Incidental Mutation 'Z1177:Ism2'
ID 626882
Institutional Source Beutler Lab
Gene Symbol Ism2
Ensembl Gene ENSMUSG00000050671
Gene Name isthmin 2
Synonyms Thsd3, LOC217738
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # Z1177 ()
Quality Score 203.009
Status Not validated
Chromosome 12
Chromosomal Location 87278638-87299705 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87280035 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 377 (W377R)
Ref Sequence ENSEMBL: ENSMUSP00000117108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051601] [ENSMUST00000125733]
AlphaFold D3Z6A3
Predicted Effect probably damaging
Transcript: ENSMUST00000051601
AA Change: W333R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053451
Gene: ENSMUSG00000050671
AA Change: W333R

low complexity region 52 68 N/A INTRINSIC
TSP1 206 248 3.9e-7 SMART
AMOP 273 437 1.21e-75 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125733
AA Change: W377R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117108
Gene: ENSMUSG00000050671
AA Change: W377R

signal peptide 1 26 N/A INTRINSIC
low complexity region 96 112 N/A INTRINSIC
TSP1 250 292 3.9e-7 SMART
AMOP 317 481 1.21e-75 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 4377 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik C A 18: 38,254,303 (GRCm38) H199N probably benign Het
0610010F05Rik C A 11: 23,624,960 (GRCm38) D105Y probably benign Het
1110032F04Rik C G 3: 68,869,907 (GRCm38) P67R probably damaging Het
1110032F04Rik G T 3: 68,870,272 (GRCm38) V189L probably benign Het
1500011B03Rik G T 5: 114,809,287 (GRCm38) L60I possibly damaging Het
1500011B03Rik C G 5: 114,813,872 (GRCm38) C14S possibly damaging Het
1700007G11Rik C A 5: 98,801,834 (GRCm38) S209Y probably damaging Het
1700011L22Rik G A 8: 79,248,296 (GRCm38) R53W probably damaging Het
1700015F17Rik C T 5: 5,457,284 (GRCm38) probably null Het
1700018B08Rik G T 8: 121,539,982 (GRCm38) P36H probably benign Het
1700024G13Rik T A 14: 32,388,365 (GRCm38) probably benign Het
1700061G19Rik AT ATT 17: 56,883,463 (GRCm38) probably null Het
1700080E11Rik G A 9: 105,144,460 (GRCm38) P129L possibly damaging Het
1700093K21Rik T A 11: 23,518,144 (GRCm38) probably null Het
2010111I01Rik G T 13: 63,170,990 (GRCm38) R537L probably damaging Het
2410089E03Rik C T 15: 8,209,989 (GRCm38) L1225F probably damaging Het
2410089E03Rik G T 15: 8,174,972 (GRCm38) G78V probably damaging Het
2700049A03Rik G T 12: 71,164,484 (GRCm38) G664V probably damaging Het
2810021J22Rik C G 11: 58,880,103 (GRCm38) S137C probably damaging Het
3425401B19Rik G T 14: 32,661,398 (GRCm38) P870H probably damaging Het
3425401B19Rik G T 14: 32,659,808 (GRCm38) T1400K possibly damaging Het
4833420G17Rik C A 13: 119,477,808 (GRCm38) T484K not run Het
4921504E06Rik C A 2: 19,480,532 (GRCm38) E441D possibly damaging Het
4921507P07Rik G T 6: 50,591,692 (GRCm38) R86S probably benign Het
4921524L21Rik G A 18: 6,635,865 (GRCm38) G306D probably benign Het
4921530L21Rik C A 14: 95,882,130 (GRCm38) P108T probably benign Het
4930402H24Rik C T 2: 130,710,867 (GRCm38) R1091K probably benign Het
4930444P10Rik T A 1: 16,082,022 (GRCm38) probably benign Het
4930452B06Rik G A 14: 8,517,953 (GRCm38) Q289* probably null Het
4930504O13Rik G T 11: 58,446,274 (GRCm38) N124K probably benign Het
4930516K23Rik C A 7: 104,059,418 (GRCm38) M61I probably damaging Het
4930578C19Rik C A X: 18,420,607 (GRCm38) M236I probably benign Het
4931406P16Rik C G 7: 34,284,755 (GRCm38) A148P probably damaging Het
4931409K22Rik G T 5: 24,550,795 (GRCm38) P243H probably benign Het
4931429L15Rik G A 9: 46,305,838 (GRCm38) S213L probably damaging Het
4932411N23Rik C A X: 126,814,533 (GRCm38) W316C probably damaging Het
4932415D10Rik G A 10: 82,289,686 (GRCm38) Q2497* probably null Het
4932415D10Rik G T 10: 82,287,417 (GRCm38) A3253E probably damaging Het
4932415D10Rik C A 10: 82,287,126 (GRCm38) R3350M possibly damaging Het
4932415D10Rik G T 10: 82,285,798 (GRCm38) H3793N possibly damaging Het
4932438A13Rik A T 3: 37,036,707 (GRCm38) S782C Het
4932438A13Rik G C 3: 36,983,440 (GRCm38) M2463I possibly damaging Het
4932438A13Rik G C 3: 36,919,950 (GRCm38) M616I probably benign Het
4933402J07Rik G C 8: 87,586,117 (GRCm38) G177R probably damaging Het
4933402N22Rik G T 5: 11,918,127 (GRCm38) R28M probably damaging Het
4933405L10Rik C G 8: 105,709,973 (GRCm38) S267C possibly damaging Het
4933405L10Rik A C 8: 105,709,975 (GRCm38) S268R possibly damaging Het
4933406M09Rik G A 1: 134,390,158 (GRCm38) V223M probably damaging Het
4933436I01Rik G T X: 67,920,992 (GRCm38) P87Q probably damaging Het
5031439G07Rik C G 15: 84,950,642 (GRCm38) E372Q possibly damaging Het
5430401F13Rik T G 6: 131,552,721 (GRCm38) L93V possibly damaging Het
5430419D17Rik G T 7: 131,265,866 (GRCm38) V1419F unknown Het
6430628N08Rik G A 4: 115,898,259 (GRCm38) R85H unknown Het
6720489N17Rik C A 13: 62,605,310 (GRCm38) M67I probably benign Het
6720489N17Rik C T 13: 62,607,126 (GRCm38) R64K probably null Het
9130204L05Rik C A 3: 91,088,356 (GRCm38) V80L probably benign Het
9130409I23Rik G A 1: 181,059,771 (GRCm38) S307N probably benign Het
