Incidental Mutation 'R0709:Abcc5'
ID 62678
Institutional Source Beutler Lab
Gene Symbol Abcc5
Ensembl Gene ENSMUSG00000022822
Gene Name ATP-binding cassette, sub-family C member 5
Synonyms 2900011L11Rik, Abcc5b, Abcc5a, Mrp5
MMRRC Submission 038892-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0709 (G1)
Quality Score 108
Status Validated
Chromosome 16
Chromosomal Location 20150053-20245144 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20195342 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 718 (H718Q)
Ref Sequence ENSEMBL: ENSMUSP00000111209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079158] [ENSMUST00000115547] [ENSMUST00000232044]
AlphaFold Q9R1X5
Predicted Effect possibly damaging
Transcript: ENSMUST00000079158
AA Change: H718Q

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078158
Gene: ENSMUSG00000022822
AA Change: H718Q

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 1.6e-18 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1142 9.3e-36 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115547
AA Change: H718Q

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111209
Gene: ENSMUSG00000022822
AA Change: H718Q

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 2e-17 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1146 6.5e-30 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150340
Predicted Effect probably benign
Transcript: ENSMUST00000232044
Meta Mutation Damage Score 0.3775 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal cGMP transport into erythrocyte membrane vesicles. [provided by MGI curators]
Allele List at MGI

All alleles(81) : Targeted(4) Gene trapped(77)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,436,358 (GRCm39) D137V probably damaging Het
Aar2 C T 2: 156,408,930 (GRCm39) P378L probably damaging Het
Ace G T 11: 105,872,364 (GRCm39) L319F probably damaging Het
Angpt4 C A 2: 151,776,434 (GRCm39) P321T possibly damaging Het
Atrip T C 9: 108,896,171 (GRCm39) N282S probably benign Het
AW554918 A C 18: 25,596,711 (GRCm39) S525R probably damaging Het
Ccdc136 T A 6: 29,414,969 (GRCm39) I644N possibly damaging Het
Ccdc178 A G 18: 22,200,719 (GRCm39) Y413H probably damaging Het
Ccdc7b A G 8: 129,863,127 (GRCm39) H223R probably benign Het
Cd109 T C 9: 78,579,260 (GRCm39) V634A possibly damaging Het
Col7a1 T A 9: 108,790,616 (GRCm39) probably benign Het
Copb2 A T 9: 98,445,220 (GRCm39) probably benign Het
Csrnp3 C T 2: 65,852,907 (GRCm39) S445L probably damaging Het
Cxcl13 G T 5: 96,106,530 (GRCm39) C34F probably damaging Het
Dars2 T C 1: 160,874,498 (GRCm39) E397G probably benign Het
Dlg5 C T 14: 24,196,323 (GRCm39) V1625M probably damaging Het
Dnah12 T G 14: 26,606,222 (GRCm39) probably benign Het
Eif4a1 C A 11: 69,561,078 (GRCm39) A76S probably damaging Het
Fam162b T A 10: 51,463,347 (GRCm39) I107L probably damaging Het
Fbxo30 G T 10: 11,167,057 (GRCm39) C593F possibly damaging Het
Fut9 A G 4: 25,620,359 (GRCm39) F152L probably damaging Het
Galnt2 G A 8: 125,070,085 (GRCm39) G534D probably benign Het
