Incidental Mutation 'R0709:Reg1'
ID62653
Institutional Source Beutler Lab
Gene Symbol Reg1
Ensembl Gene ENSMUSG00000059654
Gene Nameregenerating islet-derived 1
Synonymspancreatic stone protein
MMRRC Submission 038892-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0709 (G1)
Quality Score205
Status Validated
Chromosome6
Chromosomal Location78422711-78428667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78428118 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 108 (R108H)
Ref Sequence ENSEMBL: ENSMUSP00000145161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079926] [ENSMUST00000204601] [ENSMUST00000204687]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079926
AA Change: R108H

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078847
Gene: ENSMUSG00000059654
AA Change: R108H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 35 162 1.17e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204601
AA Change: R108H

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144840
Gene: ENSMUSG00000059654
AA Change: R108H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 35 162 1.17e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204687
AA Change: R108H

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145161
Gene: ENSMUSG00000059654
AA Change: R108H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 35 162 1.17e-34 SMART
Meta Mutation Damage Score 0.0982 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type I subclass member of the Reg gene family. The Reg gene family is a multigene family grouped into four subclasses, types I, II, III and IV, based on the primary structures of the encoded proteins. This gene encodes a protein that is secreted by the exocrine pancreas. It is associated with islet cell regeneration and diabetogenesis and may be involved in pancreatic lithogenesis. Reg family members REG1B, REGL, PAP and this gene are tandemly clustered on chromosome 2p12 and may have arisen from the same ancestral gene by gene duplication. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation appear normal. However, [3-H] thymidine incorporation into isolated pancreatic islets was reduced and GTG-induced islet hyperplasia was attenuated, suggesting a role for this gene in islet cell growth or regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,494 D137V probably damaging Het
Aar2 C T 2: 156,567,010 P378L probably damaging Het
Abcc5 A T 16: 20,376,592 H718Q possibly damaging Het
Ace G T 11: 105,981,538 L319F probably damaging Het
Angpt4 C A 2: 151,934,514 P321T possibly damaging Het
Atrip T C 9: 109,067,103 N282S probably benign Het
AW554918 A C 18: 25,463,654 S525R probably damaging Het
Casc4 T A 2: 121,867,425 V74E probably damaging Het
Ccdc136 T A 6: 29,414,970 I644N possibly damaging Het
Ccdc178 A G 18: 22,067,662 Y413H probably damaging Het
Ccdc7b A G 8: 129,136,646 H223R probably benign Het
Cd109 T C 9: 78,671,978 V634A possibly damaging Het
Col7a1 T A 9: 108,961,548 probably benign Het
Copb2 A T 9: 98,563,167 probably benign Het
Csrnp3 C T 2: 66,022,563 S445L probably damaging Het
Cxcl13 G T 5: 95,958,671 C34F probably damaging Het
Dars2 T C 1: 161,046,928 E397G probably benign Het
Dlg5 C T 14: 24,146,255 V1625M probably damaging Het
Dnah12 T G 14: 26,884,265 probably benign Het
Eif4a1 C A 11: 69,670,252 A76S probably damaging Het
Fam162b T A 10: 51,587,251 I107L probably damaging Het
Fbxo30 G T 10: 11,291,313 C593F possibly damaging Het
