Incidental Mutation 'R0709:Or7g12'
ID 62660
Institutional Source Beutler Lab
Gene Symbol Or7g12
Ensembl Gene ENSMUSG00000095525
Gene Name olfactory receptor family 7 subfamily G member 12
Synonyms GA_x6K02T2PVTD-12724921-12725859, MOR153-2, Olfr834, MOR153-4_p
MMRRC Submission 038892-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.312) question?
Stock # R0709 (G1)
Quality Score 82
Status Validated
Chromosome 9
Chromosomal Location 18899286-18900224 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18899422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 46 (I46K)
Ref Sequence ENSEMBL: ENSMUSP00000083680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086492]
AlphaFold Q7TRG8
Predicted Effect probably damaging
Transcript: ENSMUST00000086492
AA Change: I46K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083680
Gene: ENSMUSG00000095525
AA Change: I46K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.2e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7e-6 PFAM
Pfam:7tm_1 41 290 2.9e-20 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,436,358 (GRCm39) D137V probably damaging Het
Aar2 C T 2: 156,408,930 (GRCm39) P378L probably damaging Het
Abcc5 A T 16: 20,195,342 (GRCm39) H718Q possibly damaging Het
Ace G T 11: 105,872,364 (GRCm39) L319F probably damaging Het
Angpt4 C A 2: 151,776,434 (GRCm39) P321T possibly damaging Het
Atrip T C 9: 108,896,171 (GRCm39) N282S probably benign Het
AW554918 A C 18: 25,596,711 (GRCm39) S525R probably damaging Het
Ccdc136 T A 6: 29,414,969 (GRCm39) I644N possibly damaging Het
Ccdc178 A G 18: 22,200,719 (GRCm39) Y413H probably damaging Het
Ccdc7b A G 8: 129,863,127 (GRCm39) H223R probably benign Het
Cd109 T C 9: 78,579,260 (GRCm39) V634A possibly damaging Het
Col7a1 T A 9: 108,790,616 (GRCm39) probably benign Het
Copb2 A T 9: 98,445,220 (GRCm39) probably benign Het
Csrnp3 C T 2: 65,852,907 (GRCm39) S445L probably damaging Het
Cxcl13 G T 5: 96,106,530 (GRCm39) C34F probably damaging Het
Dars2 T C 1: 160,874,498 (GRCm39) E397G probably benign Het
Dlg5 C T 14: 24,196,323 (GRCm39) V1625M probably damaging Het
Dnah12 T G 14: 26,606,222 (GRCm39) probably benign Het
Eif4a1 C A 11: 69,561,078 (GRCm39) A76S probably damaging Het
Fam162b T A 10: 51,463,347 (GRCm39) I107L probably damaging Het
Fbxo30 G T 10: 11,167,057 (GRCm39) C593F possibly damaging Het
Fut9 A G 4: 25,620,359 (GRCm39) F152L probably damaging Het
Galnt2 G A 8: 125,070,085 (GRCm39) G534D probably benign Het
Gm973 C T 1: 59,597,393 (GRCm39) probably benign Het
Golm2 T A 2: 121,697,906 (GRCm39) V74E probably damaging Het
Gprc5a T A 6: 135,055,948 (GRCm39) S132T probably damaging Het
Hk3 G A 13: 55,162,543 (GRCm39) R47C probably damaging Het
Hrnr A T 3: 93,239,815 (GRCm39) Q3351L unknown Het
Icam1 T A 9: 20,930,423 (GRCm39) F92L probably damaging Het
Ifi213 C T 1: 173,417,366 (GRCm39) V349I possibly damaging Het
Il12rb2 T C 6: 67,275,888 (GRCm39) probably benign Het
Irx3 A G 8: 92,526,048 (GRCm39) V487A possibly damaging Het
Kalrn A G 16: 33,855,924 (GRCm39) V204A probably damaging Het
Krt16 T C 11: 100,137,280 (GRCm39) probably benign Het
Loxhd1 G A 18: 77,492,665 (GRCm39) V1369I probably benign Het
Med13 T A 11: 86,210,422 (GRCm39) K573N possibly damaging Het
Mnat1 A G 12: 73,234,962 (GRCm39) R204G possibly damaging Het
Myt1l A T 12: 29,877,732 (GRCm39) D461V unknown Het
Nek6 T A 2: 38,447,858 (GRCm39) S41T probably damaging Het
Nudt22 T C 19: 6,970,874 (GRCm39) E232G probably damaging Het
Numbl C A 7: 26,973,415 (GRCm39) F192L probably damaging Het
Or4c105 C T 2: 88,648,226 (GRCm39) T237I probably benign Het
P2rx4 T C 5: 122,852,467 (GRCm39) V47A probably damaging Het
Phka1 T A X: 101,629,710 (GRCm39) I478F probably damaging Het
Pkn2 G A 3: 142,536,281 (GRCm39) T200I probably damaging Het
Plcg1 T A 2: 160,593,698 (GRCm39) probably null Het
Polg2 C T 11: 106,659,239 (GRCm39) G425R probably damaging Het
Ptprm G T 17: 67,251,327 (GRCm39) probably null Het
Reg1 G A 6: 78,405,101 (GRCm39) R108H possibly damaging Het
