Incidental Mutation 'R0709:Hk3'
ID 62674
Institutional Source Beutler Lab
Gene Symbol Hk3
Ensembl Gene ENSMUSG00000025877
Gene Name hexokinase 3
Synonyms
MMRRC Submission 038892-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R0709 (G1)
Quality Score 105
Status Validated
Chromosome 13
Chromosomal Location 55153798-55169198 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 55162543 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 47 (R47C)
Ref Sequence ENSEMBL: ENSMUSP00000115227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052949] [ENSMUST00000123097] [ENSMUST00000126234] [ENSMUST00000132309] [ENSMUST00000148221] [ENSMUST00000153665]
AlphaFold Q3TRM8
Predicted Effect probably damaging
Transcript: ENSMUST00000052949
AA Change: R102C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051215
Gene: ENSMUSG00000025877
AA Change: R102C

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.7e-76 PFAM
Pfam:Hexokinase_2 234 473 1.9e-87 PFAM
Pfam:Hexokinase_1 475 674 2.2e-77 PFAM
Pfam:Hexokinase_2 676 915 2.3e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123097
AA Change: R102C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116717
Gene: ENSMUSG00000025877
AA Change: R102C

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.3e-77 PFAM
Pfam:Hexokinase_2 234 457 6e-74 PFAM
Pfam:Hexokinase_1 430 629 3e-78 PFAM
Pfam:Hexokinase_2 631 870 1e-104 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126234
AA Change: R102C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123233
Gene: ENSMUSG00000025877
AA Change: R102C

DomainStartEndE-ValueType
Pfam:Hexokinase_1 31 230 2.4e-63 PFAM
Pfam:Hexokinase_2 236 470 2.9e-62 PFAM
Pfam:Hexokinase_1 480 673 2e-69 PFAM
Pfam:Hexokinase_2 678 912 1.5e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132309
AA Change: R102C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117254
Gene: ENSMUSG00000025877
AA Change: R102C

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 164 4.1e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135983
Predicted Effect probably benign
Transcript: ENSMUST00000148221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149644
Predicted Effect probably damaging
Transcript: ENSMUST00000153665
AA Change: R47C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115227
Gene: ENSMUSG00000025877
AA Change: R47C

