Incidental Mutation 'R0709:Snap29'
ID62677
Institutional Source Beutler Lab
Gene Symbol Snap29
Ensembl Gene ENSMUSG00000022765
Gene Namesynaptosomal-associated protein 29
Synonyms1300018G05Rik
MMRRC Submission 038892-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0709 (G1)
Quality Score192
Status Validated
Chromosome16
Chromosomal Location17405986-17430827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17406148 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 9 (N9S)
Ref Sequence ENSEMBL: ENSMUSP00000023449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023449] [ENSMUST00000036161] [ENSMUST00000232232]
Predicted Effect probably damaging
Transcript: ENSMUST00000023449
AA Change: N9S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023449
Gene: ENSMUSG00000022765
AA Change: N9S

DomainStartEndE-ValueType
t_SNARE 45 112 1.53e-6 SMART
t_SNARE 193 260 1.39e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036161
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231419
Predicted Effect probably benign
Transcript: ENSMUST00000232232
Meta Mutation Damage Score 0.1844 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the SNAP25 gene family, encodes a protein involved in multiple membrane trafficking steps. Two other members of this gene family, SNAP23 and SNAP25, encode proteins that bind a syntaxin protein and mediate synaptic vesicle membrane docking and fusion to the plasma membrane. The protein encoded by this gene binds tightly to multiple syntaxins and is localized to intracellular membrane structures rather than to the plasma membrane. While the protein is mostly membrane-bound, a significant fraction of it is found free in the cytoplasm. Use of multiple polyadenylation sites has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slightly reduced birth body size and a congenital ichtyotic phenotype associated with scaly and tight skin, hyperkeratosis, acanthosis, abnormalities in epidermal differentiation and autophagy, and increased endoplasmic reticulum stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,494 D137V probably damaging Het
Aar2 C T 2: 156,567,010 P378L probably damaging Het
Abcc5 A T 16: 20,376,592 H718Q possibly damaging Het
Ace G T 11: 105,981,538 L319F probably damaging Het
Angpt4 C A 2: 151,934,514 P321T possibly damaging Het
Atrip T C 9: 109,067,103 N282S probably benign Het
AW554918 A C 18: 25,463,654 S525R probably damaging Het
Casc4 T A 2: 121,867,425 V74E probably damaging Het
Ccdc136 T A 6: 29,414,970 I644N possibly damaging Het
Ccdc178 A G 18: 22,067,662 Y413H probably damaging Het
Ccdc7b A G 8: 129,136,646 H223R probably benign Het
Cd109 T C 9: 78,671,978 V634A possibly damaging Het
Col7a1 T A 9: 108,961,548 probably benign Het
Copb2 A T 9: 98,563,167 probably benign Het
Csrnp3 C T 2: 66,022,563 S445L probably damaging Het
Cxcl13 G T 5: 95,958,671 C34F probably damaging Het
Dars2 T C 1: 161,046,928 E397G probably benign Het
Dlg5 C T 14: 24,146,255 V1625M probably damaging Het
Dnah12 T G 14: 26,884,265 probably benign Het
Eif4a1 C A 11: 69,670,252 A76S probably damaging Het
Fam162b T A 10: 51,587,251 I107L probably damaging Het
Fbxo30 G T 10: 11,291,313 C593F possibly damaging Het
Fut9 A G 4: 25,620,359 F152L probably damaging Het
Galnt2 G A 8: 124,343,346 G534D probably benign Het
Gm973 C T 1: 59,558,234 probably benign Het
