Mutagenetix > Incidental Mutation

Incidental Mutation 'R0709:Snap29'

62677

Institutional Source

Beutler Lab

Gene Symbol

Snap29

Ensembl Gene

ENSMUSG00000022765

Gene Name

synaptosomal-associated protein 29

Synonyms

1300018G05Rik

MMRRC Submission

038892-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0709 (G1)

Quality Score

192

Status

Validated

Chromosome

Chromosomal Location

17405986-17430827 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17406148 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 9 (N9S)

Ref Sequence

ENSEMBL: ENSMUSP00000023449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023449] [ENSMUST00000036161] [ENSMUST00000232232]

AlphaFold

Q9ERB0

Predicted Effect

probably damaging
Transcript: ENSMUST00000023449
AA Change: N9S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000023449
Gene: ENSMUSG00000022765
AA Change: N9S

Domain	Start	End	E-Value	Type
t_SNARE	45	112	1.53e-6	SMART
t_SNARE	193	260	1.39e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000036161

SMART Domains

Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720

Domain	Start	End	E-Value	Type
low complexity region	198	221	N/A	INTRINSIC
low complexity region	243	253	N/A	INTRINSIC
SCOP:d1gw5a_	268	675	2e-3	SMART
low complexity region	895	907	N/A	INTRINSIC
PI3Ka	1483	1671	2.11e-54	SMART
Blast:PI3Kc	1688	1762	2e-39	BLAST
PI3Kc	1788	2041	4.04e-106	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128938