Slc19a2 T A 1: 164,084,367 (GRCm39) F86I probably damaging Het
Slc26a11 T C 11: 119,265,603 (GRCm39) L372P probably damaging Het
Slc2a4 C T 11: 69,836,985 (GRCm39) V28M possibly damaging Het
Snap29 A G 16: 17,224,012 (GRCm39) N9S probably damaging Het
Snd1 C G 6: 28,545,469 (GRCm39) probably benign Het
Sorcs3 G A 19: 48,475,845 (GRCm39) A235T probably benign Het
Sp100 T A 1: 85,622,002 (GRCm39) N362K probably damaging Het
Sqor A T 2: 122,641,775 (GRCm39) I32F probably benign Het
Stx6 C T 1: 155,069,040 (GRCm39) R189C probably damaging Het
Tchp T C 5: 114,855,514 (GRCm39) I298T probably damaging Het
Themis A G 10: 28,637,570 (GRCm39) I225V probably benign Het
Timm50 A T 7: 28,006,366 (GRCm39) V245E probably damaging Het
Tnxb A G 17: 34,908,328 (GRCm39) E1327G probably damaging Het
Tpp1 C T 7: 105,398,814 (GRCm39) R205H probably benign Het
Tradd T C 8: 105,987,276 (GRCm39) E10G possibly damaging Het
Trim43a G A 9: 88,464,199 (GRCm39) E37K probably benign Het
Ttn T C 2: 76,729,747 (GRCm39) probably benign Het
Ttr A T 18: 20,803,034 (GRCm39) probably null Het
Ubp1 A G 9: 113,773,999 (GRCm39) Y66C probably damaging Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r104 A T 17: 20,263,166 (GRCm39) N98K probably damaging Het
Yipf5 A G 18: 40,340,825 (GRCm39) S176P probably benign Het
Zpbp2 C T 11: 98,444,763 (GRCm39) T97I probably damaging Het
Other mutations in Or7g12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01804:Or7g12 APN 9 18,900,136 (GRCm39) missense probably benign 0.16
IGL02073:Or7g12 APN 9 18,899,621 (GRCm39) missense possibly damaging 0.89
IGL02119:Or7g12 APN 9 18,899,908 (GRCm39) missense probably benign 0.00
IGL02705:Or7g12 APN 9 18,899,696 (GRCm39) missense probably benign 0.03
R0462:Or7g12 UTSW 9 18,900,198 (GRCm39) missense probably benign
R0466:Or7g12 UTSW 9 18,899,551 (GRCm39) missense probably benign 0.00
R0711:Or7g12 UTSW 9 18,899,447 (GRCm39) missense probably benign 0.04
R1268:Or7g12 UTSW 9 18,899,652 (GRCm39) missense probably damaging 0.98
R1663:Or7g12 UTSW 9 18,900,006 (GRCm39) missense probably damaging 0.99
R1680:Or7g12 UTSW 9 18,899,812 (GRCm39) missense possibly damaging 0.81
R1686:Or7g12 UTSW 9 18,899,839 (GRCm39) missense probably damaging 1.00
R1903:Or7g12 UTSW 9 18,900,192 (GRCm39) nonsense probably null
R1907:Or7g12 UTSW 9 18,899,737 (GRCm39) missense possibly damaging 0.82
R1911:Or7g12 UTSW 9 18,900,196 (GRCm39) missense probably damaging 0.99
R2143:Or7g12 UTSW 9 18,900,099 (GRCm39) missense probably benign 0.06
R2431:Or7g12 UTSW 9 18,899,299 (GRCm39) missense probably damaging 1.00
R4014:Or7g12 UTSW 9 18,900,178 (GRCm39) missense probably benign 0.08
R4515:Or7g12 UTSW 9 18,899,278 (GRCm39) splice site probably null
R4575:Or7g12 UTSW 9 18,900,001 (GRCm39) nonsense probably null
R6974:Or7g12 UTSW 9 18,899,689 (GRCm39) missense probably damaging 0.99
R7394:Or7g12 UTSW 9 18,900,006 (GRCm39) missense probably damaging 0.99
R7455:Or7g12 UTSW 9 18,900,150 (GRCm39) missense possibly damaging 0.92
R7828:Or7g12 UTSW 9 18,900,216 (GRCm39) missense probably benign
R7962:Or7g12 UTSW 9 18,899,952 (GRCm39) missense probably damaging 0.97
R8360:Or7g12 UTSW 9 18,900,139 (GRCm39) missense probably benign 0.28
R8812:Or7g12 UTSW 9 18,899,812 (GRCm39) missense possibly damaging 0.81
R8905:Or7g12 UTSW 9 18,899,494 (GRCm39) missense possibly damaging 0.92
R8973:Or7g12 UTSW 9 18,899,974 (GRCm39) nonsense probably null
R8980:Or7g12 UTSW 9 18,899,423 (GRCm39) missense probably damaging 1.00
R9013:Or7g12 UTSW 9 18,899,874 (GRCm39) missense possibly damaging 0.94
R9058:Or7g12 UTSW 9 18,900,222 (GRCm39) makesense probably null
R9614:Or7g12 UTSW 9 18,899,526 (GRCm39) missense possibly damaging 0.75
R9779:Or7g12 UTSW 9 18,900,135 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAAGAAAGCCCTCTTCATGCTATTCCC -3'
(R):5'- TGATGACTGTGTACCTCAGTGGATGAC -3'

Sequencing Primer
(F):5'- TCCCCTAATTTTCTTTCTTAGCATC -3'
(R):5'- TGTCATAGGCCATCATTACCAG -3'
Posted On 2013-07-30