Incidental Mutation 'R0709:Fut9'
ID 62646
Institutional Source Beutler Lab
Gene Symbol Fut9
Ensembl Gene ENSMUSG00000055373
Gene Name fucosyltransferase 9
Synonyms mFuc-TIX, mFUT9
MMRRC Submission 038892-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0709 (G1)
Quality Score 101
Status Validated
Chromosome 4
Chromosomal Location 25609332-25800244 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25620359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 152 (F152L)
Ref Sequence ENSEMBL: ENSMUSP00000103834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]
AlphaFold O88819
Predicted Effect probably damaging
Transcript: ENSMUST00000084770
AA Change: F152L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: F152L

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 6 358 2.9e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108199
AA Change: F152L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: F152L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tran_10_N 61 169 1.4e-43 PFAM
Pfam:Glyco_transf_10 185 357 4.8e-69 PFAM
Meta Mutation Damage Score 0.8413 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,494 D137V probably damaging Het
Aar2 C T 2: 156,567,010 P378L probably damaging Het
Abcc5 A T 16: 20,376,592 H718Q possibly damaging Het
Ace G T 11: 105,981,538 L319F probably damaging Het
Angpt4 C A 2: 151,934,514 P321T possibly damaging Het
Atrip T C 9: 109,067,103 N282S probably benign Het
AW554918 A C 18: 25,463,654 S525R probably damaging Het
Casc4 T A 2: 121,867,425 V74E probably damaging Het
Ccdc136 T A 6: 29,414,970 I644N possibly damaging Het
Ccdc178 A G 18: 22,067,662 Y413H probably damaging Het
Ccdc7b A G 8: 129,136,646 H223R probably benign Het
Cd109 T C 9: 78,671,978 V634A possibly damaging Het
Col7a1 T A 9: 108,961,548 probably benign Het
Copb2 A T 9: 98,563,167 probably benign Het
Csrnp3 C T 2: 66,022,563 S445L probably damaging Het
Cxcl13 G T 5: 95,958,671 C34F probably damaging Het
Dars2 T C 1: 161,046,928 E397G probably benign Het
Dlg5 C T 14: 24,146,255 V1625M probably damaging Het
Dnah12 T G 14: 26,884,265 probably benign Het
Eif4a1 C A 11: 69,670,252 A76S probably damaging Het
Fam162b T A 10: 51,587,251 I107L probably damaging Het
Fbxo30 G T 10: 11,291,313 C593F possibly damaging Het
Galnt2 G A 8: 124,343,346 G534D probably benign Het
Gm973 C T 1: 59,558,234 probably benign Het
Gprc5a T A 6: 135,078,950 S132T probably damaging Het
Hk3 G A 13: 55,014,730 R47C probably damaging Het
Hrnr A T 3: 93,332,508 Q3351L unknown Het
Icam1 T A 9: 21,019,127 F92L probably damaging Het
Ifi213 C T 1: 173,589,800 V349I possibly damaging Het
Il12rb2 T C 6: 67,298,904 probably benign Het
Irx3 A G 8: 91,799,420 V487A possibly damaging Het
Kalrn A G 16: 34,035,554 V204A probably damaging Het
Krt16 T C 11: 100,246,454 probably benign Het
Loxhd1 G A 18: 77,404,969 V1369I probably benign Het
Med13 T A 11: 86,319,596 K573N possibly damaging Het
Mnat1 A G 12: 73,188,188 R204G possibly damaging Het
Myt1l A T 12: 29,827,733 D461V unknown Het
Nek6 T A 2: 38,557,846 S41T probably damaging Het
Nudt22 T C 19: 6,993,506 E232G probably damaging Het
Numbl C A 7: 27,273,990 F192L probably damaging Het
Olfr1202 C T 2: 88,817,882 T237I probably benign Het
Olfr834 T A 9: 18,988,126 I46K probably damaging Het
P2rx4 T C 5: 122,714,404 V47A probably damaging Het
Phka1 T A X: 102,586,104 I478F probably damaging Het
Pkn2 G A 3: 142,830,520 T200I probably damaging Het
Plcg1 T A 2: 160,751,778 probably null Het
Polg2 C T 11: 106,768,413 G425R probably damaging Het