9130409I23Rik C A 1: 181,055,417 (GRCm38) P248H probably damaging Het
9330161L09Rik C G 12: 103,407,507 (GRCm38) R35S unknown Het
9430007A20Rik C A 4: 144,528,712 (GRCm38) S234* probably null Het
9430007A20Rik C G 4: 144,528,500 (GRCm38) Y163* probably null Het
9430015G10Rik A T 4: 156,122,377 (GRCm38) M91L probably benign Het
9530003J23Rik C A 10: 117,235,641 (GRCm38) W111L probably benign Het
9530053A07Rik C T 7: 28,139,898 (GRCm38) P379S probably benign Het
9630041A04Rik C A 9: 101,942,813 (GRCm38) P144Q probably damaging Het
A1bg G T 15: 60,918,074 (GRCm38) H442N possibly damaging Het
A2ml1 C G 6: 128,575,607 (GRCm38) V223L possibly damaging Het
A2ml1 G A 6: 128,561,616 (GRCm38) Q614* probably null Het
A2ml1 G T 6: 128,545,076 (GRCm38) P1261H probably benign Het
A530016L24Rik G T 12: 112,495,076 (GRCm38) G25W probably damaging Het
A530064D06Rik G A 17: 48,166,506 (GRCm38) S81F probably damaging Het
Abat G T 16: 8,603,753 (GRCm38) probably null Het
Abca1 C A 4: 53,079,584 (GRCm38) K881N probably benign Het
Abca1 C A 4: 53,080,799 (GRCm38) V837L probably benign Het
Abca1 C A 4: 53,086,133 (GRCm38) D457Y possibly damaging Het
Abca12 A T 1: 71,276,082 (GRCm38) F1893L possibly damaging Het
Abca12 C A 1: 71,282,811 (GRCm38) D1707Y probably damaging Het
Abca12 G T 1: 71,292,531 (GRCm38) L1287I probably damaging Het
Abca13 AGTGCCTTG AG 11: 9,314,545 (GRCm38) probably null Het
Abca14 G T 7: 120,317,987 (GRCm38) R1458S probably damaging Het
Abca3 CGGG CGGGG 17: 24,408,236 (GRCm38) probably null Het
Abca4 C A 3: 122,147,786 (GRCm38) H1634Q possibly damaging Het
Abca4 G T 3: 122,173,914 (GRCm38) M2204I probably benign Het
Abca5 C G 11: 110,279,328 (GRCm38) V1314L probably benign Het
Abcb11 C A 2: 69,329,269 (GRCm38) probably null Het
Abcb11 C A 2: 69,306,529 (GRCm38) G196V probably damaging Het
Abcb1a G T 5: 8,746,544 (GRCm38) Q1171H probably damaging Het
Abcb1b G T 5: 8,837,596 (GRCm38) M827I probably benign Het
Abcb4 C T 5: 8,939,906 (GRCm38) Q820* probably null Het
Abcb6 C T 1: 75,176,125 (GRCm38) G414D probably damaging Het
Abcc1 A C 16: 14,411,493 (GRCm38) Q363P probably damaging Het
Abcc10 C A 17: 46,307,062 (GRCm38) R1095L probably damaging Het
Abcc12 C A 8: 86,527,384 (GRCm38) A924S possibly damaging Het
Abcc2 T A 19: 43,803,734 (GRCm38) V318E probably benign Het
Abcc2 G T 19: 43,803,736 (GRCm38) V319L probably benign Het
Abcc2 G A 19: 43,823,100 (GRCm38) W1001* probably null Het
Abcc3 C A 11: 94,357,008 (GRCm38) G1220W probably damaging Het
Abcc8 C T 7: 46,154,509 (GRCm38) A414T probably benign Het
Abcc8 A T 7: 46,122,885 (GRCm38) H823Q probably benign Het
Abcc9 C A 6: 142,625,982 (GRCm38) G1140V probably benign Het
Abcc9 T A 6: 142,645,938 (GRCm38) Q788L probably null Het
Abcc9 T A 6: 142,594,758 (GRCm38) Q1485L probably damaging Het
Abce1 C A 8: 79,687,469 (GRCm38) V538F probably benign Het
Abcg1 C G 17: 31,106,166 (GRCm38) A322G probably benign Het
Abcg5 C A 17: 84,676,271 (GRCm38) E113D probably benign Het
Abcg8 A T 17: 84,692,006 (GRCm38) R178W possibly damaging Het
Abcg8 G T 17: 84,695,030 (GRCm38) E336* probably null Het
Abcg8 C A 17: 84,696,118 (GRCm38) P460T probably damaging Het
Abhd12 T A 2: 150,904,414 (GRCm38) K45M probably benign Het
Abhd16a G T 17: 35,102,475 (GRCm38) G516V probably damaging Het
Abhd16a G C 17: 35,099,001 (GRCm38) probably null Het
Abi2 G C 1: 60,437,165 (GRCm38) R132P probably damaging Het
Abl2 A T 1: 156,641,106 (GRCm38) R647W probably damaging Het
Abl2 CA C 1: 156,641,553 (GRCm38) probably null Het
Ablim2 GATCGGTCCTA GA 5: 35,841,293 (GRCm38) probably benign Het
Ablim2 C G 5: 35,824,043 (GRCm38) H232D probably damaging Het
Abtb2 G C 2: 103,711,196 (GRCm38) G815R probably damaging Het
Acad12 C T 5: 121,599,194 (GRCm38) probably null Het
Acads C A 5: 115,111,129 (GRCm38) A351S probably benign Het
Acan C T 7: 79,094,170 (GRCm38) P650S probably damaging Het
Acan A C 7: 79,111,354 (GRCm38) H1938P probably benign Het
Acan G A 7: 79,100,137 (GRCm38) G1552E probably damaging Het
Acap1 T A 11: 69,882,443 (GRCm38) T671S probably benign Het
Acap3 G T 4: 155,905,518 (GRCm38) G748C probably damaging Het
Acat3 G T 17: 12,934,883 (GRCm38) Q104K probably damaging Het
Accs C G 2: 93,848,153 (GRCm38) A19P probably benign Het
Ace C A 11: 105,988,134 (GRCm38) L1172M probably damaging Het
Acin1 C T 14: 54,642,750 (GRCm38) R1332Q unknown Het
Aco2 G T 15: 81,895,312 (GRCm38) A106S probably damaging Het
Aco2 T A 15: 81,895,310 (GRCm38) M105K probably damaging Het
Acot5 G T 12: 84,069,894 (GRCm38) R143L probably benign Het
Acox1 C A 11: 116,175,063 (GRCm38) Q503H probably benign Het
Acox1 C A 11: 116,183,545 (GRCm38) E117* probably null Het
Acox1 G T 11: 116,175,065 (GRCm38) Q503K probably benign Het
Acox2 G A 14: 8,256,852 (GRCm38) P4S probably benign Het
Acpp G T 9: 104,314,418 (GRCm38) P223H probably damaging Het
Acr G A 15: 89,569,879 (GRCm38) E140K possibly damaging Het
Acsbg1 C G 9: 54,621,966 (GRCm38) S321T possibly damaging Het
Acsbg1 C A 9: 54,614,934 (GRCm38) G499C probably damaging Het
Acsbg2 C A 17: 56,853,898 (GRCm38) G249W probably benign Het
