Incidental Mutation 'R0709:Reg1'
ID 62653
Institutional Source Beutler Lab
Gene Symbol Reg1
Ensembl Gene ENSMUSG00000059654
Gene Name regenerating islet-derived 1
Synonyms pancreatic stone protein
MMRRC Submission 038892-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0709 (G1)
Quality Score 205
Status Validated
Chromosome 6
Chromosomal Location 78402966-78405651 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78405101 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 108 (R108H)
Ref Sequence ENSEMBL: ENSMUSP00000145161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079926] [ENSMUST00000204601] [ENSMUST00000204687]
AlphaFold P43137
Predicted Effect possibly damaging
Transcript: ENSMUST00000079926
AA Change: R108H

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078847
Gene: ENSMUSG00000059654
AA Change: R108H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 35 162 1.17e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204601
AA Change: R108H

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144840
Gene: ENSMUSG00000059654
AA Change: R108H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 35 162 1.17e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204687
AA Change: R108H

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145161
Gene: ENSMUSG00000059654
AA Change: R108H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 35 162 1.17e-34 SMART
Meta Mutation Damage Score 0.0982 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type I subclass member of the Reg gene family. The Reg gene family is a multigene family grouped into four subclasses, types I, II, III and IV, based on the primary structures of the encoded proteins. This gene encodes a protein that is secreted by the exocrine pancreas. It is associated with islet cell regeneration and diabetogenesis and may be involved in pancreatic lithogenesis. Reg family members REG1B, REGL, PAP and this gene are tandemly clustered on chromosome 2p12 and may have arisen from the same ancestral gene by gene duplication. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation appear normal. However, [3-H] thymidine incorporation into isolated pancreatic islets was reduced and GTG-induced islet hyperplasia was attenuated, suggesting a role for this gene in islet cell growth or regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,436,358 (GRCm39) D137V probably damaging Het
Aar2 C T 2: 156,408,930 (GRCm39) P378L probably damaging Het
Abcc5 A T 16: 20,195,342 (GRCm39) H718Q possibly damaging Het
Ace G T 11: 105,872,364 (GRCm39) L319F probably damaging Het
Angpt4 C A 2: 151,776,434 (GRCm39) P321T possibly damaging Het
Atrip T C 9: 108,896,171 (GRCm39) N282S probably benign Het
AW554918 A C 18: 25,596,711 (GRCm39) S525R probably damaging Het
Ccdc136 T A 6: 29,414,969 (GRCm39) I644N possibly damaging Het
Ccdc178 A G 18: 22,200,719 (GRCm39) Y413H probably damaging Het
Ccdc7b A G 8: 129,863,127 (GRCm39) H223R probably benign Het
Cd109 T C 9: 78,579,260 (GRCm39) V634A possibly damaging Het
Col7a1 T A 9: 108,790,616 (GRCm39) probably benign Het
Copb2 A T 9: 98,445,220 (GRCm39) probably benign Het
Csrnp3 C T 2: 65,852,907 (GRCm39) S445L probably damaging Het
Cxcl13 G T 5: 96,106,530 (GRCm39) C34F probably damaging Het
Dars2 T C 1: 160,874,498 (GRCm39) E397G probably benign Het
Dlg5 C T 14: 24,196,323 (GRCm39) V1625M probably damaging Het
Dnah12 T G 14: 26,606,222 (GRCm39) probably benign Het
Eif4a1 C A 11: 69,561,078 (GRCm39) A76S probably damaging Het
Fam162b T A 10: 51,463,347 (GRCm39) I107L probably damaging Het
Fbxo30 G T 10: 11,167,057 (GRCm39) C593F possibly damaging Het
Fut9 A G 4: 25,620,359 (GRCm39) F152L probably damaging Het
Galnt2 G A 8: 125,070,085 (GRCm39) G534D probably benign Het
Gm973 C T 1: 59,597,393 (GRCm39) probably benign Het
Golm2 T A 2: 121,697,906 (GRCm39) V74E probably damaging Het
Gprc5a T A 6: 135,055,948 (GRCm39) S132T probably damaging Het