Gm973 C T 1: 59,597,393 (GRCm39) probably benign Het
Golm2 T A 2: 121,697,906 (GRCm39) V74E probably damaging Het
Gprc5a T A 6: 135,055,948 (GRCm39) S132T probably damaging Het
Hk3 G A 13: 55,162,543 (GRCm39) R47C probably damaging Het
Hrnr A T 3: 93,239,815 (GRCm39) Q3351L unknown Het
Icam1 T A 9: 20,930,423 (GRCm39) F92L probably damaging Het
Ifi213 C T 1: 173,417,366 (GRCm39) V349I possibly damaging Het
Il12rb2 T C 6: 67,275,888 (GRCm39) probably benign Het
Irx3 A G 8: 92,526,048 (GRCm39) V487A possibly damaging Het
Kalrn A G 16: 33,855,924 (GRCm39) V204A probably damaging Het
Krt16 T C 11: 100,137,280 (GRCm39) probably benign Het
Loxhd1 G A 18: 77,492,665 (GRCm39) V1369I probably benign Het
Med13 T A 11: 86,210,422 (GRCm39) K573N possibly damaging Het
Mnat1 A G 12: 73,234,962 (GRCm39) R204G possibly damaging Het
Myt1l A T 12: 29,877,732 (GRCm39) D461V unknown Het
Nek6 T A 2: 38,447,858 (GRCm39) S41T probably damaging Het
Nudt22 T C 19: 6,970,874 (GRCm39) E232G probably damaging Het
Numbl C A 7: 26,973,415 (GRCm39) F192L probably damaging Het
Or4c105 C T 2: 88,648,226 (GRCm39) T237I probably benign Het
Or7g12 T A 9: 18,899,422 (GRCm39) I46K probably damaging Het
P2rx4 T C 5: 122,852,467 (GRCm39) V47A probably damaging Het
Phka1 T A X: 101,629,710 (GRCm39) I478F probably damaging Het
Pkn2 G A 3: 142,536,281 (GRCm39) T200I probably damaging Het
Plcg1 T A 2: 160,593,698 (GRCm39) probably null Het
Polg2 C T 11: 106,659,239 (GRCm39) G425R probably damaging Het
Ptprm G T 17: 67,251,327 (GRCm39) probably null Het
Reg1 G A 6: 78,405,101 (GRCm39) R108H possibly damaging Het
Slc19a2 T A 1: 164,084,367 (GRCm39) F86I probably damaging Het
Slc26a11 T C 11: 119,265,603 (GRCm39) L372P probably damaging Het
Slc2a4 C T 11: 69,836,985 (GRCm39) V28M possibly damaging Het
Snap29 A G 16: 17,224,012 (GRCm39) N9S probably damaging Het
Snd1 C G 6: 28,545,469 (GRCm39) probably benign Het
Sorcs3 G A 19: 48,475,845 (GRCm39) A235T probably benign Het
Sp100 T A 1: 85,622,002 (GRCm39) N362K probably damaging Het
Sqor A T 2: 122,641,775 (GRCm39) I32F probably benign Het
Stx6 C T 1: 155,069,040 (GRCm39) R189C probably damaging Het
Tchp T C 5: 114,855,514 (GRCm39) I298T probably damaging Het
Themis A G 10: 28,637,570 (GRCm39) I225V probably benign Het
Timm50 A T 7: 28,006,366 (GRCm39) V245E probably damaging Het
Tnxb A G 17: 34,908,328 (GRCm39) E1327G probably damaging Het
Tpp1 C T 7: 105,398,814 (GRCm39) R205H probably benign Het
Tradd T C 8: 105,987,276 (GRCm39) E10G possibly damaging Het
Trim43a G A 9: 88,464,199 (GRCm39) E37K probably benign Het
Ttn T C 2: 76,729,747 (GRCm39) probably benign Het
Ttr A T 18: 20,803,034 (GRCm39) probably null Het
Ubp1 A G 9: 113,773,999 (GRCm39) Y66C probably damaging Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r104 A T 17: 20,263,166 (GRCm39) N98K probably damaging Het
Yipf5 A G 18: 40,340,825 (GRCm39) S176P probably benign Het
Zpbp2 C T 11: 98,444,763 (GRCm39) T97I probably damaging Het
Other mutations in Abcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Abcc5 APN 16 20,241,107 (GRCm39) missense probably benign 0.01