Acsf3 G T 8: 122,779,964 (GRCm38) probably benign Het
Acsl6 G T 11: 54,320,172 (GRCm38) E24* probably null Het
Acsm1 C A 7: 119,662,278 (GRCm38) L573I probably benign Het
Acsm2 T A 7: 119,578,093 (GRCm38) L277Q probably damaging Het
Acsm4 C A 7: 119,711,371 (GRCm38) H494N probably damaging Het
Acss2 G T 2: 155,517,957 (GRCm38) probably benign Het
Acss3 G C 10: 107,004,777 (GRCm38) F374L probably damaging Het
Acta1 C A 8: 123,893,471 (GRCm38) probably null Het
Actc1 C A 2: 114,047,513 (GRCm38) E363* probably null Het
Actg1 G T 11: 120,348,109 (GRCm38) L52I probably benign Het
Actl9 G T 17: 33,433,113 (GRCm38) G49V probably damaging Het
Actn2 G T 13: 12,288,562 (GRCm38) L451M probably damaging Het
Actn4 T G 7: 28,919,049 (GRCm38) N62T probably damaging Het
Actr5 G A 2: 158,636,705 (GRCm38) V492I probably benign Het
Actr8 G T 14: 29,986,401 (GRCm38) W212L probably damaging Het
Actr8 G T 14: 29,987,242 (GRCm38) V268L probably damaging Het
Actrt3 A T 3: 30,598,003 (GRCm38) L314Q possibly damaging Het
Adam2 C T 14: 66,056,521 (GRCm38) A286T probably damaging Het
Adam26b G A 8: 43,521,422 (GRCm38) T181I probably benign Het
Adam26b G T 8: 43,520,698 (GRCm38) S422R probably benign Het
Adam28 C A 14: 68,626,784 (GRCm38) W523C probably damaging Het
Adam29 A G 8: 55,871,496 (GRCm38) I641T probably damaging Het
Adam30 A T 3: 98,160,979 (GRCm38) T43S probably damaging Het
Adam33 T A 2: 131,058,662 (GRCm38) H86L possibly damaging Het
Adam39 C A 8: 40,825,295 (GRCm38) T241K probably benign Het
Adamdec1 G T 14: 68,580,643 (GRCm38) T34K probably benign Het
Adamts10 G T 17: 33,545,594 (GRCm38) R696L probably damaging Het
Adamts10 G C 17: 33,545,429 (GRCm38) E676Q possibly damaging Het
Adamts12 G A 15: 11,317,324 (GRCm38) C1370Y probably damaging Het
Adamts12 G T 15: 11,336,383 (GRCm38) C1518F not run Het
Adamts14 C A 10: 61,198,843 (GRCm38) G1086C possibly damaging Het
Adamts15 G T 9: 30,902,491 (GRCm38) R793S probably damaging Het
Adamts19 G T 18: 58,890,374 (GRCm38) R280S possibly damaging Het
Adamts19 G T 18: 58,838,075 (GRCm38) G244C probably damaging Het
Adamts3 C T 5: 89,775,351 (GRCm38) V199I not run Het
Adamts3 G T 5: 89,707,864 (GRCm38) C382* probably null Het
Adamts5 C A 16: 85,870,074 (GRCm38) G510V probably damaging Het
Adamts9 C A 6: 92,854,346 (GRCm38) G1342V probably damaging Het
Adarb2 C T 13: 8,570,200 (GRCm38) P241S probably benign Het
Adck2 C T 6: 39,574,088 (GRCm38) probably benign Het
Adcy1 G T 11: 7,100,642 (GRCm38) E287* probably null Het
Adcy1 A T 11: 7,144,802 (GRCm38) Q576L probably damaging Het
Adcy10 C A 1: 165,510,276 (GRCm38) T153N possibly damaging Het
Adcy5 G A 16: 35,291,544 (GRCm38) V924M not run Het
Adcy8 G T 15: 64,699,177 (GRCm38) P1236T probably benign Het
Adgrb1 G T 15: 74,547,683 (GRCm38) W791L probably damaging Het
Adgrb1 G T 15: 74,541,676 (GRCm38) G570C probably damaging Het
Adgrb2 G T 4: 130,011,826 (GRCm38) D822Y probably damaging Het
Adgrb2 G C 4: 130,019,119 (GRCm38) G1313R probably damaging Het
Adgre1 G T 17: 57,419,374 (GRCm38) C415F probably damaging Het
Adgre4 A T 17: 55,814,152 (GRCm38) probably null Het
Adgrf1 G C 17: 43,310,147 (GRCm38) G425A probably benign Het
Adgrf5 C T 17: 43,445,053 (GRCm38) P634L probably benign Het
Adgrg1 T A 8: 95,007,630 (GRCm38) C377S probably damaging Het
Adgrv1 C G 13: 81,419,256 (GRCm38) W5266S possibly damaging Het
Adipor2 C A 6: 119,357,322 (GRCm38) G309V possibly damaging Het
Adora1 G A 1: 134,234,228 (GRCm38) A43V possibly damaging Het
Adora1 G C 1: 134,234,124 (GRCm38) H78D possibly damaging Het
Adora1 C A 1: 134,203,009 (GRCm38) R308L probably benign Het
Adora2b G A 11: 62,249,426 (GRCm38) V109I probably benign Het
Adora3 G T 3: 105,907,785 (GRCm38) A284S probably damaging Het
Adprhl1 G C 8: 13,245,476 (GRCm38) H212Q possibly damaging Het
Adrm1 A T 2: 180,174,915 (GRCm38) S198C unknown Het
Adrm1 G T 2: 180,175,372 (GRCm38) G279V possibly damaging Het
Aebp2 G T 6: 140,624,094 (GRCm38) A134S unknown Het
Aen G C 7: 78,902,766 (GRCm38) R158P possibly damaging Het
AF529169 G T 9: 89,603,162 (GRCm38) P61T probably damaging Het
Afap1l1 C A 18: 61,752,508 (GRCm38) probably null Het
Aff1 G T 5: 103,783,753 (GRCm38) R79L possibly damaging Het
Afm C A 5: 90,551,383 (GRCm38) T562K possibly damaging Het
Afm C A 5: 90,531,616 (GRCm38) P323Q probably damaging Het
Afm C A 5: 90,531,506 (GRCm38) N286K probably benign Het
Afm C A 5: 90,521,946 (GRCm38) T44K probably benign Het
Agbl1 C A 7: 76,720,206 (GRCm38) S936R unknown Het
Agbl3 T G 6: 34,799,408 (GRCm38) F283C probably damaging Het
Agl T A 3: 116,781,036 (GRCm38) I40F Het
Agmat C A 4: 141,746,979 (GRCm38) P57Q possibly damaging Het
Ago1 C A 4: 126,453,656 (GRCm38) W433C probably damaging Het
Agrn C G 4: 156,179,576 (GRCm38) V184L possibly damaging Het
Agrn C A 4: 156,171,544 (GRCm38) E1447* probably null Het
Ahctf1 C G 1: 179,793,730 (GRCm38) A157P probably damaging Het
Ahcyl1 C T 3: 107,673,435 (GRCm38) probably null Het
Ahi1 G T 10: 21,041,007 (GRCm38) probably benign Het
Ahnak G T 19: 9,017,468 (GRCm38) G5372V probably damaging Het
Ahnak2 C A 12: 112,781,199 (GRCm38) G1676V Het