DomainStartEndE-ValueType
Pfam:Hexokinase_1 1 177 8.5e-70 PFAM
Pfam:Hexokinase_2 179 418 9.4e-88 PFAM
Pfam:Hexokinase_1 420 619 1.2e-77 PFAM
Pfam:Hexokinase_2 621 860 1.1e-103 PFAM
Meta Mutation Damage Score 0.8039 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 3. Similar to hexokinases 1 and 2, this allosteric enzyme is inhibited by its product glucose-6-phosphate. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,436,358 (GRCm39) D137V probably damaging Het
Aar2 C T 2: 156,408,930 (GRCm39) P378L probably damaging Het
Abcc5 A T 16: 20,195,342 (GRCm39) H718Q possibly damaging Het
Ace G T 11: 105,872,364 (GRCm39) L319F probably damaging Het
Angpt4 C A 2: 151,776,434 (GRCm39) P321T possibly damaging Het
Atrip T C 9: 108,896,171 (GRCm39) N282S probably benign Het
AW554918 A C 18: 25,596,711 (GRCm39) S525R probably damaging Het
Ccdc136 T A 6: 29,414,969 (GRCm39) I644N possibly damaging Het
Ccdc178 A G 18: 22,200,719 (GRCm39) Y413H probably damaging Het
Ccdc7b A G 8: 129,863,127 (GRCm39) H223R probably benign Het
Cd109 T C 9: 78,579,260 (GRCm39) V634A possibly damaging Het
Col7a1 T A 9: 108,790,616 (GRCm39) probably benign Het
Copb2 A T 9: 98,445,220 (GRCm39) probably benign Het
Csrnp3 C T 2: 65,852,907 (GRCm39) S445L probably damaging Het
Cxcl13 G T 5: 96,106,530 (GRCm39) C34F probably damaging Het
Dars2 T C 1: 160,874,498 (GRCm39) E397G probably benign Het
Dlg5 C T 14: 24,196,323 (GRCm39) V1625M probably damaging Het
Dnah12 T G 14: 26,606,222 (GRCm39) probably benign Het
Eif4a1 C A 11: 69,561,078 (GRCm39) A76S probably damaging Het
Fam162b T A 10: 51,463,347 (GRCm39) I107L probably damaging Het
Fbxo30 G T 10: 11,167,057 (GRCm39) C593F possibly damaging Het
Fut9 A G 4: 25,620,359 (GRCm39) F152L probably damaging Het
Galnt2 G A 8: 125,070,085 (GRCm39) G534D probably benign Het
Gm973 C T 1: 59,597,393 (GRCm39) probably benign Het
Golm2 T A 2: 121,697,906 (GRCm39) V74E probably damaging Het
Gprc5a T A 6: 135,055,948 (GRCm39) S132T probably damaging Het
Hrnr A T 3: 93,239,815 (GRCm39) Q3351L unknown Het
Icam1 T A 9: 20,930,423 (GRCm39) F92L probably damaging Het
Ifi213 C T 1: 173,417,366 (GRCm39) V349I possibly damaging Het
Il12rb2 T C 6: 67,275,888 (GRCm39) probably benign Het
Irx3 A G 8: 92,526,048 (GRCm39) V487A possibly damaging Het
Kalrn A G 16: 33,855,924 (GRCm39) V204A probably damaging Het
Krt16 T C 11: 100,137,280 (GRCm39) probably benign Het
Loxhd1 G A 18: 77,492,665 (GRCm39) V1369I probably benign Het
Med13 T A 11: 86,210,422 (GRCm39) K573N possibly damaging Het
Mnat1 A G 12: 73,234,962 (GRCm39) R204G possibly damaging Het
Myt1l A T 12: 29,877,732 (GRCm39) D461V unknown Het
Nek6 T A 2: 38,447,858 (GRCm39) S41T probably damaging Het
Nudt22 T C 19: 6,970,874 (GRCm39) E232G probably damaging Het
Numbl C A 7: 26,973,415 (GRCm39) F192L probably damaging Het
Or4c105 C T 2: 88,648,226 (GRCm39) T237I probably benign Het
Or7g12 T A 9: 18,899,422 (GRCm39) I46K probably damaging Het
P2rx4 T C 5: 122,852,467 (GRCm39) V47A probably damaging Het
Phka1 T A X: 101,629,710 (GRCm39) I478F probably damaging Het
Pkn2 G A 3: 142,536,281 (GRCm39) T200I probably damaging Het
Plcg1 T A 2: 160,593,698 (GRCm39) probably null Het
Polg2 C T 11: 106,659,239 (GRCm39) G425R probably damaging Het
Ptprm G T 17: 67,251,327 (GRCm39) probably null Het
Reg1 G A 6: 78,405,101 (GRCm39) R108H possibly damaging Het
Slc19a2 T A 1: 164,084,367 (GRCm39) F86I probably damaging Het
Slc26a11 T C 11: 119,265,603 (GRCm39) L372P probably damaging Het
Slc2a4 C T 11: 69,836,985 (GRCm39) V28M possibly damaging Het
Snap29 A G 16: 17,224,012 (GRCm39) N9S probably damaging Het
Snd1 C G 6: 28,545,469 (GRCm39) probably benign Het
Sorcs3 G A 19: 48,475,845 (GRCm39) A235T probably benign Het
Sp100 T A 1: 85,622,002 (GRCm39) N362K probably damaging Het
Sqor A T 2: 122,641,775 (GRCm39) I32F probably benign Het
Stx6 C T 1: 155,069,040 (GRCm39) R189C probably damaging Het
Tchp T C 5: 114,855,514 (GRCm39) I298T probably damaging Het
Themis A G 10: 28,637,570 (GRCm39) I225V probably benign Het
Timm50 A T 7: 28,006,366 (GRCm39) V245E probably damaging Het
