Incidental Mutation 'R0709:Ifi213'
ID 62638
Institutional Source Beutler Lab
Gene Symbol Ifi213
Ensembl Gene ENSMUSG00000073491
Gene Name interferon activated gene 213
Synonyms E030037K03Rik, Pydc4, Pyr-A
MMRRC Submission 038892-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R0709 (G1)
Quality Score 207
Status Validated
Chromosome 1
Chromosomal Location 173566283-173599274 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 173589800 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 349 (V349I)
Ref Sequence ENSEMBL: ENSMUSP00000117222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097462] [ENSMUST00000150649] [ENSMUST00000180215]
AlphaFold D3Z5G0
Predicted Effect probably benign
Transcript: ENSMUST00000097462
SMART Domains Protein: ENSMUSP00000095070
Gene: ENSMUSG00000073491

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150649
AA Change: V349I

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117222
Gene: ENSMUSG00000073491
AA Change: V349I

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180215
SMART Domains Protein: ENSMUSP00000136238
Gene: ENSMUSG00000073491

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,494 D137V probably damaging Het
Aar2 C T 2: 156,567,010 P378L probably damaging Het
Abcc5 A T 16: 20,376,592 H718Q possibly damaging Het
Ace G T 11: 105,981,538 L319F probably damaging Het
Angpt4 C A 2: 151,934,514 P321T possibly damaging Het
Atrip T C 9: 109,067,103 N282S probably benign Het
AW554918 A C 18: 25,463,654 S525R probably damaging Het
Casc4 T A 2: 121,867,425 V74E probably damaging Het
Ccdc136 T A 6: 29,414,970 I644N possibly damaging Het
Ccdc178 A G 18: 22,067,662 Y413H probably damaging Het
Ccdc7b A G 8: 129,136,646 H223R probably benign Het
Cd109 T C 9: 78,671,978 V634A possibly damaging Het
Col7a1 T A 9: 108,961,548 probably benign Het
Copb2 A T 9: 98,563,167 probably benign Het
Csrnp3 C T 2: 66,022,563 S445L probably damaging Het
Cxcl13 G T 5: 95,958,671 C34F probably damaging Het
Dars2 T C 1: 161,046,928 E397G probably benign Het
Dlg5 C T 14: 24,146,255 V1625M probably damaging Het
Dnah12 T G 14: 26,884,265 probably benign Het
Eif4a1 C A 11: 69,670,252 A76S probably damaging Het
Fam162b T A 10: 51,587,251 I107L probably damaging Het
Fbxo30 G T 10: 11,291,313 C593F possibly damaging Het
Fut9 A G 4: 25,620,359 F152L probably damaging Het
Galnt2 G A 8: 124,343,346 G534D probably benign Het
Gm973 C T 1: 59,558,234 probably benign Het
Gprc5a T A 6: 135,078,950 S132T probably damaging Het
Hk3 G A 13: 55,014,730 R47C probably damaging Het
Hrnr A T 3: 93,332,508 Q3351L unknown Het
Icam1 T A 9: 21,019,127 F92L probably damaging Het
Il12rb2 T C 6: 67,298,904 probably benign Het
Irx3 A G 8: 91,799,420 V487A possibly damaging Het
Kalrn A G 16: 34,035,554 V204A probably damaging Het
Krt16 T C 11: 100,246,454 probably benign Het
Loxhd1 G A 18: 77,404,969 V1369I probably benign Het
Med13 T A 11: 86,319,596 K573N possibly damaging Het
Mnat1 A G 12: 73,188,188 R204G possibly damaging Het
Myt1l A T 12: 29,827,733 D461V unknown Het
Nek6 T A 2: 38,557,846 S41T probably damaging Het
Nudt22 T C 19: 6,993,506 E232G probably damaging Het
Numbl C A 7: 27,273,990 F192L probably damaging Het
Olfr1202 C T 2: 88,817,882 T237I probably benign Het
Olfr834 T A 9: 18,988,126 I46K probably damaging Het
P2rx4 T C 5: 122,714,404 V47A probably damaging Het
Phka1 T A X: 102,586,104 I478F probably damaging Het
Pkn2 G A 3: 142,830,520 T200I probably damaging Het
Plcg1 T A 2: 160,751,778 probably null Het
Polg2 C T 11: 106,768,413 G425R probably damaging Het
Ptprm G T 17: 66,944,332 probably null Het