Ahrr T G 13: 74,224,776 (GRCm38) H185P probably benign Het
Ahsg C A 16: 22,899,047 (GRCm38) P337Q probably damaging Het
AI182371 A C 2: 35,095,759 (GRCm38) probably null Het
AI314180 C A 4: 58,861,614 (GRCm38) D322Y probably damaging Het
AI413582 G T 17: 27,564,645 (GRCm38) P10T probably benign Het
AI593442 G T 9: 52,677,912 (GRCm38) P122T possibly damaging Het
AI597479 G T 1: 43,111,119 (GRCm38) A130S probably benign Het
Aifm3 G T 16: 17,500,934 (GRCm38) G206C probably benign Het
Aifm3 G T 16: 17,503,720 (GRCm38) R479L probably benign Het
Ajap1 C A 4: 153,432,436 (GRCm38) Q149H probably damaging Het
Ajap1 C A 4: 153,432,435 (GRCm38) G150C probably benign Het
Akap13 G C 7: 75,615,005 (GRCm38) G532A probably benign Het
Akap2 G A 4: 57,856,348 (GRCm38) G559E probably damaging Het
Akap9 A T 5: 4,046,189 (GRCm38) N2355Y probably damaging Het
Akp3 G T 1: 87,126,445 (GRCm38) probably null Het
Akr1c12 G C 13: 4,272,954 (GRCm38) L219V probably damaging Het
Akr1c20 G T 13: 4,523,244 (GRCm38) S24Y probably benign Het
Alb A T 5: 90,468,512 (GRCm38) Q292L probably damaging Het
Aldh16a1 C A 7: 45,145,903 (GRCm38) G444V probably null Het
Aldh1a2 T A 9: 71,283,522 (GRCm38) V349E probably benign Het
Aldh1b1 G C 4: 45,802,692 (GRCm38) D77H probably damaging Het
Aldh1l1 C A 6: 90,564,449 (GRCm38) A275E probably benign Het
Aldh1l2 G T 10: 83,493,480 (GRCm38) A822D probably damaging Het
Aldh1l2 G A 10: 83,534,005 (GRCm38) R4W probably benign Het
Aldh5a1 C G 13: 24,911,638 (GRCm38) G499R probably damaging Het
Aldh7a1 T A 18: 56,526,991 (GRCm38) T528S probably benign Het
Alg1 G C 16: 5,239,967 (GRCm38) G268R probably benign Het
Alg8 G T 7: 97,371,662 (GRCm38) A9S probably benign Het
Alg9 G C 9: 50,788,173 (GRCm38) G166A probably damaging Het
Alk G T 17: 72,603,063 (GRCm38) S216Y probably damaging Het
Alox12 C A 11: 70,251,479 (GRCm38) G308C possibly damaging Het
Alox8 G A 11: 69,185,221 (GRCm38) R635W probably damaging Het
Alpk1 C A 3: 127,685,307 (GRCm38) W30C Het
Als2cl C A 9: 110,895,817 (GRCm38) Y786* probably null Het
Als2cl G A 9: 110,888,528 (GRCm38) G279S probably benign Het
Alx3 C A 3: 107,604,834 (GRCm38) P263T probably damaging Het
Alx4 G T 2: 93,642,656 (GRCm38) probably benign Het
Ambra1 C A 2: 91,900,608 (GRCm38) N1030K possibly damaging Het
Ambra1 G T 2: 91,875,786 (GRCm38) W865C probably damaging Het
Ambra1 G T 2: 91,768,999 (GRCm38) A155S possibly damaging Het
Amer3 C A 1: 34,587,196 (GRCm38) S172* probably null Het
Amh G C 10: 80,807,586 (GRCm38) E535Q possibly damaging Het
Amot C A X: 145,480,458 (GRCm38) R110S Het
Ampd3 A T 7: 110,788,780 (GRCm38) Q131L probably damaging Het
Amph G C 13: 19,139,334 (GRCm38) D589H possibly damaging Het
Amy1 A T 3: 113,558,353 (GRCm38) W397R probably damaging Het
Amy2a1 C A 3: 113,530,532 (GRCm38) A120S not run Het
Anapc15 G T 7: 101,901,039 (GRCm38) E153D unknown Het
Angptl6 C A 9: 20,878,411 (GRCm38) G62C probably damaging Het
Ank2 T C 3: 126,944,357 (GRCm38) Q2626R unknown Het
Ankk1 G T 9: 49,416,487 (GRCm38) A464E probably damaging Het
Ankk1 C A 9: 49,415,944 (GRCm38) G645V probably damaging Het
Ankra2 G T 13: 98,272,277 (GRCm38) V263L possibly damaging Het
Ankrd11 C A 8: 122,900,142 (GRCm38) Q100H probably damaging Het
Ankrd17 C A 5: 90,283,505 (GRCm38) A807S possibly damaging Het
Ankrd17 C T 5: 90,289,325 (GRCm38) A554T possibly damaging Het
Ankrd2 A G 19: 42,040,159 (GRCm38) I85V Het
Ankrd2 G T 19: 42,044,999 (GRCm38) A327S Het
Ankrd22 CT CTT 19: 34,123,491 (GRCm38) probably null Het
Ankrd26 C A 6: 118,523,532 (GRCm38) A993S possibly damaging Het
Ankrd26 C T 6: 118,523,595 (GRCm38) E972K probably damaging Het
Ankrd27 G T 7: 35,603,878 (GRCm38) V228L possibly damaging Het
Ankrd33b C A 15: 31,305,133 (GRCm38) probably null Het
Ankrd35 G T 3: 96,683,770 (GRCm38) Q457H probably damaging Het
Ankrd36 C A 11: 5,643,738 (GRCm38) P448T probably damaging Het
Ankrd36 G A 11: 5,629,345 (GRCm38) S203N probably benign Het
Ankrd36 G T 11: 5,571,117 (GRCm38) W88C probably damaging Het
Ankrd45 G T 1: 161,160,752 (GRCm38) K193N possibly damaging Het
Ankrd45 G T 1: 161,160,738 (GRCm38) G189W probably damaging Het
Ankrd50 C G 3: 38,455,792 (GRCm38) A809P probably damaging Het
Ankrd53 C G 6: 83,765,783 (GRCm38) L253V possibly damaging Het
Ankrd7 G A 6: 18,866,564 (GRCm38) A28T possibly damaging Het
Ano2 G T 6: 126,013,207 (GRCm38) A764S probably damaging Het
Ano2 G A 6: 126,015,647 (GRCm38) G861E probably damaging Het
Ano7 C A 1: 93,401,527 (GRCm38) A681E probably damaging Het
Antxrl TC T 14: 34,067,930 (GRCm38) probably null Het
Anxa11 G T 14: 25,870,176 (GRCm38) G55C unknown Het
Aox2 C A 1: 58,354,397 (GRCm38) P1239T possibly damaging Het
Ap1s1 C A 5: 137,045,233 (GRCm38) probably benign Het
Ap2b1 G T 11: 83,365,753 (GRCm38) G713V probably damaging Het
Ap3m2 C T 8: 22,791,321 (GRCm38) S312N probably benign Het
Ap5b1 G T 19: 5,570,928 (GRCm38) G792V probably damaging Het
Apba2 G T 7: 64,750,235 (GRCm38) V725L probably benign Het
Apbb1ip G T 2: 22,875,103 (GRCm38) A599S unknown Het
Apc G T 18: 34,314,463 (GRCm38) V1471L probably benign Het
