Incidental Mutation 'R0709:Ace'
ID 62670
Institutional Source Beutler Lab
Gene Symbol Ace
Ensembl Gene ENSMUSG00000020681
Gene Name angiotensin I converting enzyme
Synonyms CD143
MMRRC Submission 038892-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0709 (G1)
Quality Score 155
Status Validated
Chromosome 11
Chromosomal Location 105858774-105880790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 105872364 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 319 (L319F)
Ref Sequence ENSEMBL: ENSMUSP00000001964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001963] [ENSMUST00000001964]
AlphaFold P09470
Predicted Effect possibly damaging
Transcript: ENSMUST00000001963
AA Change: L899F

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001963
Gene: ENSMUSG00000020681
AA Change: L899F

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Peptidase_M2 45 628 7.1e-257 PFAM
Pfam:Peptidase_M2 648 1226 8.9e-261 PFAM
transmembrane domain 1264 1286 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000001964
AA Change: L319F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001964
Gene: ENSMUSG00000020681
AA Change: L319F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Peptidase_M2 59 653 N/A PFAM
transmembrane domain 684 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130673
Predicted Effect unknown
Transcript: ENSMUST00000132280
AA Change: L665F
SMART Domains Protein: ENSMUSP00000119826
Gene: ENSMUSG00000020681
AA Change: L665F

DomainStartEndE-ValueType
Pfam:Peptidase_M2 1 395 2.4e-201 PFAM
Pfam:Peptidase_M2 415 993 1.4e-261 PFAM
low complexity region 999 1014 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152925
Meta Mutation Damage Score 0.5810 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in catalyzing the conversion of angiotensin I into a physiologically active peptide angiotensin II. Angiotensin II is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This enzyme plays a key role in the renin-angiotensin system. Many studies have associated the presence or absence of a 287 bp Alu repeat element in this gene with the levels of circulating enzyme or cardiovascular pathophysiologies. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, and two most abundant spliced variants encode the somatic form and the testicular form, respectively, that are equally active. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable phenotypes, including reduced systemic blood pressure, normocytic anemia, renal abnormalities, inability to concentrate urine, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,436,358 (GRCm39) D137V probably damaging Het
Aar2 C T 2: 156,408,930 (GRCm39) P378L probably damaging Het
Abcc5 A T 16: 20,195,342 (GRCm39) H718Q possibly damaging Het
Angpt4 C A 2: 151,776,434 (GRCm39) P321T possibly damaging Het
Atrip T C 9: 108,896,171 (GRCm39) N282S probably benign Het
AW554918 A C 18: 25,596,711 (GRCm39) S525R probably damaging Het
Ccdc136 T A 6: 29,414,969 (GRCm39) I644N possibly damaging Het
Ccdc178 A G 18: 22,200,719 (GRCm39) Y413H probably damaging Het
Ccdc7b A G 8: 129,863,127 (GRCm39) H223R probably benign Het
Cd109 T C 9: 78,579,260 (GRCm39) V634A possibly damaging Het
Col7a1 T A 9: 108,790,616 (GRCm39) probably benign Het
Copb2 A T 9: 98,445,220 (GRCm39) probably benign Het
Csrnp3 C T 2: 65,852,907 (GRCm39) S445L probably damaging Het
Cxcl13 G T 5: 96,106,530 (GRCm39) C34F probably damaging Het
Dars2 T C 1: 160,874,498 (GRCm39) E397G probably benign Het
Dlg5 C T 14: 24,196,323 (GRCm39) V1625M probably damaging Het
Dnah12 T G 14: 26,606,222 (GRCm39) probably benign Het
Eif4a1 C A 11: 69,561,078 (GRCm39) A76S probably damaging Het
Fam162b T A 10: 51,463,347 (GRCm39) I107L probably damaging Het
