Mutagenetix > Incidental Mutation

Incidental Mutation 'R0709:Loxhd1'

62683

Institutional Source

Beutler Lab

Gene Symbol

Loxhd1

Ensembl Gene

ENSMUSG00000032818

Gene Name

lipoxygenase homology domains 1

Synonyms

sba, 1700096C21Rik

MMRRC Submission

038892-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R0709 (G1)

Quality Score

117

Status

Validated

Chromosome

Chromosomal Location

77281958-77442341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 77404969 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1369 (V1369I)

Ref Sequence

ENSEMBL: ENSMUSP00000114988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096547] [ENSMUST00000123166] [ENSMUST00000123410] [ENSMUST00000148341]

AlphaFold

C8YR32

Predicted Effect

probably benign
Transcript: ENSMUST00000096547
AA Change: V1478I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: V1478I

Domain	Start	End	E-Value	Type
LH2	43	158	5.64e-5	SMART
LH2	172	290	1.64e-9	SMART
LH2	296	409	1.1e-4	SMART
LH2	425	539	4.02e-4	SMART
LH2	553	675	3.79e-6	SMART
LH2	684	800	5.92e-6	SMART
LH2	814	936	6.91e-8	SMART
low complexity region	945	954	N/A	INTRINSIC
LH2	970	1086	4.81e-7	SMART
LH2	1101	1228	5.73e-3	SMART
LH2	1255	1375	8.82e-5	SMART
Pfam:PLAT	1424	1540	5.4e-10	PFAM
LH2	1553	1666	6.41e-3	SMART
LH2	1680	1799	6.76e-6	SMART
Pfam:PLAT	1813	1929	3.8e-9	PFAM
LH2	1949	2067	7.23e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123166

SMART Domains

Protein: ENSMUSP00000116287
Gene: ENSMUSG00000032818

Domain	Start	End	E-Value	Type
LH2	1	114	6.41e-3	SMART
LH2	128	247	6.76e-6	SMART
Pfam:PLAT	261	379	1.3e-8	PFAM
LH2	397	515	7.23e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123410
AA Change: V612I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818
AA Change: V612I

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	67	4.4e-15	PFAM
low complexity region	79	88	N/A	INTRINSIC
LH2	104	220	4.81e-7	SMART
LH2	235	362	5.73e-3	SMART
LH2	389	509	8.82e-5	SMART
Pfam:PLAT	558	674	9.9e-12	PFAM
LH2	687	800	6.41e-3	SMART
LH2	814	933	6.76e-6	SMART
Pfam:PLAT	947	1065	8.8e-9	PFAM
Pfam:PLAT	1085	1174	4.2e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148341
AA Change: V1369I

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: V1369I

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	91	1.7e-11	PFAM
LH2	106	220	4.02e-4	SMART
LH2	234	356	3.79e-6	SMART
LH2	365	481	5.92e-6	SMART
LH2	495	610	7.67e-3	SMART
LH2	707	827	1.47e-11	SMART
low complexity region	836	845	N/A	INTRINSIC
LH2	861	977	4.81e-7	SMART
LH2	992	1119	5.73e-3	SMART
LH2	1146	1266	8.82e-5	SMART
Pfam:PLAT	1384	1469	8.9e-14	PFAM

Meta Mutation Damage Score

0.1611

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.8%

Validation Efficiency

98% (83/85)