Fut9 A G 4: 25,620,359 F152L probably damaging Het
Galnt2 G A 8: 124,343,346 G534D probably benign Het
Gm973 C T 1: 59,558,234 probably benign Het
Gprc5a T A 6: 135,078,950 S132T probably damaging Het
Hk3 G A 13: 55,014,730 R47C probably damaging Het
Hrnr A T 3: 93,332,508 Q3351L unknown Het
Icam1 T A 9: 21,019,127 F92L probably damaging Het
Ifi213 C T 1: 173,589,800 V349I possibly damaging Het
Il12rb2 T C 6: 67,298,904 probably benign Het
Irx3 A G 8: 91,799,420 V487A possibly damaging Het
Kalrn A G 16: 34,035,554 V204A probably damaging Het
Krt16 T C 11: 100,246,454 probably benign Het
Loxhd1 G A 18: 77,404,969 V1369I probably benign Het
Med13 T A 11: 86,319,596 K573N possibly damaging Het
Mnat1 A G 12: 73,188,188 R204G possibly damaging Het
Myt1l A T 12: 29,827,733 D461V unknown Het
Nek6 T A 2: 38,557,846 S41T probably damaging Het
Nudt22 T C 19: 6,993,506 E232G probably damaging Het
Numbl C A 7: 27,273,990 F192L probably damaging Het
Olfr1202 C T 2: 88,817,882 T237I probably benign Het
Olfr834 T A 9: 18,988,126 I46K probably damaging Het
P2rx4 T C 5: 122,714,404 V47A probably damaging Het
Phka1 T A X: 102,586,104 I478F probably damaging Het
Pkn2 G A 3: 142,830,520 T200I probably damaging Het
Plcg1 T A 2: 160,751,778 probably null Het
Polg2 C T 11: 106,768,413 G425R probably damaging Het
Ptprm G T 17: 66,944,332 probably null Het
Slc19a2 T A 1: 164,256,798 F86I probably damaging Het
Slc26a11 T C 11: 119,374,777 L372P probably damaging Het
Slc2a4 C T 11: 69,946,159 V28M possibly damaging Het
Snap29 A G 16: 17,406,148 N9S probably damaging Het
Snd1 C G 6: 28,545,470 probably benign Het
Sorcs3 G A 19: 48,487,406 A235T probably benign Het
Sp100 T A 1: 85,694,281 N362K probably damaging Het
Sqor A T 2: 122,799,855 I32F probably benign Het
Stx6 C T 1: 155,193,294 R189C probably damaging Het
Tchp T C 5: 114,717,453 I298T probably damaging Het
Themis A G 10: 28,761,574 I225V probably benign Het
Timm50 A T 7: 28,306,941 V245E probably damaging Het
Tnxb A G 17: 34,689,354 E1327G probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Tradd T C 8: 105,260,644 E10G possibly damaging Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Ttn T C 2: 76,899,403 probably benign Het
Ttr A T 18: 20,669,977 probably null Het
Ubp1 A G 9: 113,944,931 Y66C probably damaging Het
Vmn2r102 A T 17: 19,677,619 M299L probably benign Het
Vmn2r104 A T 17: 20,042,904 N98K probably damaging Het
Yipf5 A G 18: 40,207,772 S176P probably benign Het
Zpbp2 C T 11: 98,553,937 T97I probably damaging Het
Other mutations in Reg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Reg1 APN 6 78427338 missense probably damaging 0.96
R1703:Reg1 UTSW 6 78428449 missense probably damaging 1.00
R2943:Reg1 UTSW 6 78428145 missense possibly damaging 0.94
R4006:Reg1 UTSW 6 78427030 missense probably null 0.98
R4007:Reg1 UTSW 6 78427030 missense probably null 0.98
R4780:Reg1 UTSW 6 78426350 missense possibly damaging 0.91
R4983:Reg1 UTSW 6 78428213 missense possibly damaging 0.56
R5884:Reg1 UTSW 6 78428217 missense possibly damaging 0.94
R6213:Reg1 UTSW 6 78427403 missense possibly damaging 0.88
R6222:Reg1 UTSW 6 78427374 missense probably benign 0.40
R8266:Reg1 UTSW 6 78427359 missense possibly damaging 0.93
Z1088:Reg1 UTSW 6 78426918 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGCCTCCAGAAAGAAAACTTAGGAAC -3'
(R):5'- AAATGTAGAATTCCTCTGCCTCTTGCC -3'

Sequencing Primer
(F):5'- TCACTCTTCAAACtttttgttgttg -3'
(R):5'- TCTTGCCCCAGACCCAG -3'
Posted On2013-07-30