Fbxo30 G T 10: 11,167,057 (GRCm39) C593F possibly damaging Het
Fut9 A G 4: 25,620,359 (GRCm39) F152L probably damaging Het
Galnt2 G A 8: 125,070,085 (GRCm39) G534D probably benign Het
Gm973 C T 1: 59,597,393 (GRCm39) probably benign Het
Golm2 T A 2: 121,697,906 (GRCm39) V74E probably damaging Het
Gprc5a T A 6: 135,055,948 (GRCm39) S132T probably damaging Het
Hk3 G A 13: 55,162,543 (GRCm39) R47C probably damaging Het
Hrnr A T 3: 93,239,815 (GRCm39) Q3351L unknown Het
Icam1 T A 9: 20,930,423 (GRCm39) F92L probably damaging Het
Ifi213 C T 1: 173,417,366 (GRCm39) V349I possibly damaging Het
Il12rb2 T C 6: 67,275,888 (GRCm39) probably benign Het
Irx3 A G 8: 92,526,048 (GRCm39) V487A possibly damaging Het
Kalrn A G 16: 33,855,924 (GRCm39) V204A probably damaging Het
Krt16 T C 11: 100,137,280 (GRCm39) probably benign Het
Loxhd1 G A 18: 77,492,665 (GRCm39) V1369I probably benign Het
Med13 T A 11: 86,210,422 (GRCm39) K573N possibly damaging Het
Mnat1 A G 12: 73,234,962 (GRCm39) R204G possibly damaging Het
Myt1l A T 12: 29,877,732 (GRCm39) D461V unknown Het
Nek6 T A 2: 38,447,858 (GRCm39) S41T probably damaging Het
Nudt22 T C 19: 6,970,874 (GRCm39) E232G probably damaging Het
Numbl C A 7: 26,973,415 (GRCm39) F192L probably damaging Het
Or4c105 C T 2: 88,648,226 (GRCm39) T237I probably benign Het
Or7g12 T A 9: 18,899,422 (GRCm39) I46K probably damaging Het
P2rx4 T C 5: 122,852,467 (GRCm39) V47A probably damaging Het
Phka1 T A X: 101,629,710 (GRCm39) I478F probably damaging Het
Pkn2 G A 3: 142,536,281 (GRCm39) T200I probably damaging Het
Plcg1 T A 2: 160,593,698 (GRCm39) probably null Het
Polg2 C T 11: 106,659,239 (GRCm39) G425R probably damaging Het
Ptprm G T 17: 67,251,327 (GRCm39) probably null Het
Reg1 G A 6: 78,405,101 (GRCm39) R108H possibly damaging Het
Slc19a2 T A 1: 164,084,367 (GRCm39) F86I probably damaging Het
Slc26a11 T C 11: 119,265,603 (GRCm39) L372P probably damaging Het
Slc2a4 C T 11: 69,836,985 (GRCm39) V28M possibly damaging Het
Snap29 A G 16: 17,224,012 (GRCm39) N9S probably damaging Het
Snd1 C G 6: 28,545,469 (GRCm39) probably benign Het
Sorcs3 G A 19: 48,475,845 (GRCm39) A235T probably benign Het
Sp100 T A 1: 85,622,002 (GRCm39) N362K probably damaging Het
Sqor A T 2: 122,641,775 (GRCm39) I32F probably benign Het
Stx6 C T 1: 155,069,040 (GRCm39) R189C probably damaging Het
Tchp T C 5: 114,855,514 (GRCm39) I298T probably damaging Het
Themis A G 10: 28,637,570 (GRCm39) I225V probably benign Het
Timm50 A T 7: 28,006,366 (GRCm39) V245E probably damaging Het
Tnxb A G 17: 34,908,328 (GRCm39) E1327G probably damaging Het
Tpp1 C T 7: 105,398,814 (GRCm39) R205H probably benign Het
Tradd T C 8: 105,987,276 (GRCm39) E10G possibly damaging Het
Trim43a G A 9: 88,464,199 (GRCm39) E37K probably benign Het
Ttn T C 2: 76,729,747 (GRCm39) probably benign Het
Ttr A T 18: 20,803,034 (GRCm39) probably null Het
Ubp1 A G 9: 113,773,999 (GRCm39) Y66C probably damaging Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r104 A T 17: 20,263,166 (GRCm39) N98K probably damaging Het
Yipf5 A G 18: 40,340,825 (GRCm39) S176P probably benign Het
Zpbp2 C T 11: 98,444,763 (GRCm39) T97I probably damaging Het
Other mutations in Ace
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ace APN 11 105,870,376 (GRCm39) missense probably benign 0.21
IGL01105:Ace APN 11 105,862,885 (GRCm39) missense probably damaging 1.00
IGL01761:Ace APN 11 105,870,319 (GRCm39) missense possibly damaging 0.70
IGL01888:Ace APN 11 105,859,770 (GRCm39) missense probably benign
IGL02173:Ace APN 11 105,879,817 (GRCm39) missense probably benign 0.04
IGL02179:Ace APN 11 105,860,615 (GRCm39) missense probably benign 0.16
IGL02331:Ace APN 11 105,862,170 (GRCm39) missense possibly damaging 0.61