MGI Phenotype

PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	A	T	16: 14,618,494	D137V	probably damaging	Het
Aar2	C	T	2: 156,567,010	P378L	probably damaging	Het
Abcc5	A	T	16: 20,376,592	H718Q	possibly damaging	Het
Ace	G	T	11: 105,981,538	L319F	probably damaging	Het
Angpt4	C	A	2: 151,934,514	P321T	possibly damaging	Het
Atrip	T	C	9: 109,067,103	N282S	probably benign	Het
AW554918	A	C	18: 25,463,654	S525R	probably damaging	Het
Casc4	T	A	2: 121,867,425	V74E	probably damaging	Het
Ccdc136	T	A	6: 29,414,970	I644N	possibly damaging	Het
Ccdc178	A	G	18: 22,067,662	Y413H	probably damaging	Het
Ccdc7b	A	G	8: 129,136,646	H223R	probably benign	Het
Cd109	T	C	9: 78,671,978	V634A	possibly damaging	Het
Col7a1	T	A	9: 108,961,548		probably benign	Het
Copb2	A	T	9: 98,563,167		probably benign	Het
Csrnp3	C	T	2: 66,022,563	S445L	probably damaging	Het
Cxcl13	G	T	5: 95,958,671	C34F	probably damaging	Het
Dars2	T	C	1: 161,046,928	E397G	probably benign	Het
Dlg5	C	T	14: 24,146,255	V1625M	probably damaging	Het
Dnah12	T	G	14: 26,884,265		probably benign	Het
Eif4a1	C	A	11: 69,670,252	A76S	probably damaging	Het
Fam162b	T	A	10: 51,587,251	I107L	probably damaging	Het
Fbxo30	G	T	10: 11,291,313	C593F	possibly damaging	Het
Fut9	A	G	4: 25,620,359	F152L	probably damaging	Het
Galnt2	G	A	8: 124,343,346	G534D	probably benign	Het
Gm973	C	T	1: 59,558,234		probably benign	Het
Gprc5a	T	A	6: 135,078,950	S132T	probably damaging	Het
Hk3	G	A	13: 55,014,730	R47C	probably damaging	Het
Hrnr	A	T	3: 93,332,508	Q3351L	unknown	Het
Icam1	T	A	9: 21,019,127	F92L	probably damaging	Het
Ifi213	C	T	1: 173,589,800	V349I	possibly damaging	Het
Il12rb2	T	C	6: 67,298,904		probably benign	Het
Irx3	A	G	8: 91,799,420	V487A	possibly damaging	Het
Kalrn	A	G	16: 34,035,554	V204A	probably damaging	Het
Krt16	T	C	11: 100,246,454		probably benign	Het
Med13	T	A	11: 86,319,596	K573N	possibly damaging	Het
Mnat1	A	G	12: 73,188,188	R204G	possibly damaging	Het
Myt1l	A	T	12: 29,827,733	D461V	unknown	Het
Nek6	T	A	2: 38,557,846	S41T	probably damaging	Het
Nudt22	T	C	19: 6,993,506	E232G	probably damaging	Het
Numbl	C	A	7: 27,273,990	F192L	probably damaging	Het
Olfr1202	C	T	2: 88,817,882	T237I	probably benign	Het
Olfr834	T	A	9: 18,988,126	I46K	probably damaging	Het
P2rx4	T	C	5: 122,714,404	V47A	probably damaging	Het
Phka1	T	A	X: 102,586,104	I478F	probably damaging	Het
Pkn2	G	A	3: 142,830,520	T200I	probably damaging	Het
Plcg1	T	A	2: 160,751,778		probably null	Het
Polg2	C	T	11: 106,768,413	G425R	probably damaging	Het
Ptprm	G	T	17: 66,944,332		probably null	Het
Reg1	G	A	6: 78,428,118	R108H	possibly damaging	Het
Slc19a2	T	A	1: 164,256,798	F86I	probably damaging	Het
Slc26a11	T	C	11: 119,374,777	L372P	probably damaging	Het
Slc2a4	C	T	11: 69,946,159	V28M	possibly damaging	Het
Snap29	A	G	16: 17,406,148	N9S	probably damaging	Het
Snd1	C	G	6: 28,545,470		probably benign	Het
Sorcs3	G	A	19: 48,487,406	A235T	probably benign	Het
Sp100	T	A	1: 85,694,281	N362K	probably damaging	Het
Sqor	A	T	2: 122,799,855	I32F	probably benign	Het
Stx6	C	T	1: 155,193,294	R189C	probably damaging	Het
Tchp	T	C	5: 114,717,453	I298T	probably damaging	Het
Themis	A	G	10: 28,761,574	I225V	probably benign	Het
Timm50	A	T	7: 28,306,941	V245E	probably damaging	Het
Tnxb	A	G	17: 34,689,354	E1327G	probably damaging	Het
Tpp1	C	T	7: 105,749,607	R205H	probably benign	Het
Tradd	T	C	8: 105,260,644	E10G	possibly damaging	Het
Trim43a	G	A	9: 88,582,146	E37K	probably benign	Het
Ttn	T	C	2: 76,899,403		probably benign	Het
Ttr	A	T	18: 20,669,977		probably null	Het
Ubp1	A	G	9: 113,944,931	Y66C	probably damaging	Het
Vmn2r102	A	T	17: 19,677,619	M299L	probably benign	Het
Vmn2r104	A	T	17: 20,042,904	N98K	probably damaging	Het
Yipf5	A	G	18: 40,207,772	S176P	probably benign	Het
Zpbp2	C	T	11: 98,553,937	T97I	probably damaging	Het