Apc2 C A 10: 80,312,036 (GRCm38) R975S probably damaging Het
Apcdd1 G T 18: 62,922,691 (GRCm38) G10* probably null Het
Aplp1 T A 7: 30,438,279 (GRCm38) probably null Het
Aplp1 C A 7: 30,438,189 (GRCm38) R482L probably benign Het
Apoa5 G A 9: 46,269,119 (GRCm38) A8T possibly damaging Het
Apob C A 12: 7,988,765 (GRCm38) L406I probably benign Het
Apob GCC GC 12: 8,015,249 (GRCm38) probably null Het
Apobec4 G T 1: 152,756,726 (GRCm38) W168C probably damaging Het
Apod C T 16: 31,297,520 (GRCm38) V131M probably damaging Het
Apol11b A C 15: 77,638,007 (GRCm38) I30R probably benign Het
Aqp4 C G 18: 15,399,881 (GRCm38) G52R possibly damaging Het
Arcn1 C G 9: 44,757,253 (GRCm38) G229R probably damaging Het
Arf6 G T 12: 69,372,407 (GRCm38) probably benign Het
Arfgap2 C T 2: 91,275,104 (GRCm38) S468L probably benign Het
Arfgap3 C A 15: 83,332,688 (GRCm38) E159* probably null Het
Arfgef3 C A 10: 18,627,628 (GRCm38) V1010L probably damaging Het
Arfgef3 A C 10: 18,607,776 (GRCm38) I1400S probably damaging Het
Arhgap20 C A 9: 51,824,924 (GRCm38) L179I probably damaging Het
Arhgap30 A C 1: 171,407,908 (GRCm38) K617Q probably benign Het
Arhgap32 G T 9: 32,260,680 (GRCm38) Q1585H probably damaging Het
Arhgap33 C G 7: 30,522,817 (GRCm38) R1230P probably damaging Het
Arhgef10l C A 4: 140,516,772 (GRCm38) R852L probably benign Het
Arhgef16 G T 4: 154,281,453 (GRCm38) S501Y probably damaging Het
Arhgef26 C A 3: 62,339,930 (GRCm38) T145N probably benign Het
Arhgef28 C A 13: 97,899,756 (GRCm38) G1665V probably benign Het
Arhgef33 G T 17: 80,384,230 (GRCm38) G50V unknown Het
Arhgef38 C A 3: 133,206,961 (GRCm38) E106* probably null Het
Arhgef4 C G 1: 34,724,259 (GRCm38) S865R probably benign Het
Arhgef4 A G 1: 34,723,366 (GRCm38) S568G unknown Het
Arhgef4 C G 1: 34,722,921 (GRCm38) S419R unknown Het
Arhgef6 C A X: 57,304,624 (GRCm38) probably benign Het
Arid1a C A 4: 133,680,916 (GRCm38) W1708C unknown Het
Arid1b G T 17: 4,996,328 (GRCm38) A464S possibly damaging Het
Arid2 A C 15: 96,390,986 (GRCm38) Q1672P probably damaging Het
Arid3a A C 10: 79,949,430 (GRCm38) Q344P probably damaging Het
Arid3c C A 4: 41,730,177 (GRCm38) R6M possibly damaging Het
Arid4a G A 12: 71,075,637 (GRCm38) E931K possibly damaging Het
Arid5b C T 10: 68,097,228 (GRCm38) R948Q probably damaging Het
Arl11 CA CAA 14: 61,310,868 (GRCm38) probably null Het
Armc1 G T 3: 19,149,574 (GRCm38) L63I probably benign Het
Armc3 C A 2: 19,285,991 (GRCm38) T427K probably benign Het
Armc5 G T 7: 128,244,663 (GRCm38) R876L probably damaging Het
Armc5 G T 7: 128,240,625 (GRCm38) G372C probably damaging Het
Armc5 C A 7: 128,240,830 (GRCm38) T440N probably damaging Het
Armc8 C T 9: 99,497,386 (GRCm38) A496T probably damaging Het
Armc9 G C 1: 86,176,825 (GRCm38) E265D probably damaging Het
Armc9 G C 1: 86,196,355 (GRCm38) R417P probably benign Het
Armcx4 C A X: 134,693,042 (GRCm38) A1233D not run Het
Armcx6 C A X: 134,749,992 (GRCm38) G30V probably damaging Het
Arnt2 G A 7: 84,263,207 (GRCm38) T575I possibly damaging Het
Arsj G T 3: 126,438,909 (GRCm38) G435C probably damaging Het
Art3 C G 5: 92,412,206 (GRCm38) L75V unknown Het
Art4 G T 6: 136,849,583 (GRCm38) P299T probably damaging Het
Arvcf T A 16: 18,389,299 (GRCm38) L41Q probably damaging Het
Asb14 T C 14: 26,912,299 (GRCm38) V487A probably benign Het
Asb3 C G 11: 31,058,965 (GRCm38) P250A possibly damaging Het
Ascc3 A T 10: 50,718,421 (GRCm38) H1204L probably benign Het
Asic2 G A 11: 81,152,240 (GRCm38) R76C possibly damaging Het
Asic2 G T 11: 81,152,090 (GRCm38) R126S probably benign Het
Asic2 G C 11: 80,894,011 (GRCm38) I367M possibly damaging Het
Asic4 A T 1: 75,469,220 (GRCm38) Q231L probably benign Het
Aspdh G T 7: 44,465,530 (GRCm38) R20L probably damaging Het
Aspg G A 12: 112,121,021 (GRCm38) V304M probably damaging Het
Asprv1 C A 6: 86,628,344 (GRCm38) S57R probably damaging Het
Asxl2 A C 12: 3,474,589 (GRCm38) S206R probably damaging Het
Asxl3 C G 18: 22,523,591 (GRCm38) R1553G probably damaging Het
Asxl3 G T 18: 22,516,339 (GRCm38) V462L probably benign Het
Atf7ip2 A T 16: 10,241,640 (GRCm38) Q348L possibly damaging Het
Atg2b C A 12: 105,635,764 (GRCm38) R1651L probably damaging Het
Atg9b C T 5: 24,391,787 (GRCm38) G44R probably benign Het
Atl3 G T 19: 7,530,553 (GRCm38) A357S probably benign Het
Atn1 C A 6: 124,745,035 (GRCm38) G952C unknown Het
Atoh8 C A 6: 72,235,126 (GRCm38) K13N probably damaging Het
Atp10b G C 11: 43,153,349 (GRCm38) G134A probably benign Het
Atp11b G T 3: 35,806,854 (GRCm38) M363I probably benign Het
Atp12a C A 14: 56,373,215 (GRCm38) T272K probably damaging Het
Atp13a5 C A 16: 29,280,969 (GRCm38) W761C probably damaging Het
Atp1a2 G T 1: 172,287,336 (GRCm38) T294K probably damaging Het
Atp1a3 C A 7: 24,980,119 (GRCm38) V904L probably benign Het
Atp1b3 C A 9: 96,333,560 (GRCm38) L267F probably damaging Het
Atp2a3 C G 11: 72,980,327 (GRCm38) S582R possibly damaging Het
Atp2b1 G T 10: 99,018,848 (GRCm38) R1101L probably damaging Het
Atp2c2 C A 8: 119,734,385 (GRCm38) T239N probably benign Het
Atp4a G T 7: 30,717,840 (GRCm38) Q549H possibly damaging Het