IGL00928:Abcc5 APN 16 20,217,720 (GRCm39) unclassified probably benign
IGL01350:Abcc5 APN 16 20,187,208 (GRCm39) missense probably benign 0.00
IGL01774:Abcc5 APN 16 20,197,207 (GRCm39) missense probably damaging 1.00
IGL01934:Abcc5 APN 16 20,241,191 (GRCm39) utr 5 prime probably benign
IGL02413:Abcc5 APN 16 20,241,187 (GRCm39) utr 5 prime probably benign
IGL02426:Abcc5 APN 16 20,157,675 (GRCm39) missense probably damaging 0.98
IGL02797:Abcc5 APN 16 20,187,214 (GRCm39) missense probably benign 0.06
IGL02938:Abcc5 APN 16 20,180,979 (GRCm39) missense possibly damaging 0.64
IGL03367:Abcc5 APN 16 20,211,561 (GRCm39) utr 3 prime probably benign
IGL03411:Abcc5 APN 16 20,218,310 (GRCm39) missense probably damaging 0.97
PIT4508001:Abcc5 UTSW 16 20,176,128 (GRCm39) missense probably damaging 0.97
R0021:Abcc5 UTSW 16 20,197,411 (GRCm39) nonsense probably null
R0021:Abcc5 UTSW 16 20,197,411 (GRCm39) nonsense probably null
R0220:Abcc5 UTSW 16 20,187,852 (GRCm39) missense probably benign
R0281:Abcc5 UTSW 16 20,241,150 (GRCm39) missense probably damaging 1.00
R0401:Abcc5 UTSW 16 20,195,308 (GRCm39) missense probably benign 0.09
R0448:Abcc5 UTSW 16 20,218,687 (GRCm39) missense probably damaging 1.00
R0477:Abcc5 UTSW 16 20,217,635 (GRCm39) missense probably damaging 0.96
R0477:Abcc5 UTSW 16 20,187,319 (GRCm39) missense possibly damaging 0.51
R0601:Abcc5 UTSW 16 20,223,309 (GRCm39) splice site probably benign
R0648:Abcc5 UTSW 16 20,184,632 (GRCm39) missense possibly damaging 0.90
R1144:Abcc5 UTSW 16 20,241,188 (GRCm39) utr 5 prime probably benign
R1552:Abcc5 UTSW 16 20,217,617 (GRCm39) missense probably damaging 0.99
R1625:Abcc5 UTSW 16 20,184,567 (GRCm39) missense probably damaging 0.99
R1748:Abcc5 UTSW 16 20,152,338 (GRCm39) missense probably benign 0.01
R1789:Abcc5 UTSW 16 20,184,701 (GRCm39) missense probably damaging 1.00
R1801:Abcc5 UTSW 16 20,157,637 (GRCm39) missense probably benign 0.43
R1909:Abcc5 UTSW 16 20,195,259 (GRCm39) critical splice donor site probably null
R2046:Abcc5 UTSW 16 20,218,567 (GRCm39) missense possibly damaging 0.90
R2203:Abcc5 UTSW 16 20,224,632 (GRCm39) missense possibly damaging 0.91
R3031:Abcc5 UTSW 16 20,193,863 (GRCm39) missense probably damaging 0.99
R3417:Abcc5 UTSW 16 20,224,302 (GRCm39) splice site probably benign
R3708:Abcc5 UTSW 16 20,190,930 (GRCm39) missense probably benign 0.30
R3731:Abcc5 UTSW 16 20,217,684 (GRCm39) nonsense probably null
R3829:Abcc5 UTSW 16 20,184,615 (GRCm39) missense probably benign 0.00
R3847:Abcc5 UTSW 16 20,190,906 (GRCm39) missense probably benign 0.12
R3850:Abcc5 UTSW 16 20,190,906 (GRCm39) missense probably benign 0.12
R3955:Abcc5 UTSW 16 20,224,293 (GRCm39) missense probably damaging 0.97
R4072:Abcc5 UTSW 16 20,152,445 (GRCm39) missense probably damaging 1.00
R4432:Abcc5 UTSW 16 20,186,937 (GRCm39) splice site probably null
R4433:Abcc5 UTSW 16 20,186,937 (GRCm39) splice site probably null
R4505:Abcc5 UTSW 16 20,152,445 (GRCm39) missense probably damaging 1.00
R4506:Abcc5 UTSW 16 20,152,445 (GRCm39) missense probably damaging 1.00