Other mutations in Loxhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Loxhd1	APN	18	77395450	missense	probably damaging	0.99
IGL00490:Loxhd1	APN	18	77431074	missense	possibly damaging	0.94
IGL00507:Loxhd1	APN	18	77332567	missense	probably benign	0.03
IGL00546:Loxhd1	APN	18	77405976	missense	probably damaging	0.97
IGL01369:Loxhd1	APN	18	77329201	missense	possibly damaging	0.85
IGL01767:Loxhd1	APN	18	77286424	missense	possibly damaging	0.71
IGL02245:Loxhd1	APN	18	77340101	missense	possibly damaging	0.71
IGL02388:Loxhd1	APN	18	77369137	missense	probably benign	0.18
IGL02410:Loxhd1	APN	18	77402952	missense	probably benign	0.02
IGL02593:Loxhd1	APN	18	77410539	missense	possibly damaging	0.91
IGL02632:Loxhd1	APN	18	77405932	missense	probably damaging	0.99
IGL02692:Loxhd1	APN	18	77356913	missense	probably damaging	0.99
IGL02796:Loxhd1	APN	18	77369115	splice site	probably benign
IGL03032:Loxhd1	APN	18	77286473	missense	possibly damaging	0.93
IGL03074:Loxhd1	APN	18	77441784	missense	possibly damaging	0.75
IGL03094:Loxhd1	APN	18	77431113	missense	possibly damaging	0.88
IGL03118:Loxhd1	APN	18	77380464	missense	probably damaging	1.00
IGL03232:Loxhd1	APN	18	77408750	missense	probably damaging	1.00
IGL03377:Loxhd1	APN	18	77441673	missense	possibly damaging	0.91
H8562:Loxhd1	UTSW	18	77341931	missense	possibly damaging	0.93
PIT4494001:Loxhd1	UTSW	18	77441768	missense	probably damaging	0.99
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0048:Loxhd1	UTSW	18	77408778	missense	probably damaging	0.99
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0208:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0323:Loxhd1	UTSW	18	77369137	missense	probably benign	0.18
R0332:Loxhd1	UTSW	18	77383830	splice site	probably null
R0367:Loxhd1	UTSW	18	77425757	splice site	probably benign
R0783:Loxhd1	UTSW	18	77429984	missense	possibly damaging	0.58
R1132:Loxhd1	UTSW	18	77429943	missense	possibly damaging	0.71
R1232:Loxhd1	UTSW	18	77406003	critical splice donor site	probably null
R1331:Loxhd1	UTSW	18	77402936	missense	possibly damaging	0.86
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1501:Loxhd1	UTSW	18	77356832	missense	probably damaging	1.00
R1640:Loxhd1	UTSW	18	77402563	missense	probably damaging	1.00
R1656:Loxhd1	UTSW	18	77321668	missense	possibly damaging	0.71
R1671:Loxhd1	UTSW	18	77404802	missense	probably damaging	1.00
R1725:Loxhd1	UTSW	18	77293241	missense	probably benign	0.32
R1735:Loxhd1	UTSW	18	77404889	missense	probably damaging	0.98
R1796:Loxhd1	UTSW	18	77405907	missense	probably damaging	0.96
R1796:Loxhd1	UTSW	18	77425639	missense	possibly damaging	0.88
R1800:Loxhd1	UTSW	18	77402502	missense	probably damaging	1.00
R1848:Loxhd1	UTSW	18	77281971	missense	possibly damaging	0.53