Ptprm G T 17: 66,944,332 probably null Het
Reg1 G A 6: 78,428,118 R108H possibly damaging Het
Slc19a2 T A 1: 164,256,798 F86I probably damaging Het
Slc26a11 T C 11: 119,374,777 L372P probably damaging Het
Slc2a4 C T 11: 69,946,159 V28M possibly damaging Het
Snap29 A G 16: 17,406,148 N9S probably damaging Het
Snd1 C G 6: 28,545,470 probably benign Het
Sorcs3 G A 19: 48,487,406 A235T probably benign Het
Sp100 T A 1: 85,694,281 N362K probably damaging Het
Sqor A T 2: 122,799,855 I32F probably benign Het
Stx6 C T 1: 155,193,294 R189C probably damaging Het
Tchp T C 5: 114,717,453 I298T probably damaging Het
Themis A G 10: 28,761,574 I225V probably benign Het
Timm50 A T 7: 28,306,941 V245E probably damaging Het
Tnxb A G 17: 34,689,354 E1327G probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Tradd T C 8: 105,260,644 E10G possibly damaging Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Ttn T C 2: 76,899,403 probably benign Het
Ttr A T 18: 20,669,977 probably null Het
Ubp1 A G 9: 113,944,931 Y66C probably damaging Het
Vmn2r102 A T 17: 19,677,619 M299L probably benign Het
Vmn2r104 A T 17: 20,042,904 N98K probably damaging Het
Yipf5 A G 18: 40,207,772 S176P probably benign Het
Zpbp2 C T 11: 98,553,937 T97I probably damaging Het
Other mutations in Fut9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Fut9 APN 4 25620316 missense possibly damaging 0.71
IGL01134:Fut9 APN 4 25620446 missense probably benign 0.13
IGL01330:Fut9 APN 4 25619791 missense possibly damaging 0.95
IGL01732:Fut9 APN 4 25619867 missense possibly damaging 0.58
IGL02824:Fut9 APN 4 25620037 missense probably damaging 1.00
ANU74:Fut9 UTSW 4 25620802 missense probably benign 0.25
R0280:Fut9 UTSW 4 25619852 missense probably benign 0.00
R0408:Fut9 UTSW 4 25620319 missense possibly damaging 0.69
R0594:Fut9 UTSW 4 25620526 missense possibly damaging 0.94
R0609:Fut9 UTSW 4 25620811 start codon destroyed probably null 0.98
R1567:Fut9 UTSW 4 25620344 missense probably damaging 0.99
R1719:Fut9 UTSW 4 25619744 missense possibly damaging 0.62
R1856:Fut9 UTSW 4 25620352 missense probably damaging 1.00
R2036:Fut9 UTSW 4 25620322 missense probably damaging 1.00
R2165:Fut9 UTSW 4 25619733 makesense probably null
R2165:Fut9 UTSW 4 25619734 makesense probably null
R2332:Fut9 UTSW 4 25619823 nonsense probably null
R4539:Fut9 UTSW 4 25619793 missense probably damaging 1.00
R4722:Fut9 UTSW 4 25799734 utr 5 prime probably benign
R4766:Fut9 UTSW 4 25799191 intron probably benign
R4937:Fut9 UTSW 4 25799591 splice site probably benign
R5025:Fut9 UTSW 4 25620502 missense probably damaging 1.00
R5032:Fut9 UTSW 4 25799245 intron probably benign
R5158:Fut9 UTSW 4 25620731 missense probably benign 0.01
R5601:Fut9 UTSW 4 25620299 missense probably benign 0.00
R5974:Fut9 UTSW 4 25620090 nonsense probably null
R6315:Fut9 UTSW 4 25619774 missense probably damaging 1.00
R6385:Fut9 UTSW 4 25620328 missense probably damaging 1.00
R6652:Fut9 UTSW 4 25620619 missense probably benign 0.44
R6809:Fut9 UTSW 4 25620647 missense probably benign
R6825:Fut9 UTSW 4 25619925 missense probably benign
R7145:Fut9 UTSW 4 25620507 missense probably damaging 0.96
R7573:Fut9 UTSW 4 25620691 missense probably benign 0.04
R8933:Fut9 UTSW 4 25619861 missense probably damaging 1.00
R9715:Fut9 UTSW 4 25620679 missense probably benign 0.00
X0057:Fut9 UTSW 4 25799686 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCTCGTTGTAATACTTGACCCTGGC -3'
(R):5'- GGGCAGACCTTTGACCTTACATCC -3'

Sequencing Primer
(F):5'- CATGCTCAGGGTTCCAGTTAC -3'
(R):5'- CAATGTTCAATATCCAAGGGTGC -3'
Posted On 2013-07-30