Incidental Mutation 'R0709:Fut9'
ID 62646
Institutional Source Beutler Lab
Gene Symbol Fut9
Ensembl Gene ENSMUSG00000055373
Gene Name fucosyltransferase 9
Synonyms mFUT9, mFuc-TIX
MMRRC Submission 038892-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0709 (G1)
Quality Score 101
Status Validated
Chromosome 4
Chromosomal Location 25609333-25800003 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25620359 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 152 (F152L)
Ref Sequence ENSEMBL: ENSMUSP00000103834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]
AlphaFold O88819
Predicted Effect probably damaging
Transcript: ENSMUST00000084770
AA Change: F152L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: F152L

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 6 358 2.9e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108199
AA Change: F152L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: F152L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tran_10_N 61 169 1.4e-43 PFAM
Pfam:Glyco_transf_10 185 357 4.8e-69 PFAM
Meta Mutation Damage Score 0.8413 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,436,358 (GRCm39) D137V probably damaging Het
Aar2 C T 2: 156,408,930 (GRCm39) P378L probably damaging Het
Abcc5 A T 16: 20,195,342 (GRCm39) H718Q possibly damaging Het
Ace G T 11: 105,872,364 (GRCm39) L319F probably damaging Het
Angpt4 C A 2: 151,776,434 (GRCm39) P321T possibly damaging Het
Atrip T C 9: 108,896,171 (GRCm39) N282S probably benign Het
AW554918 A C 18: 25,596,711 (GRCm39) S525R probably damaging Het
Ccdc136 T A 6: 29,414,969 (GRCm39) I644N possibly damaging Het
Ccdc178 A G 18: 22,200,719 (GRCm39) Y413H probably damaging Het
Ccdc7b A G 8: 129,863,127 (GRCm39) H223R probably benign Het
Cd109 T C 9: 78,579,260 (GRCm39) V634A possibly damaging Het
Col7a1 T A 9: 108,790,616 (GRCm39) probably benign Het
Copb2 A T 9: 98,445,220 (GRCm39) probably benign Het
Csrnp3 C T 2: 65,852,907 (GRCm39) S445L probably damaging Het
Cxcl13 G T 5: 96,106,530 (GRCm39) C34F probably damaging Het
Dars2 T C 1: 160,874,498 (GRCm39) E397G probably benign Het
Dlg5 C T 14: 24,196,323 (GRCm39) V1625M probably damaging Het
Dnah12 T G 14: 26,606,222 (GRCm39) probably benign Het
Eif4a1 C A 11: 69,561,078 (GRCm39) A76S probably damaging Het
Fam162b T A 10: 51,463,347 (GRCm39) I107L probably damaging Het
Fbxo30 G T 10: 11,167,057 (GRCm39) C593F possibly damaging Het
Galnt2 G A 8: 125,070,085 (GRCm39) G534D probably benign Het
Gm973 C T 1: 59,597,393 (GRCm39) probably benign Het
Golm2 T A 2: 121,697,906 (GRCm39) V74E probably damaging Het
Gprc5a T A 6: 135,055,948 (GRCm39) S132T probably damaging Het
Hk3 G A 13: 55,162,543 (GRCm39) R47C probably damaging Het
Hrnr A T 3: 93,239,815 (GRCm39) Q3351L unknown Het
Icam1 T A 9: 20,930,423 (GRCm39) F92L probably damaging Het
Ifi213 C T 1: 173,417,366 (GRCm39) V349I possibly damaging Het
Il12rb2 T C 6: 67,275,888 (GRCm39) probably benign Het
Irx3 A G 8: 92,526,048 (GRCm39) V487A possibly damaging Het
Kalrn A G 16: 33,855,924 (GRCm39) V204A probably damaging Het
Krt16 T C 11: 100,137,280 (GRCm39) probably benign Het
Loxhd1 G A 18: 77,492,665 (GRCm39) V1369I probably benign Het
Med13 T A 11: 86,210,422 (GRCm39) K573N possibly damaging Het
Mnat1 A G 12: 73,234,962 (GRCm39) R204G possibly damaging Het
Myt1l A T 12: 29,877,732 (GRCm39) D461V unknown Het
Nek6 T A 2: 38,447,858 (GRCm39) S41T probably damaging Het
Nudt22 T C 19: 6,970,874 (GRCm39) E232G probably damaging Het
Numbl C A 7: 26,973,415 (GRCm39) F192L probably damaging Het
Or4c105 C T 2: 88,648,226 (GRCm39) T237I probably benign Het
Or7g12 T A 9: 18,899,422 (GRCm39) I46K probably damaging Het
P2rx4 T C 5: 122,852,467 (GRCm39) V47A probably damaging Het
Phka1 T A X: 101,629,710 (GRCm39) I478F probably damaging Het
Pkn2 G A 3: 142,536,281 (GRCm39) T200I probably damaging Het
Plcg1 T A 2: 160,593,698 (GRCm39) probably null Het
Polg2 C T 11: 106,659,239 (GRCm39) G425R probably damaging Het
Ptprm G T 17: 67,251,327 (GRCm39) probably null Het
Reg1 G A 6: 78,405,101 (GRCm39) R108H possibly damaging Het