R1912:Loxhd1	UTSW	18	77340137	missense	probably benign	0.32
R1945:Loxhd1	UTSW	18	77404808	missense	probably damaging	1.00
R1978:Loxhd1	UTSW	18	77321642	missense	possibly damaging	0.86
R1997:Loxhd1	UTSW	18	77295769	missense	probably damaging	0.98
R2086:Loxhd1	UTSW	18	77384946	missense	probably damaging	1.00
R2153:Loxhd1	UTSW	18	77356166	missense	possibly damaging	0.72
R3124:Loxhd1	UTSW	18	77431078	missense	probably damaging	0.97
R3896:Loxhd1	UTSW	18	77382023	missense	possibly damaging	0.65
R3907:Loxhd1	UTSW	18	77408768	missense	possibly damaging	0.60
R3980:Loxhd1	UTSW	18	77414159	missense	probably damaging	1.00
R4165:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4166:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4176:Loxhd1	UTSW	18	77331059	missense	possibly damaging	0.53
R4345:Loxhd1	UTSW	18	77399001	missense	possibly damaging	0.89
R4354:Loxhd1	UTSW	18	77395427	missense	probably damaging	1.00
R4385:Loxhd1	UTSW	18	77372911	missense	probably damaging	0.99
R4402:Loxhd1	UTSW	18	77441760	missense	possibly damaging	0.94
R4404:Loxhd1	UTSW	18	77431132	missense	probably damaging	1.00
R4456:Loxhd1	UTSW	18	77399089	missense	probably damaging	1.00
R4525:Loxhd1	UTSW	18	77356912	missense	probably damaging	0.98
R4605:Loxhd1	UTSW	18	77405946	missense	probably benign	0.00
R4661:Loxhd1	UTSW	18	77402885	missense	possibly damaging	0.79
R4698:Loxhd1	UTSW	18	77372291	missense	possibly damaging	0.82
R4725:Loxhd1	UTSW	18	77395457	missense	probably damaging	1.00
R4820:Loxhd1	UTSW	18	77384967	missense	probably damaging	1.00
R5163:Loxhd1	UTSW	18	77361736	missense	possibly damaging	0.92
R5288:Loxhd1	UTSW	18	77363612	missense	probably damaging	1.00
R5328:Loxhd1	UTSW	18	77410572	missense	probably damaging	1.00
R5329:Loxhd1	UTSW	18	77332682	missense	probably damaging	0.98
R5347:Loxhd1	UTSW	18	77366541	missense	probably damaging	1.00
R5589:Loxhd1	UTSW	18	77342055	missense	possibly damaging	0.86
R5616:Loxhd1	UTSW	18	77404951	missense	probably damaging	1.00
R5703:Loxhd1	UTSW	18	77356877	missense	probably damaging	1.00
R5837:Loxhd1	UTSW	18	77286409	missense	possibly damaging	0.71
R5888:Loxhd1	UTSW	18	77402515	missense	probably damaging	0.99
R6021:Loxhd1	UTSW	18	77412250	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6153:Loxhd1	UTSW	18	77295758	missense	possibly damaging	0.71
R6174:Loxhd1	UTSW	18	77412178	missense	probably damaging	1.00
R6265:Loxhd1	UTSW	18	77361730	missense	probably damaging	0.99
R6377:Loxhd1	UTSW	18	77380432	missense	probably damaging	1.00
R6530:Loxhd1	UTSW	18	77412151	missense	probably benign	0.30
R6555:Loxhd1	UTSW	18	77293269	missense	possibly damaging	0.51
R6782:Loxhd1	UTSW	18	77431177	missense	probably damaging	0.99
R6834:Loxhd1	UTSW	18	77441526	missense	probably damaging	1.00