Tnxb A G 17: 34,908,328 (GRCm39) E1327G probably damaging Het
Tpp1 C T 7: 105,398,814 (GRCm39) R205H probably benign Het
Tradd T C 8: 105,987,276 (GRCm39) E10G possibly damaging Het
Trim43a G A 9: 88,464,199 (GRCm39) E37K probably benign Het
Ttn T C 2: 76,729,747 (GRCm39) probably benign Het
Ttr A T 18: 20,803,034 (GRCm39) probably null Het
Ubp1 A G 9: 113,773,999 (GRCm39) Y66C probably damaging Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r104 A T 17: 20,263,166 (GRCm39) N98K probably damaging Het
Yipf5 A G 18: 40,340,825 (GRCm39) S176P probably benign Het
Zpbp2 C T 11: 98,444,763 (GRCm39) T97I probably damaging Het
Other mutations in Hk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Hk3 APN 13 55,162,239 (GRCm39) critical splice donor site probably null
IGL01314:Hk3 APN 13 55,154,876 (GRCm39) splice site probably benign
IGL02043:Hk3 APN 13 55,162,908 (GRCm39) missense probably damaging 1.00
IGL02197:Hk3 APN 13 55,162,281 (GRCm39) missense probably damaging 1.00
IGL02619:Hk3 APN 13 55,162,107 (GRCm39) missense probably damaging 1.00
R0454:Hk3 UTSW 13 55,156,518 (GRCm39) missense probably damaging 1.00
R0518:Hk3 UTSW 13 55,162,239 (GRCm39) critical splice donor site probably null
R0521:Hk3 UTSW 13 55,162,239 (GRCm39) critical splice donor site probably null
R1386:Hk3 UTSW 13 55,154,843 (GRCm39) splice site probably null
R1567:Hk3 UTSW 13 55,154,418 (GRCm39) missense probably damaging 1.00
R1647:Hk3 UTSW 13 55,162,274 (GRCm39) missense probably damaging 1.00
R1648:Hk3 UTSW 13 55,162,274 (GRCm39) missense probably damaging 1.00
R1663:Hk3 UTSW 13 55,154,388 (GRCm39) missense probably benign 0.00
R1936:Hk3 UTSW 13 55,159,204 (GRCm39) missense probably damaging 0.98
R1940:Hk3 UTSW 13 55,159,204 (GRCm39) missense probably damaging 0.98
R1966:Hk3 UTSW 13 55,162,268 (GRCm39) missense probably damaging 1.00
R2345:Hk3 UTSW 13 55,156,806 (GRCm39) missense probably damaging 1.00
R4838:Hk3 UTSW 13 55,154,231 (GRCm39) missense probably damaging 1.00
R4852:Hk3 UTSW 13 55,160,409 (GRCm39) missense probably damaging 0.99
R4883:Hk3 UTSW 13 55,158,735 (GRCm39) missense probably benign 0.04
R4888:Hk3 UTSW 13 55,154,405 (GRCm39) missense probably damaging 1.00
R5100:Hk3 UTSW 13 55,156,843 (GRCm39) missense probably damaging 1.00
R5253:Hk3 UTSW 13 55,158,824 (GRCm39) missense probably damaging 1.00
R5328:Hk3 UTSW 13 55,161,306 (GRCm39) missense probably benign 0.00
R5441:Hk3 UTSW 13 55,162,869 (GRCm39) missense probably damaging 1.00
R5493:Hk3 UTSW 13 55,158,984 (GRCm39) missense probably damaging 1.00
R5557:Hk3 UTSW 13 55,159,888 (GRCm39) nonsense probably null
R5575:Hk3 UTSW 13 55,162,583 (GRCm39) missense probably damaging 0.99
R5578:Hk3 UTSW 13 55,159,994 (GRCm39) missense probably damaging 1.00
R5686:Hk3 UTSW 13 55,154,626 (GRCm39) missense probably damaging 1.00
R5872:Hk3 UTSW 13 55,158,617 (GRCm39) missense probably damaging 1.00
R6038:Hk3 UTSW 13 55,154,373 (GRCm39) missense probably benign 0.13
R6038:Hk3 UTSW 13 55,154,373 (GRCm39) missense probably benign 0.13
R6314:Hk3 UTSW 13 55,161,393 (GRCm39) missense probably benign 0.02
R6315:Hk3 UTSW 13 55,158,970 (GRCm39) missense probably benign 0.03
R6797:Hk3 UTSW 13 55,158,644 (GRCm39) splice site probably null
R6827:Hk3 UTSW 13 55,159,165 (GRCm39) missense probably damaging 0.98
R6860:Hk3 UTSW 13 55,162,278 (GRCm39) missense probably damaging 0.98
R7082:Hk3 UTSW 13 55,154,710 (GRCm39) missense probably benign 0.40
R7227:Hk3 UTSW 13 55,160,053 (GRCm39) missense probably benign 0.00
R7564:Hk3 UTSW 13 55,159,209 (GRCm39) missense probably damaging 1.00
R8274:Hk3 UTSW 13 55,159,230 (GRCm39) missense possibly damaging 0.95
R9704:Hk3 UTSW 13 55,160,253 (GRCm39) critical splice donor site probably null
X0003:Hk3 UTSW 13 55,154,949 (GRCm39) missense probably benign 0.01
Z1177:Hk3 UTSW 13 55,158,523 (GRCm39) missense probably damaging 0.96
Z1177:Hk3 UTSW 13 55,158,521 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGTAGCTTTCCGCTCACTGACC -3'
(R):5'- ACCATCTCTGAGGCCCTTTTCAATG -3'

Sequencing Primer
(F):5'- CAAGCCTGTCTGGTGACAAG -3'
(R):5'- CAATGGCCCTCTCAGACTC -3'
Posted On 2013-07-30