Slc19a2 T A 1: 164,084,367 (GRCm39) F86I probably damaging Het
Slc26a11 T C 11: 119,265,603 (GRCm39) L372P probably damaging Het
Slc2a4 C T 11: 69,836,985 (GRCm39) V28M possibly damaging Het
Snap29 A G 16: 17,224,012 (GRCm39) N9S probably damaging Het
Snd1 C G 6: 28,545,469 (GRCm39) probably benign Het
Sorcs3 G A 19: 48,475,845 (GRCm39) A235T probably benign Het
Sp100 T A 1: 85,622,002 (GRCm39) N362K probably damaging Het
Sqor A T 2: 122,641,775 (GRCm39) I32F probably benign Het
Stx6 C T 1: 155,069,040 (GRCm39) R189C probably damaging Het
Tchp T C 5: 114,855,514 (GRCm39) I298T probably damaging Het
Themis A G 10: 28,637,570 (GRCm39) I225V probably benign Het
Timm50 A T 7: 28,006,366 (GRCm39) V245E probably damaging Het
Tnxb A G 17: 34,908,328 (GRCm39) E1327G probably damaging Het
Tpp1 C T 7: 105,398,814 (GRCm39) R205H probably benign Het
Tradd T C 8: 105,987,276 (GRCm39) E10G possibly damaging Het
Trim43a G A 9: 88,464,199 (GRCm39) E37K probably benign Het
Ttn T C 2: 76,729,747 (GRCm39) probably benign Het
Ttr A T 18: 20,803,034 (GRCm39) probably null Het
Ubp1 A G 9: 113,773,999 (GRCm39) Y66C probably damaging Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r104 A T 17: 20,263,166 (GRCm39) N98K probably damaging Het
Yipf5 A G 18: 40,340,825 (GRCm39) S176P probably benign Het
Zpbp2 C T 11: 98,444,763 (GRCm39) T97I probably damaging Het
Other mutations in Fut9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Fut9 APN 4 25,620,316 (GRCm39) missense possibly damaging 0.71
IGL01134:Fut9 APN 4 25,620,446 (GRCm39) missense probably benign 0.13
IGL01330:Fut9 APN 4 25,619,791 (GRCm39) missense possibly damaging 0.95
IGL01732:Fut9 APN 4 25,619,867 (GRCm39) missense possibly damaging 0.58
IGL02824:Fut9 APN 4 25,620,037 (GRCm39) missense probably damaging 1.00
ANU74:Fut9 UTSW 4 25,620,802 (GRCm39) missense probably benign 0.25
R0280:Fut9 UTSW 4 25,619,852 (GRCm39) missense probably benign 0.00
R0408:Fut9 UTSW 4 25,620,319 (GRCm39) missense possibly damaging 0.69
R0594:Fut9 UTSW 4 25,620,526 (GRCm39) missense possibly damaging 0.94
R0609:Fut9 UTSW 4 25,620,811 (GRCm39) start codon destroyed probably null 0.98
R1567:Fut9 UTSW 4 25,620,344 (GRCm39) missense probably damaging 0.99
R1719:Fut9 UTSW 4 25,619,744 (GRCm39) missense possibly damaging 0.62
R1856:Fut9 UTSW 4 25,620,352 (GRCm39) missense probably damaging 1.00
R2036:Fut9 UTSW 4 25,620,322 (GRCm39) missense probably damaging 1.00
R2165:Fut9 UTSW 4 25,619,734 (GRCm39) makesense probably null
R2165:Fut9 UTSW 4 25,619,733 (GRCm39) makesense probably null
R2332:Fut9 UTSW 4 25,619,823 (GRCm39) nonsense probably null
R4539:Fut9 UTSW 4 25,619,793 (GRCm39) missense probably damaging 1.00
R4722:Fut9 UTSW 4 25,799,734 (GRCm39) utr 5 prime probably benign
R4766:Fut9 UTSW 4 25,799,191 (GRCm39) intron probably benign
R4937:Fut9 UTSW 4 25,799,591 (GRCm39) splice site probably benign
R5025:Fut9 UTSW 4 25,620,502 (GRCm39) missense probably damaging 1.00
R5032:Fut9 UTSW 4 25,799,245 (GRCm39) intron probably benign
R5158:Fut9 UTSW 4 25,620,731 (GRCm39) missense probably benign 0.01
R5601:Fut9 UTSW 4 25,620,299 (GRCm39) missense probably benign 0.00
R5974:Fut9 UTSW 4 25,620,090 (GRCm39) nonsense probably null
R6315:Fut9 UTSW 4 25,619,774 (GRCm39) missense probably damaging 1.00
R6385:Fut9 UTSW 4 25,620,328 (GRCm39) missense probably damaging 1.00
R6652:Fut9 UTSW 4 25,620,619 (GRCm39) missense probably benign 0.44
R6809:Fut9 UTSW 4 25,620,647 (GRCm39) missense probably benign
R6825:Fut9 UTSW 4 25,619,925 (GRCm39) missense probably benign
R7145:Fut9 UTSW 4 25,620,507 (GRCm39) missense probably damaging 0.96
R7573:Fut9 UTSW 4 25,620,691 (GRCm39) missense probably benign 0.04
R8933:Fut9 UTSW 4 25,619,861 (GRCm39) missense probably damaging 1.00
R9715:Fut9 UTSW 4 25,620,679 (GRCm39) missense probably benign 0.00
X0057:Fut9 UTSW 4 25,799,686 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCTCGTTGTAATACTTGACCCTGGC -3'
(R):5'- GGGCAGACCTTTGACCTTACATCC -3'

Sequencing Primer
(F):5'- CATGCTCAGGGTTCCAGTTAC -3'
(R):5'- CAATGTTCAATATCCAAGGGTGC -3'
Posted On 2013-07-30