R7000:Loxhd1	UTSW	18	77372433	critical splice donor site	probably null
R7112:Loxhd1	UTSW	18	77388514	missense	probably damaging	1.00
R7203:Loxhd1	UTSW	18	77414196	missense	probably damaging	0.97
R7206:Loxhd1	UTSW	18	77441817	missense	probably damaging	0.97
R7260:Loxhd1	UTSW	18	77332642	missense	possibly damaging	0.93
R7432:Loxhd1	UTSW	18	77295851	missense	possibly damaging	0.51
R7475:Loxhd1	UTSW	18	77412305	missense	possibly damaging	0.83
R7555:Loxhd1	UTSW	18	77395365	missense	probably damaging	0.99
R7590:Loxhd1	UTSW	18	77321634	missense	possibly damaging	0.84
R7612:Loxhd1	UTSW	18	77429975	missense	possibly damaging	0.95
R7626:Loxhd1	UTSW	18	77431186	missense	possibly damaging	0.75
R7768:Loxhd1	UTSW	18	77384941	missense	probably damaging	0.99
R7791:Loxhd1	UTSW	18	77383729	missense	probably damaging	1.00
R7829:Loxhd1	UTSW	18	77408787	missense	probably damaging	0.99
R7884:Loxhd1	UTSW	18	77431213	missense	probably damaging	0.98
R7960:Loxhd1	UTSW	18	77385050	missense	probably damaging	0.99
R7986:Loxhd1	UTSW	18	77375194	missense	possibly damaging	0.88
R8042:Loxhd1	UTSW	18	77431192	missense	probably damaging	0.99
R8084:Loxhd1	UTSW	18	77340149	missense	possibly damaging	0.71
R8088:Loxhd1	UTSW	18	77342013	missense	possibly damaging	0.52
R8100:Loxhd1	UTSW	18	77404816	missense	possibly damaging	0.69
R8139:Loxhd1	UTSW	18	77380496	missense	possibly damaging	0.95
R8152:Loxhd1	UTSW	18	77388399	missense	possibly damaging	0.62
R8199:Loxhd1	UTSW	18	77381638	missense	possibly damaging	0.77
R8246:Loxhd1	UTSW	18	77363546	missense	possibly damaging	0.71
R8263:Loxhd1	UTSW	18	77375162	missense	probably damaging	1.00
R8324:Loxhd1	UTSW	18	77339579	critical splice donor site	probably null
R8342:Loxhd1	UTSW	18	77405985	missense	possibly damaging	0.88
R8401:Loxhd1	UTSW	18	77380460	missense	probably damaging	1.00
R8480:Loxhd1	UTSW	18	77431131	missense	probably damaging	1.00
R8490:Loxhd1	UTSW	18	77441466	missense	possibly damaging	0.96
R8807:Loxhd1	UTSW	18	77356772	missense	possibly damaging	0.93
R8961:Loxhd1	UTSW	18	77385069	missense	probably damaging	1.00
R8974:Loxhd1	UTSW	18	77431203	missense	possibly damaging	0.88
R9079:Loxhd1	UTSW	18	77402897	missense	probably benign
R9284:Loxhd1	UTSW	18	77414130	missense	probably damaging	0.97
R9312:Loxhd1	UTSW	18	77410589	missense	probably benign	0.05
R9619:Loxhd1	UTSW	18	77356175	missense	probably benign	0.32
X0020:Loxhd1	UTSW	18	77339562	nonsense	probably null
X0024:Loxhd1	UTSW	18	77395403	missense	probably damaging	1.00
X0062:Loxhd1	UTSW	18	77441516	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTCATTACAAGTCCCTCAAACCCG -3'
(R):5'- AGGCTGGAGATCTGCCTCTAACTC -3'

Sequencing Primer
(F):5'- AAGTTAACCCCCACGATCTCTTG -3'
(R):5'- CCACCCTATGTGTTGACCAGTT -3'

Posted On

2013-07-30