Atp4b GGTTCCAACAGTAGT GGT 8: 13,396,684 (GRCm38) probably benign Het
Atp4b C A 8: 13,389,794 (GRCm38) A143S probably benign Het
Atp5s G A 12: 69,740,962 (GRCm38) probably benign Het
Atp7b C A 8: 21,994,877 (GRCm38) R1388L probably benign Het
Atp8a2 C A 14: 60,006,330 (GRCm38) R642L possibly damaging Het
Atp8b3 A T 10: 80,531,077 (GRCm38) V229E probably benign Het
Atp8b4 T A 2: 126,322,824 (GRCm38) T1191S probably benign Het
Atp8b4 A T 2: 126,433,943 (GRCm38) L123Q probably damaging Het
Atp8b5 T A 4: 43,370,669 (GRCm38) L982I probably benign Het
Atr A T 9: 95,888,100 (GRCm38) R1194S probably benign Het
Atrn G T 2: 130,946,042 (GRCm38) G255C probably damaging Het
Atxn7l3b T A 10: 112,928,454 (GRCm38) Q90L possibly damaging Het
Atxn7l3b C G 10: 112,928,479 (GRCm38) G82R probably damaging Het
AU040320 G C 4: 126,842,633 (GRCm38) Q836H probably benign Het
Aup1 A G 6: 83,057,524 (GRCm38) E437G unknown Het
Axin2 G T 11: 108,923,474 (GRCm38) G63W probably damaging Het
Axl C A 7: 25,761,526 (GRCm38) G686V probably damaging Het
B020004C17Rik C T 14: 57,015,260 (GRCm38) Q2* probably null Het
B230359F08Rik G A 14: 53,795,507 (GRCm38) probably benign Het
B3galt1 G T 2: 68,117,990 (GRCm38) W16C probably damaging Het
B3galt4 C A 17: 33,951,136 (GRCm38) A43S unknown Het
B3galt5 C A 16: 96,315,379 (GRCm38) R71S probably damaging Het
B3galt5 G C 16: 96,316,032 (GRCm38) Q288H probably benign Het
B3gntl1 C T 11: 121,639,814 (GRCm38) D144N probably benign Het
B4galt2 C A 4: 117,881,069 (GRCm38) M113I probably benign Het
Babam1 G T 8: 71,399,563 (GRCm38) V132F probably benign Het
Bag6 A C 17: 35,142,924 (GRCm38) Q510P unknown Het
Bahcc1 G A 11: 120,272,921 (GRCm38) V682M possibly damaging Het
Baz2b C G 2: 59,977,520 (GRCm38) A132P probably benign Het
Bbox1 C A 2: 110,270,188 (GRCm38) K221N probably benign Het
Bbs5 G A 2: 69,665,071 (GRCm38) V288M probably benign Het
Bbs7 C T 3: 36,602,920 (GRCm38) G253E probably damaging Het
BC016579 C A 16: 45,648,896 (GRCm38) V70F possibly damaging Het
BC027072 C A 17: 71,750,403 (GRCm38) G760W probably damaging Het
BC049762 G C 11: 51,253,968 (GRCm38) A106G probably benign Het
BC051019 G T 7: 109,720,640 (GRCm38) P72Q probably benign Het
BC055324 T A 1: 163,964,517 (GRCm38) R611W probably damaging Het
Bcam C A 7: 19,760,107 (GRCm38) A420S probably null Het
Bcar3 G C 3: 122,505,018 (GRCm38) R144P probably damaging Het
Bcl11b C A 12: 107,989,740 (GRCm38) G50V probably damaging Het
Bcl2a1a G T 9: 88,957,466 (GRCm38) G139V probably damaging Het
Bcl2a1c A C 9: 114,330,468 (GRCm38) T105P probably benign Het
Bcl2l11 C G 2: 128,128,995 (GRCm38) N121K probably damaging Het
Bcl2l11 G T 2: 128,147,193 (GRCm38) R164M probably damaging Het
Bdh1 C T 16: 31,455,175 (GRCm38) A186V possibly damaging Het
Bdh1 A G 16: 31,455,177 (GRCm38) K187E possibly damaging Het
Bdp1 T A 13: 100,061,396 (GRCm38) K827M probably damaging Het
Best1 G C 19: 9,993,239 (GRCm38) S79C probably damaging Het
Bfar G T 16: 13,688,810 (GRCm38) V175L probably benign Het
Bid C T 6: 120,900,258 (GRCm38) E41K probably damaging Het
Birc6 G T 17: 74,647,280 (GRCm38) A3376S probably benign Het
Bmp2k G T 5: 97,053,156 (GRCm38) A312S probably damaging Het
Bmpr2 G A 1: 59,847,167 (GRCm38) R321Q not run Het
Bnc1 C A 7: 81,968,470 (GRCm38) R949L probably damaging Het
Bpifa3 C G 2: 154,136,292 (GRCm38) T138R possibly damaging Het
Bpifb3 C T 2: 153,925,789 (GRCm38) P261S probably benign Het
Bpnt1 G A 1: 185,352,269 (GRCm38) G188R probably damaging Het
Brd2 C A 17: 34,116,907 (GRCm38) probably null Het
Brd2 C A 17: 34,116,908 (GRCm38) probably benign Het
Brinp2 C A 1: 158,246,782 (GRCm38) V590L possibly damaging Het
Brpf3 G T 17: 28,821,478 (GRCm38) D958Y probably benign Het
Brsk1 G C 7: 4,704,222 (GRCm38) C258S probably damaging Het
Bsn G C 9: 108,139,195 (GRCm38) L206V probably damaging Het
Bsn C T 9: 108,105,499 (GRCm38) R913H Het
Bst1 C A 5: 43,819,032 (GRCm38) P36T probably damaging Het
Btbd10 C G 7: 113,332,689 (GRCm38) V169L probably benign Het
Btbd18 G T 2: 84,661,568 (GRCm38) G31V probably damaging Het
Btbd7 C T 12: 102,811,120 (GRCm38) E483K probably damaging Het
Btla C A 16: 45,239,272 (GRCm38) P113Q possibly damaging Het
Btnl2 G T 17: 34,363,519 (GRCm38) R353L probably benign Het
Btnl4 C A 17: 34,470,060 (GRCm38) probably null Het
Bud13 G C 9: 46,291,740 (GRCm38) R487P probably damaging Het
C1qb C A 4: 136,882,281 (GRCm38) W9C probably benign Het
C1qtnf1 G C 11: 118,443,754 (GRCm38) W20S probably benign Het
C1qtnf12 G T 4: 155,965,649 (GRCm38) R202L probably damaging Het
C1qtnf4 G T 2: 90,889,505 (GRCm38) G41C probably damaging Het
C1s2 G T 6: 124,625,734 (GRCm38) A506D possibly damaging Het
C2cd4b C G 9: 67,759,799 (GRCm38) P26A probably damaging Het
C2cd5 C A 6: 143,029,206 (GRCm38) E820D probably null Het
C3 G A 17: 57,217,144 (GRCm38) A964V probably benign Het
C3 G T 17: 57,226,171 (GRCm38) S144Y probably damaging Het
C7 C T 15: 5,015,375 (GRCm38) D394N probably benign Het
C9 C A 15: 6,491,519 (GRCm38) P482T probably damaging Het
Cabin1 C T 10: 75,648,123 (GRCm38) A2043T probably benign Het
Cables1 G T 18: 11,941,317 (GRCm38) G525V probably damaging Het
