 1 164257197 missense probably damaging 0.98
R1833:Slc19a2 UTSW 1 164262184 missense probably damaging 1.00
R2148:Slc19a2 UTSW 1 164262088 missense probably damaging 1.00
R2680:Slc19a2 UTSW 1 164249413 missense probably damaging 1.00
R4010:Slc19a2 UTSW 1 164260882 missense probably damaging 1.00
R5850:Slc19a2 UTSW 1 164263456 missense probably benign 0.00
R6279:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R6300:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R6907:Slc19a2 UTSW 1 164262754 missense possibly damaging 0.79
R6917:Slc19a2 UTSW 1 164261009 missense probably damaging 1.00
R6982:Slc19a2 UTSW 1 164256859 missense possibly damaging 0.88
R6993:Slc19a2 UTSW 1 164260822 missense probably benign 0.00
R7424:Slc19a2 UTSW 1 164260876 missense probably benign 0.31
R7575:Slc19a2 UTSW 1 164257122 missense probably damaging 1.00
R8193:Slc19a2 UTSW 1 164257225 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGGAAAGGCTACTCCAGGAGTTACC -3'
(R):5'- ATGCCCAGGTCCACCACAGTATAG -3'

Sequencing Primer
(F):5'- CCAGGAGTTACCTGAACTTACTGTG -3'
(R):5'- CAGGTCCACCACAGTATAGATATAGG -3'
Posted On2013-07-30