Gprc5a T A 6: 135,078,950 S132T probably damaging Het
Hk3 G A 13: 55,014,730 R47C probably damaging Het
Hrnr A T 3: 93,332,508 Q3351L unknown Het
Icam1 T A 9: 21,019,127 F92L probably damaging Het
Ifi213 C T 1: 173,589,800 V349I possibly damaging Het
Il12rb2 T C 6: 67,298,904 probably benign Het
Irx3 A G 8: 91,799,420 V487A possibly damaging Het
Kalrn A G 16: 34,035,554 V204A probably damaging Het
Krt16 T C 11: 100,246,454 probably benign Het
Loxhd1 G A 18: 77,404,969 V1369I probably benign Het
Med13 T A 11: 86,319,596 K573N possibly damaging Het
Mnat1 A G 12: 73,188,188 R204G possibly damaging Het
Myt1l A T 12: 29,827,733 D461V unknown Het
Nek6 T A 2: 38,557,846 S41T probably damaging Het
Nudt22 T C 19: 6,993,506 E232G probably damaging Het
Numbl C A 7: 27,273,990 F192L probably damaging Het
Olfr1202 C T 2: 88,817,882 T237I probably benign Het
Olfr834 T A 9: 18,988,126 I46K probably damaging Het
P2rx4 T C 5: 122,714,404 V47A probably damaging Het
Phka1 T A X: 102,586,104 I478F probably damaging Het
Pkn2 G A 3: 142,830,520 T200I probably damaging Het
Plcg1 T A 2: 160,751,778 probably null Het
Polg2 C T 11: 106,768,413 G425R probably damaging Het
Ptprm G T 17: 66,944,332 probably null Het
Reg1 G A 6: 78,428,118 R108H possibly damaging Het
Slc19a2 T A 1: 164,256,798 F86I probably damaging Het
Slc26a11 T C 11: 119,374,777 L372P probably damaging Het
Slc2a4 C T 11: 69,946,159 V28M possibly damaging Het
Snd1 C G 6: 28,545,470 probably benign Het
Sorcs3 G A 19: 48,487,406 A235T probably benign Het
Sp100 T A 1: 85,694,281 N362K probably damaging Het
Sqor A T 2: 122,799,855 I32F probably benign Het
Stx6 C T 1: 155,193,294 R189C probably damaging Het
Tchp T C 5: 114,717,453 I298T probably damaging Het
Themis A G 10: 28,761,574 I225V probably benign Het
Timm50 A T 7: 28,306,941 V245E probably damaging Het
Tnxb A G 17: 34,689,354 E1327G probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Tradd T C 8: 105,260,644 E10G possibly damaging Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Ttn T C 2: 76,899,403 probably benign Het
Ttr A T 18: 20,669,977 probably null Het
Ubp1 A G 9: 113,944,931 Y66C probably damaging Het
Vmn2r102 A T 17: 19,677,619 M299L probably benign Het
Vmn2r104 A T 17: 20,042,904 N98K probably damaging Het
Yipf5 A G 18: 40,207,772 S176P probably benign Het
Zpbp2 C T 11: 98,553,937 T97I probably damaging Het
Other mutations in Snap29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03231:Snap29 APN 16 17427100 missense probably benign 0.06
IGL02799:Snap29 UTSW 16 17422503 missense probably benign
R0086:Snap29 UTSW 16 17428236 missense probably damaging 0.96
R0371:Snap29 UTSW 16 17406203 missense probably benign 0.02
R0616:Snap29 UTSW 16 17422506 nonsense probably null
R2002:Snap29 UTSW 16 17406326 nonsense probably null
R2137:Snap29 UTSW 16 17428249 missense possibly damaging 0.60
R4478:Snap29 UTSW 16 17428155 missense probably benign 0.00
R4976:Snap29 UTSW 16 17419268 missense probably damaging 1.00
R5933:Snap29 UTSW 16 17406330 missense probably damaging 1.00
R6314:Snap29 UTSW 16 17419319 missense probably benign 0.25
R6824:Snap29 UTSW 16 17422506 missense probably benign 0.01
R7397:Snap29 UTSW 16 17419372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTTACCTTCTCCAAGGATGCTG -3'
(R):5'- CATACATGAGAGACAAGGACCTGCTG -3'

Sequencing Primer
(F):5'- AGAGCTGGACCCCGAgc -3'
(R):5'- GGTACTGGCAGCGGTAG -3'
Posted On2013-07-30