Cabp4 G T 19: 4,136,222 (GRCm38) L227M probably damaging Het
Cacna1a C A 8: 84,579,491 (GRCm38) D1289E probably damaging Het
Cacna1b T G 2: 24,638,677 (GRCm38) M1609L probably damaging Het
Cacna1b G T 2: 24,661,790 (GRCm38) P1115H probably damaging Het
Cacna1b G T 2: 24,678,988 (GRCm38) H975N probably damaging Het
Cacna1c G T 6: 118,757,661 (GRCm38) probably benign Het
Cacna1e G T 1: 154,442,292 (GRCm38) A1448E probably damaging Het
Cacna1g C A 11: 94,473,590 (GRCm38) A10S probably benign Het
Cacna1g C A 11: 94,459,596 (GRCm38) Q474H probably benign Het
Cacna1h C A 17: 25,375,892 (GRCm38) E2097D probably damaging Het
Cacna1h T A 17: 25,391,378 (GRCm38) E718V probably damaging Het
Cacna1h C A 17: 25,393,584 (GRCm38) W380L probably benign Het
Cacna1i G T 15: 80,389,383 (GRCm38) G1757C possibly damaging Het
Cacna1i G T 15: 80,381,179 (GRCm38) R1544L possibly damaging Het
Cacna1s G C 1: 136,117,686 (GRCm38) A1691P probably benign Het
Cacna2d3 A C 14: 29,347,163 (GRCm38) D232E possibly damaging Het
Cad G T 5: 31,075,128 (GRCm38) D1846Y probably benign Het
Cad G T 5: 31,068,421 (GRCm38) G1017V probably damaging Het
Cadps C G 14: 12,465,880 (GRCm38) R1010P probably damaging Het
Cadps2 A T 6: 23,385,478 (GRCm38) L782I possibly damaging Het
Cadps2 C G 6: 23,626,695 (GRCm38) S198T probably damaging Het
Cadps2 G T 6: 23,838,818 (GRCm38) P107H probably damaging Het
Calcb G T 7: 114,722,162 (GRCm38) probably null Het
Calm4 G C 13: 3,838,199 (GRCm38) V102L possibly damaging Het
Calml3 C A 13: 3,804,011 (GRCm38) D18Y probably damaging Het
Caln1 C A 5: 130,839,314 (GRCm38) C230* probably null Het
Calr4 G T 4: 109,235,733 (GRCm38) W3C probably benign Het
Calu G T 6: 29,372,515 (GRCm38) V230L probably damaging Het
Camta1 A T 4: 151,077,925 (GRCm38) L454Q probably damaging Het
Camta2 C A 11: 70,675,221 (GRCm38) G746* probably null Het
Capg G A 6: 72,556,230 (GRCm38) C166Y probably damaging Het
Capn12 T A 7: 28,887,828 (GRCm38) W380R probably damaging Het
Capn15 T A 17: 25,973,220 (GRCm38) H16L probably benign Het
Capn8 G T 1: 182,613,346 (GRCm38) E448D probably benign Het
Caprin1 C G 2: 103,775,934 (GRCm38) E320D probably null Het
Car12 C A 9: 66,751,954 (GRCm38) P39Q probably benign Het
Car3 G T 3: 14,871,636 (GRCm38) R253M Het
Car4 C G 11: 84,963,419 (GRCm38) P64R possibly damaging Het
Car5a C T 8: 121,916,373 (GRCm38) M297I probably benign Het
Car8 G C 4: 8,221,594 (GRCm38) R126G probably damaging Het
Card10 G T 15: 78,795,328 (GRCm38) P307T probably benign Het
Card11 T A 5: 140,898,241 (GRCm38) I428F probably benign Het
Card14 C A 11: 119,341,061 (GRCm38) H818Q probably damaging Het
Card9 G C 2: 26,357,551 (GRCm38) R241G probably damaging Het
Carf A C 1: 60,136,262 (GRCm38) probably null Het
Casd1 G T 6: 4,631,531 (GRCm38) W549L possibly damaging Het
Caskin1 T A 17: 24,496,687 (GRCm38) C142S probably damaging Het
Caskin2 C T 11: 115,806,781 (GRCm38) A110T possibly damaging Het
Cass4 C T 2: 172,427,575 (GRCm38) Q526* probably null Het
Cast C A 13: 74,725,463 (GRCm38) K402N probably damaging Het
Casz1 T C 4: 148,944,359 (GRCm38) L1087P probably benign Het
Casz1 C A 4: 148,933,306 (GRCm38) P351T probably damaging Het
Catsper1 A T 19: 5,343,883 (GRCm38) Q641L probably damaging Het
Catsperb G C 12: 101,446,048 (GRCm38) W131C probably damaging Het
Catspere2 G T 1: 178,156,802 (GRCm38) probably benign Het
Catsperg2 A T 7: 29,697,782 (GRCm38) W1099R possibly damaging Het
Cbarp G C 10: 80,131,872 (GRCm38) R512G probably damaging Het
Cbarp G T 10: 80,133,060 (GRCm38) P367T probably damaging Het
Cbfa2t3 G A 8: 122,630,757 (GRCm38) P605S probably benign Het
Cblc T G 7: 19,785,278 (GRCm38) D419A probably benign Het
Cbr2 G C 11: 120,730,279 (GRCm38) A164G possibly damaging Het
Cbs C G 17: 31,625,882 (GRCm38) probably null Het
Cbx4 C T 11: 119,085,766 (GRCm38) W35* probably null Het
Cbx7 G T 15: 79,933,884 (GRCm38) L6M unknown Het
Cc2d2a C T 5: 43,703,204 (GRCm38) P541S probably benign Het
Ccdc121 G A 1: 181,510,739 (GRCm38) T216M probably damaging Het
Ccdc129 G T 6: 55,968,234 (GRCm38) G647C probably damaging Het
Ccdc14 G C 16: 34,723,670 (GRCm38) K847N probably damaging Het
Ccdc141 G T 2: 77,015,149 (GRCm38) S1191R probably benign Het
Ccdc157 G A 11: 4,146,547 (GRCm38) Q503* probably null Het
Ccdc162 G T 10: 41,683,195 (GRCm38) A136D probably benign Het
Ccdc170 A C 10: 4,509,884 (GRCm38) T5P probably benign Het
Ccdc177 G T 12: 80,757,736 (GRCm38) A588E unknown Het
Ccdc178 G T 18: 22,109,731 (GRCm38) R276S possibly damaging Het
Ccdc185 G T 1: 182,748,514 (GRCm38) N203K possibly damaging Het
Ccdc191 G C 16: 43,939,122 (GRCm38) E429Q possibly damaging Het
Ccdc25 A T 14: 65,865,128 (GRCm38) probably null Het
Ccdc27 C A 4: 154,036,471 (GRCm38) M289I unknown Het
Ccdc33 G T 9: 58,118,585 (GRCm38) Q54K possibly damaging Het
Ccdc38 C A 10: 93,562,876 (GRCm38) S172Y probably damaging Het
Ccdc40 C G 11: 119,238,107 (GRCm38) R390G probably damaging Het
Ccdc40 C T 11: 119,254,398 (GRCm38) S973L probably benign Het
Ccdc60 C A 5: 116,288,709 (GRCm38) probably benign Het