Reg1 G A 6: 78,428,118 R108H possibly damaging Het
Slc19a2 T A 1: 164,256,798 F86I probably damaging Het
Slc26a11 T C 11: 119,374,777 L372P probably damaging Het
Slc2a4 C T 11: 69,946,159 V28M possibly damaging Het
Snap29 A G 16: 17,406,148 N9S probably damaging Het
Snd1 C G 6: 28,545,470 probably benign Het
Sorcs3 G A 19: 48,487,406 A235T probably benign Het
Sp100 T A 1: 85,694,281 N362K probably damaging Het
Sqor A T 2: 122,799,855 I32F probably benign Het
Stx6 C T 1: 155,193,294 R189C probably damaging Het
Tchp T C 5: 114,717,453 I298T probably damaging Het
Themis A G 10: 28,761,574 I225V probably benign Het
Timm50 A T 7: 28,306,941 V245E probably damaging Het
Tnxb A G 17: 34,689,354 E1327G probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Tradd T C 8: 105,260,644 E10G possibly damaging Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Ttn T C 2: 76,899,403 probably benign Het
Ttr A T 18: 20,669,977 probably null Het
Ubp1 A G 9: 113,944,931 Y66C probably damaging Het
Vmn2r102 A T 17: 19,677,619 M299L probably benign Het
Vmn2r104 A T 17: 20,042,904 N98K probably damaging Het
Yipf5 A G 18: 40,207,772 S176P probably benign Het
Zpbp2 C T 11: 98,553,937 T97I probably damaging Het
Other mutations in Ifi213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Ifi213 APN 1 173594053 splice site probably benign
IGL00908:Ifi213 APN 1 173595083 missense probably damaging 1.00
IGL00964:Ifi213 APN 1 173593952 missense possibly damaging 0.91
IGL02217:Ifi213 APN 1 173595032 missense possibly damaging 0.91
R1518:Ifi213 UTSW 1 173589663 missense probably damaging 0.99
R1559:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R1822:Ifi213 UTSW 1 173589842 missense probably damaging 0.99
R1839:Ifi213 UTSW 1 173589600 missense probably damaging 0.98
R1989:Ifi213 UTSW 1 173568808 critical splice donor site probably null
R2108:Ifi213 UTSW 1 173569102 critical splice acceptor site probably null
R2696:Ifi213 UTSW 1 173590024 missense probably benign
R3890:Ifi213 UTSW 1 173567256 missense probably benign 0.33
R4544:Ifi213 UTSW 1 173582127 splice site probably null
R4611:Ifi213 UTSW 1 173589914 missense possibly damaging 0.91
R4689:Ifi213 UTSW 1 173590420 missense possibly damaging 0.92
R4710:Ifi213 UTSW 1 173567172 utr 3 prime probably benign
R5126:Ifi213 UTSW 1 173590015 missense possibly damaging 0.85
R5472:Ifi213 UTSW 1 173567272 splice site probably null
R5625:Ifi213 UTSW 1 173569063 missense possibly damaging 0.73
R5789:Ifi213 UTSW 1 173568794 splice site probably benign
R5898:Ifi213 UTSW 1 173568979 missense probably benign 0.01
R6025:Ifi213 UTSW 1 173595234 missense probably damaging 0.99
R6149:Ifi213 UTSW 1 173594015 missense probably benign 0.18
R6348:Ifi213 UTSW 1 173590282 missense possibly damaging 0.46
R6564:Ifi213 UTSW 1 173595296 start codon destroyed probably null 0.06
R7254:Ifi213 UTSW 1 173593963 missense probably damaging 0.98
R7292:Ifi213 UTSW 1 173595125 missense probably damaging 0.99
R7752:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R7901:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R8100:Ifi213 UTSW 1 173595182 missense probably damaging 1.00
R8352:Ifi213 UTSW 1 173595269 missense possibly damaging 0.92
R8425:Ifi213 UTSW 1 173589860 missense probably benign
R8452:Ifi213 UTSW 1 173595269 missense possibly damaging 0.92
R9357:Ifi213 UTSW 1 173568826 missense probably benign 0.01
RF010:Ifi213 UTSW 1 173582153 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACCTGAGGACTATTACAGCCGTG -3'
(R):5'- ACAGCAGCAGTATCCAGCAGTTTC -3'

Sequencing Primer
(F):5'- TGGAGTCACCCAAGGGTTAT -3'
(R):5'- CCTCAGCAAGGTTACTCAGTG -3'
Posted On 2013-07-30