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231419

Predicted Effect

probably benign
Transcript: ENSMUST00000232232

Meta Mutation Damage Score

0.1844

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.8%

Validation Efficiency

98% (83/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the SNAP25 gene family, encodes a protein involved in multiple membrane trafficking steps. Two other members of this gene family, SNAP23 and SNAP25, encode proteins that bind a syntaxin protein and mediate synaptic vesicle membrane docking and fusion to the plasma membrane. The protein encoded by this gene binds tightly to multiple syntaxins and is localized to intracellular membrane structures rather than to the plasma membrane. While the protein is mostly membrane-bound, a significant fraction of it is found free in the cytoplasm. Use of multiple polyadenylation sites has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slightly reduced birth body size and a congenital ichtyotic phenotype associated with scaly and tight skin, hyperkeratosis, acanthosis, abnormalities in epidermal differentiation and autophagy, and increased endoplasmic reticulum stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	A	T	16: 14,618,494	D137V	probably damaging	Het
Aar2	C	T	2: 156,567,010	P378L	probably damaging	Het
Abcc5	A	T	16: 20,376,592	H718Q	possibly damaging	Het
Ace	G	T	11: 105,981,538	L319F	probably damaging	Het
Angpt4	C	A	2: 151,934,514	P321T	possibly damaging	Het
Atrip	T	C	9: 109,067,103	N282S	probably benign	Het
AW554918	A	C	18: 25,463,654	S525R	probably damaging	Het
Casc4	T	A	2: 121,867,425	V74E	probably damaging	Het
Ccdc136	T	A	6: 29,414,970	I644N	possibly damaging	Het
Ccdc178	A	G	18: 22,067,662	Y413H	probably damaging	Het
Ccdc7b	A	G	8: 129,136,646	H223R	probably benign	Het
Cd109	T	C	9: 78,671,978	V634A	possibly damaging	Het
Col7a1	T	A	9: 108,961,548		probably benign	Het
Copb2	A	T	9: 98,563,167		probably benign	Het
Csrnp3	C	T	2: 66,022,563	S445L	probably damaging	Het
Cxcl13	G	T	5: 95,958,671	C34F	probably damaging	Het
Dars2	T	C	1: 161,046,928	E397G	probably benign	Het
Dlg5	C	T	14: 24,146,255	V1625M	probably damaging	Het
Dnah12	T	G	14: 26,884,265		probably benign	Het
Eif4a1	C	A	11: 69,670,252	A76S	probably damaging	Het
Fam162b	T	A	10: 51,587,251	I107L	probably damaging	Het
Fbxo30	G	T	10: 11,291,313	C593F	possibly damaging	Het
Fut9	A	G	4: 25,620,359	F152L	probably damaging	Het
Galnt2	G	A	8: 124,343,346	G534D	probably benign	Het
Gm973	C	T	1: 59,558,234		probably benign	Het
Gprc5a	T	A	6: 135,078,950	S132T	probably damaging	Het
Hk3	G	A	13: 55,014,730	R47C	probably damaging	Het
Hrnr	A	T	3: 93,332,508	Q3351L	unknown	Het
Icam1	T	A	9: 21,019,127	F92L	probably damaging	Het
Ifi213	C	T	1: 173,589,800	V349I	possibly damaging	Het
Il12rb2	T	C	6: 67,298,904		probably benign	Het
Irx3	A	G	8: 91,799,420	V487A	possibly damaging	Het
Kalrn	A	G	16: 34,035,554	V204A	probably damaging	Het
Krt16	T	C	11: 100,246,454		probably benign	Het
Loxhd1	G	A	18: 77,404,969	V1369I	probably benign	Het
Med13	T	A	11: 86,319,596	K573N	possibly damaging	Het
Mnat1	A	G	12: 73,188,188	R204G	possibly damaging	Het
Myt1l	A	T	12: 29,827,733	D461V	unknown	Het
Nek6	T	A	2: 38,557,846	S41T	probably damaging	Het
Nudt22	T	C	19: 6,993,506	E232G	probably damaging	Het
Numbl	C	A	7: 27,273,990	F192L	probably damaging	Het
Olfr1202	C	T	2: 88,817,882	T237I	probably benign	Het
Olfr834	T	A	9: 18,988,126	I46K	probably damaging	Het
P2rx4	T	C	5: 122,714,404	V47A	probably damaging	Het
Phka1	T	A	X: 102,586,104	I478F	probably damaging	Het
Pkn2	G	A	3: 142,830,520	T200I	probably damaging	Het
Plcg1	T	A	2: 160,751,778		probably null	Het
Polg2	C	T	11: 106,768,413	G425R	probably damaging	Het
Ptprm	G	T	17: 66,944,332		probably null	Het
Reg1	G	A	6: 78,428,118	R108H	possibly damaging	Het
Slc19a2	T	A	1: 164,256,798	F86I	probably damaging	Het
Slc26a11	T	C	11: 119,374,777	L372P	probably damaging	Het
Slc2a4	C	T	11: 69,946,159	V28M	possibly damaging	Het
Snd1	C	G	6: 28,545,470		probably benign	Het
Sorcs3	G	A	19: 48,487,406	A235T	probably benign	Het
Sp100	T	A	1: 85,694,281	N362K	probably damaging	Het
Sqor	A	T	2: 122,799,855	I32F	probably benign	Het
Stx6	C	T	1: 155,193,294	R189C	probably damaging	Het
Tchp	T	C	5: 114,717,453	I298T	probably damaging	Het
Themis	A	G	10: 28,761,574	I225V	probably benign	Het
Timm50	A	T	7: 28,306,941	V245E	probably damaging	Het
Tnxb	A	G	17: 34,689,354	E1327G	probably damaging	Het
Tpp1	C	T	7: 105,749,607	R205H	probably benign	Het
Tradd	T	C	8: 105,260,644	E10G	possibly damaging	Het
Trim43a	G	A	9: 88,582,146	E37K	probably benign	Het
Ttn	T	C	2: 76,899,403		probably benign	Het
Ttr	A	T	18: 20,669,977		probably null	Het
Ubp1	A	G	9: 113,944,931	Y66C	probably damaging	Het
Vmn2r102	A	T	17: 19,677,619	M299L	probably benign	Het
Vmn2r104	A	T	17: 20,042,904	N98K	probably damaging	Het
Yipf5	A	G	18: 40,207,772	S176P	probably benign	Het
Zpbp2	C	T	11: 98,553,937	T97I	probably damaging	Het

Other mutations in Snap29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03231:Snap29	APN	16	17427100	missense	probably benign	0.06
IGL02799:Snap29	UTSW	16	17422503	missense	probably benign
R0086:Snap29	UTSW	16	17428236	missense	probably damaging	0.96
R0371:Snap29	UTSW	16	17406203	missense	probably benign	0.02
R0616:Snap29	UTSW	16	17422506	nonsense	probably null
R2002:Snap29	UTSW	16	17406326	nonsense	probably null
R2137:Snap29	UTSW	16	17428249	missense	possibly damaging	0.60
R4478:Snap29	UTSW	16	17428155	missense	probably benign	0.00
R4976:Snap29	UTSW	16	17419268	missense	probably damaging	1.00
R5933:Snap29	UTSW	16	17406330	missense	probably damaging	1.00
R6314:Snap29	UTSW	16	17419319	missense	probably benign	0.25
R6824:Snap29	UTSW	16	17422506	missense	probably benign	0.01
R7397:Snap29	UTSW	16	17419372	missense	probably damaging	1.00
R9088:Snap29	UTSW	16	17428194	missense	probably damaging	1.00
R9180:Snap29	UTSW	16	17406299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGTTACCTTCTCCAAGGATGCTG -3'
(R):5'- CATACATGAGAGACAAGGACCTGCTG -3'

Sequencing Primer
(F):5'- AGAGCTGGACCCCGAgc -3'
(R):5'- GGTACTGGCAGCGGTAG -3'

Posted On

2013-07-30