R4715:Abcc5 UTSW 16 20,217,626 (GRCm39) missense probably damaging 1.00
R4739:Abcc5 UTSW 16 20,218,376 (GRCm39) missense probably damaging 1.00
R4866:Abcc5 UTSW 16 20,241,182 (GRCm39) start codon destroyed probably null 1.00
R4905:Abcc5 UTSW 16 20,218,678 (GRCm39) missense probably damaging 1.00
R4907:Abcc5 UTSW 16 20,195,296 (GRCm39) missense possibly damaging 0.86
R5088:Abcc5 UTSW 16 20,195,412 (GRCm39) missense probably damaging 1.00
R5232:Abcc5 UTSW 16 20,157,672 (GRCm39) missense probably damaging 0.96
R5559:Abcc5 UTSW 16 20,157,636 (GRCm39) missense probably damaging 1.00
R5647:Abcc5 UTSW 16 20,218,597 (GRCm39) missense probably damaging 1.00
R5861:Abcc5 UTSW 16 20,218,644 (GRCm39) missense probably damaging 1.00
R6190:Abcc5 UTSW 16 20,211,529 (GRCm39) missense probably benign 0.02
R6213:Abcc5 UTSW 16 20,218,762 (GRCm39) missense probably damaging 1.00
R6511:Abcc5 UTSW 16 20,195,344 (GRCm39) missense probably damaging 0.99
R6732:Abcc5 UTSW 16 20,223,434 (GRCm39) missense probably benign 0.01
R6815:Abcc5 UTSW 16 20,152,380 (GRCm39) missense probably damaging 1.00
R6913:Abcc5 UTSW 16 20,197,494 (GRCm39) missense possibly damaging 0.73
R6945:Abcc5 UTSW 16 20,218,759 (GRCm39) missense probably benign
R7167:Abcc5 UTSW 16 20,224,251 (GRCm39) missense possibly damaging 0.70
R7276:Abcc5 UTSW 16 20,195,258 (GRCm39) splice site probably null
R7318:Abcc5 UTSW 16 20,211,293 (GRCm39) missense probably benign 0.01
R7380:Abcc5 UTSW 16 20,215,784 (GRCm39) missense possibly damaging 0.84
R7419:Abcc5 UTSW 16 20,241,173 (GRCm39) missense possibly damaging 0.57
R7451:Abcc5 UTSW 16 20,193,820 (GRCm39) missense probably damaging 1.00
R7475:Abcc5 UTSW 16 20,218,739 (GRCm39) missense probably benign 0.04
R7567:Abcc5 UTSW 16 20,224,260 (GRCm39) missense probably damaging 1.00
R7601:Abcc5 UTSW 16 20,193,882 (GRCm39) nonsense probably null
R7623:Abcc5 UTSW 16 20,163,446 (GRCm39) missense possibly damaging 0.95
R7682:Abcc5 UTSW 16 20,186,803 (GRCm39) missense probably damaging 1.00
R8128:Abcc5 UTSW 16 20,184,473 (GRCm39) missense probably damaging 0.98
R8327:Abcc5 UTSW 16 20,241,068 (GRCm39) missense probably benign 0.00
R8518:Abcc5 UTSW 16 20,223,398 (GRCm39) missense possibly damaging 0.80
R8678:Abcc5 UTSW 16 20,184,685 (GRCm39) missense probably benign 0.31
R8679:Abcc5 UTSW 16 20,152,479 (GRCm39) missense possibly damaging 0.89
R9206:Abcc5 UTSW 16 20,208,139 (GRCm39) missense probably benign 0.00
R9254:Abcc5 UTSW 16 20,152,437 (GRCm39) missense probably damaging 1.00
R9379:Abcc5 UTSW 16 20,152,437 (GRCm39) missense probably damaging 1.00
R9501:Abcc5 UTSW 16 20,214,853 (GRCm39) missense probably damaging 1.00
R9647:Abcc5 UTSW 16 20,195,310 (GRCm39) missense probably benign 0.01
X0022:Abcc5 UTSW 16 20,211,337 (GRCm39) missense probably damaging 1.00
X0053:Abcc5 UTSW 16 20,182,792 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTCATCGACAGATGCCACCTCAG -3'
(R):5'- AGTTGTAGGGTGACTTCCTCAGCC -3'

Sequencing Primer
(F):5'- TGCAGAACCAGTGTGTTCC -3'
(R):5'- CAGGCAGTTTGTGAAGGC -3'
Posted On 2013-07-30