IGL02333:Ace APN 11 105,862,273 (GRCm39) missense probably benign
IGL02556:Ace APN 11 105,863,353 (GRCm39) missense probably damaging 1.00
IGL02576:Ace APN 11 105,864,937 (GRCm39) missense probably damaging 1.00
IGL03202:Ace APN 11 105,867,788 (GRCm39) missense probably damaging 1.00
R0403:Ace UTSW 11 105,864,706 (GRCm39) splice site probably null
R1555:Ace UTSW 11 105,865,727 (GRCm39) splice site probably null
R1603:Ace UTSW 11 105,862,925 (GRCm39) missense probably benign 0.23
R1644:Ace UTSW 11 105,875,932 (GRCm39) missense probably damaging 1.00
R1834:Ace UTSW 11 105,876,920 (GRCm39) splice site probably benign
R2074:Ace UTSW 11 105,867,449 (GRCm39) nonsense probably null
R3025:Ace UTSW 11 105,864,919 (GRCm39) splice site probably null
R3176:Ace UTSW 11 105,867,528 (GRCm39) missense probably null 1.00
R3276:Ace UTSW 11 105,867,528 (GRCm39) missense probably null 1.00
R3977:Ace UTSW 11 105,872,664 (GRCm39) missense possibly damaging 0.96
R4506:Ace UTSW 11 105,867,492 (GRCm39) missense probably damaging 0.98
R4598:Ace UTSW 11 105,872,585 (GRCm39) splice site probably null
R4914:Ace UTSW 11 105,870,423 (GRCm39) missense probably damaging 1.00
R4968:Ace UTSW 11 105,872,679 (GRCm39) missense possibly damaging 0.93
R5137:Ace UTSW 11 105,865,652 (GRCm39) missense probably damaging 1.00
R5274:Ace UTSW 11 105,858,863 (GRCm39) missense probably benign
R5332:Ace UTSW 11 105,864,705 (GRCm39) critical splice donor site probably null
R5388:Ace UTSW 11 105,879,284 (GRCm39) missense possibly damaging 0.85
R5425:Ace UTSW 11 105,864,254 (GRCm39) missense probably damaging 1.00
R5640:Ace UTSW 11 105,861,511 (GRCm39) missense probably damaging 1.00
R5838:Ace UTSW 11 105,863,706 (GRCm39) missense probably benign 0.00
R6041:Ace UTSW 11 105,866,134 (GRCm39) missense probably benign 0.27
R6083:Ace UTSW 11 105,876,093 (GRCm39) nonsense probably null
R6106:Ace UTSW 11 105,879,838 (GRCm39) missense probably damaging 1.00
R6225:Ace UTSW 11 105,870,445 (GRCm39) missense possibly damaging 0.51
R6607:Ace UTSW 11 105,863,203 (GRCm39) missense possibly damaging 0.82
R6918:Ace UTSW 11 105,863,769 (GRCm39) missense probably damaging 1.00
R7330:Ace UTSW 11 105,876,887 (GRCm39) missense probably damaging 1.00
R7471:Ace UTSW 11 105,864,308 (GRCm39) missense probably damaging 1.00
R7709:Ace UTSW 11 105,879,663 (GRCm39) missense probably benign 0.01
R7800:Ace UTSW 11 105,876,884 (GRCm39) missense probably damaging 1.00
R7855:Ace UTSW 11 105,863,205 (GRCm39) missense probably benign 0.05
R7947:Ace UTSW 11 105,863,880 (GRCm39) missense possibly damaging 0.81
R8063:Ace UTSW 11 105,862,190 (GRCm39) missense possibly damaging 0.90
R8072:Ace UTSW 11 105,863,785 (GRCm39) missense probably damaging 0.98
R8412:Ace UTSW 11 105,870,092 (GRCm39) missense probably benign
R8544:Ace UTSW 11 105,862,116 (GRCm39) critical splice acceptor site probably null
R8695:Ace UTSW 11 105,875,971 (GRCm39) missense probably benign 0.00
R8731:Ace UTSW 11 105,861,426 (GRCm39) missense possibly damaging 0.93
R8855:Ace UTSW 11 105,861,424 (GRCm39) nonsense probably null
R9087:Ace UTSW 11 105,872,745 (GRCm39) missense probably damaging 1.00
R9149:Ace UTSW 11 105,863,299 (GRCm39) missense possibly damaging 0.57
R9347:Ace UTSW 11 105,864,958 (GRCm39) missense probably damaging 1.00
R9590:Ace UTSW 11 105,876,506 (GRCm39) missense probably benign 0.01
X0018:Ace UTSW 11 105,862,210 (GRCm39) missense probably damaging 1.00
X0063:Ace UTSW 11 105,866,464 (GRCm39) missense probably benign 0.07
Z1177:Ace UTSW 11 105,878,960 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGAGACATGCACATCAAATACC -3'
(R):5'- TCCTTGCCGTTGTAGAAGTCCCAG -3'

Sequencing Primer
(F):5'- ATACCCAGCACCGTTTGC -3'
(R):5'- ACTTGTTCCAGAACTCAGGG -3'
Posted On 2013-07-30