Hk3 G A 13: 55,162,543 (GRCm39) R47C probably damaging Het
Hrnr A T 3: 93,239,815 (GRCm39) Q3351L unknown Het
Icam1 T A 9: 20,930,423 (GRCm39) F92L probably damaging Het
Ifi213 C T 1: 173,417,366 (GRCm39) V349I possibly damaging Het
Il12rb2 T C 6: 67,275,888 (GRCm39) probably benign Het
Irx3 A G 8: 92,526,048 (GRCm39) V487A possibly damaging Het
Kalrn A G 16: 33,855,924 (GRCm39) V204A probably damaging Het
Krt16 T C 11: 100,137,280 (GRCm39) probably benign Het
Loxhd1 G A 18: 77,492,665 (GRCm39) V1369I probably benign Het
Med13 T A 11: 86,210,422 (GRCm39) K573N possibly damaging Het
Mnat1 A G 12: 73,234,962 (GRCm39) R204G possibly damaging Het
Myt1l A T 12: 29,877,732 (GRCm39) D461V unknown Het
Nek6 T A 2: 38,447,858 (GRCm39) S41T probably damaging Het
Nudt22 T C 19: 6,970,874 (GRCm39) E232G probably damaging Het
Numbl C A 7: 26,973,415 (GRCm39) F192L probably damaging Het
Or4c105 C T 2: 88,648,226 (GRCm39) T237I probably benign Het
Or7g12 T A 9: 18,899,422 (GRCm39) I46K probably damaging Het
P2rx4 T C 5: 122,852,467 (GRCm39) V47A probably damaging Het
Phka1 T A X: 101,629,710 (GRCm39) I478F probably damaging Het
Pkn2 G A 3: 142,536,281 (GRCm39) T200I probably damaging Het
Plcg1 T A 2: 160,593,698 (GRCm39) probably null Het
Polg2 C T 11: 106,659,239 (GRCm39) G425R probably damaging Het
Ptprm G T 17: 67,251,327 (GRCm39) probably null Het
Slc19a2 T A 1: 164,084,367 (GRCm39) F86I probably damaging Het
Slc26a11 T C 11: 119,265,603 (GRCm39) L372P probably damaging Het
Slc2a4 C T 11: 69,836,985 (GRCm39) V28M possibly damaging Het
Snap29 A G 16: 17,224,012 (GRCm39) N9S probably damaging Het
Snd1 C G 6: 28,545,469 (GRCm39) probably benign Het
Sorcs3 G A 19: 48,475,845 (GRCm39) A235T probably benign Het
Sp100 T A 1: 85,622,002 (GRCm39) N362K probably damaging Het
Sqor A T 2: 122,641,775 (GRCm39) I32F probably benign Het
Stx6 C T 1: 155,069,040 (GRCm39) R189C probably damaging Het
Tchp T C 5: 114,855,514 (GRCm39) I298T probably damaging Het
Themis A G 10: 28,637,570 (GRCm39) I225V probably benign Het
Timm50 A T 7: 28,006,366 (GRCm39) V245E probably damaging Het
Tnxb A G 17: 34,908,328 (GRCm39) E1327G probably damaging Het
Tpp1 C T 7: 105,398,814 (GRCm39) R205H probably benign Het
Tradd T C 8: 105,987,276 (GRCm39) E10G possibly damaging Het
Trim43a G A 9: 88,464,199 (GRCm39) E37K probably benign Het
Ttn T C 2: 76,729,747 (GRCm39) probably benign Het
Ttr A T 18: 20,803,034 (GRCm39) probably null Het
Ubp1 A G 9: 113,773,999 (GRCm39) Y66C probably damaging Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r104 A T 17: 20,263,166 (GRCm39) N98K probably damaging Het
Yipf5 A G 18: 40,340,825 (GRCm39) S176P probably benign Het
Zpbp2 C T 11: 98,444,763 (GRCm39) T97I probably damaging Het
Other mutations in Reg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Reg1 APN 6 78,404,321 (GRCm39) missense probably damaging 0.96
R1703:Reg1 UTSW 6 78,405,432 (GRCm39) missense probably damaging 1.00
R2943:Reg1 UTSW 6 78,405,128 (GRCm39) missense possibly damaging 0.94
R4006:Reg1 UTSW 6 78,404,013 (GRCm39) missense probably null 0.98
R4007:Reg1 UTSW 6 78,404,013 (GRCm39) missense probably null 0.98
R4780:Reg1 UTSW 6 78,403,333 (GRCm39) missense possibly damaging 0.91
R4983:Reg1 UTSW 6 78,405,196 (GRCm39) missense possibly damaging 0.56
R5884:Reg1 UTSW 6 78,405,200 (GRCm39) missense possibly damaging 0.94
R6213:Reg1 UTSW 6 78,404,386 (GRCm39) missense possibly damaging 0.88
R6222:Reg1 UTSW 6 78,404,357 (GRCm39) missense probably benign 0.40
R8266:Reg1 UTSW 6 78,404,342 (GRCm39) missense possibly damaging 0.93
R9040:Reg1 UTSW 6 78,403,268 (GRCm39) splice site probably benign
Z1088:Reg1 UTSW 6 78,403,901 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGCCTCCAGAAAGAAAACTTAGGAAC -3'
(R):5'- AAATGTAGAATTCCTCTGCCTCTTGCC -3'

Sequencing Primer
(F):5'- TCACTCTTCAAACtttttgttgttg -3'
(R):5'- TCTTGCCCCAGACCCAG -3'
Posted On 2013-07-30