Ccdc68 G T 18: 69,947,050 (GRCm38) probably null Het
Ccdc71l G C 12: 32,379,615 (GRCm38) R211P possibly damaging Het
Ccdc73 C A 2: 104,992,239 (GRCm38) C16* probably null Het
Ccdc7a C A 8: 128,807,924 (GRCm38) R1357L possibly damaging Het
Ccdc81 T A 7: 89,881,657 (GRCm38) Q359L probably damaging Het
Ccdc85a C A 11: 28,583,491 (GRCm38) A18S probably benign Het
Ccdc88c G T 12: 100,945,155 (GRCm38) H807N probably benign Het
Ccdc90b G A 7: 92,568,557 (GRCm38) M102I possibly damaging Het
Cchcr1 G T 17: 35,528,663 (GRCm38) Q532H probably damaging Het
Ccin G T 4: 43,984,902 (GRCm38) K436N probably benign Het
Ccl17 G T 8: 94,811,189 (GRCm38) R35L possibly damaging Het
Ccna2 C A 3: 36,571,701 (GRCm38) Q41H probably benign Het
Ccnt2 G T 1: 127,803,058 (GRCm38) K557N probably damaging Het
Ccny T G 18: 9,353,494 (GRCm38) Q93P probably benign Het
Ccr4 C G 9: 114,492,839 (GRCm38) G53R probably damaging Het
Ccr8 C G 9: 120,094,499 (GRCm38) L227V probably benign Het
Cct7 G T 6: 85,466,669 (GRCm38) D340Y possibly damaging Het
Cd101 G T 3: 101,017,140 (GRCm38) Q328K probably benign Het
Cd101 A C 3: 101,011,916 (GRCm38) D627E probably benign Het
Cd109 G T 9: 78,691,313 (GRCm38) Q944H probably damaging Het
Cd163 G A 6: 124,317,385 (GRCm38) V501I probably benign Het
Cd177 C A 7: 24,760,256 (GRCm38) G11W probably damaging Het
Cd180 C A 13: 102,706,032 (GRCm38) H529N possibly damaging Het
Cd2 G C 3: 101,276,106 (GRCm38) R296G probably damaging Het
Cd200 C A 16: 45,394,688 (GRCm38) R200L possibly damaging Het
Cd209e T A 8: 3,851,181 (GRCm38) S158C probably null Het
Cd244 T A 1: 171,574,350 (GRCm38) C215S probably damaging Het
Cd248 G C 19: 5,069,165 (GRCm38) G347A probably damaging Het
Cd6 G C 19: 10,791,445 (GRCm38) R503G probably damaging Het
Cd8a G T 6: 71,374,593 (GRCm38) R179L possibly damaging Het
Cdc42bpg A T 19: 6,309,746 (GRCm38) E119V probably damaging Het
Cdc42bpg C A 19: 6,314,522 (GRCm38) N593K possibly damaging Het
Cdc42bpg G A 19: 6,314,523 (GRCm38) G594S probably damaging Het
Cdc42ep2 C A 19: 5,918,108 (GRCm38) D190Y probably damaging Het
Cdc42ep2 G A 19: 5,918,645 (GRCm38) R11C probably damaging Het
Cdc42ep3 C A 17: 79,334,898 (GRCm38) D198Y probably damaging Het
Cdc42ep3 C A 17: 79,334,878 (GRCm38) M204I probably benign Het
Cdca2 C A 14: 67,680,244 (GRCm38) K568N probably damaging Het
Cdh1 G A 8: 106,656,839 (GRCm38) V237M probably damaging Het
Cdh16 T G 8: 104,623,440 (GRCm38) probably null Het
Cdh22 C A 2: 165,146,680 (GRCm38) G252C probably damaging Het
Cdh23 C A 10: 60,323,555 (GRCm38) R2149L possibly damaging Het
Cdh23 T A 10: 60,434,614 (GRCm38) probably null Het
Cdh4 C A 2: 179,780,326 (GRCm38) A81E probably benign Het
Cdh9 C T 15: 16,850,364 (GRCm38) P528S probably benign Het
Cdhr2 C A 13: 54,715,671 (GRCm38) P122T probably damaging Het
Cdhr2 G T 13: 54,718,564 (GRCm38) C361F probably damaging Het
Cdhr2 A T 13: 54,726,408 (GRCm38) R764S probably benign Het
Cdipt A T 7: 126,976,944 (GRCm38) I24F probably benign Het
Cdk14 C A 5: 4,888,894 (GRCm38) G461W possibly damaging Het
Cdk5rap3 C G 11: 96,912,216 (GRCm38) probably null Het
Cdk8 G A 5: 146,299,795 (GRCm38) R340K probably damaging Het
Cdk8 A T 5: 146,299,796 (GRCm38) R340S probably damaging Het
Cdk8 G T 5: 146,301,637 (GRCm38) S379I probably benign Het
Cdkl4 G T 17: 80,550,858 (GRCm38) L111I probably damaging Het
Cdkl5 C A X: 160,824,045 (GRCm38) V736F probably benign Het
Cdkn1c C A 7: 143,460,316 (GRCm38) G131V probably damaging Het
Cdnf G A 2: 3,521,083 (GRCm38) S104N possibly damaging Het
Cdon G T 9: 35,491,900 (GRCm38) C1102F probably damaging Het
Cdyl G C 13: 35,816,070 (GRCm38) R111S probably benign Het
Ceacam12 G C 7: 18,067,515 (GRCm38) V140L probably damaging Het
Ceacam19 G T 7: 19,886,449 (GRCm38) P86T probably damaging Het
Ceacam19 G T 7: 19,882,844 (GRCm38) A175D probably damaging Het
Ceacam20 G A 7: 19,970,164 (GRCm38) probably null Het
Cebpe C A 14: 54,710,580 (GRCm38) E269* probably null Het
Cecr2 C A 6: 120,720,962 (GRCm38) T74K probably damaging Het
Cela3b G T 4: 137,428,484 (GRCm38) H37Q probably damaging Het
Celf1 G T 2: 91,004,705 (GRCm38) C177F possibly damaging Het
Celsr1 A C 15: 85,978,851 (GRCm38) C1327G probably damaging Het
Celsr2 C T 3: 108,413,571 (GRCm38) V642I probably benign Het
Celsr2 C T 3: 108,412,220 (GRCm38) R1092Q probably damaging Het
Celsr3 C A 9: 108,826,477 (GRCm38) A53E probably benign Het
Cemip C A 7: 83,947,296 (GRCm38) G1087C probably damaging Het
Cenpe G C 3: 135,216,385 (GRCm38) V68L possibly damaging Het
Cenpj C G 14: 56,552,879 (GRCm38) R571P possibly damaging Het
Cep128 C A 12: 91,289,603 (GRCm38) M364I probably benign Het
Cep128 C A 12: 91,364,371 (GRCm38) A75S probably damaging Het
Cep131 C A 11: 120,065,715 (GRCm38) G936W probably damaging Het
Cep135 A T 5: 76,591,826 (GRCm38) Q23L probably damaging Het
Cep152 C A 2: 125,614,324 (GRCm38) V256F probably benign Het
Cep152 C T 2: 125,619,704 (GRCm38) V151M probably damaging Het
Cep162 C A 9: 87,199,980 (GRCm38) probably null Het
Cep250 A T 2: 155,976,467 (GRCm38) Q854L probably benign Het
Cep290 G A 10: 100,497,944 (GRCm38) R286Q probably benign Het
Cep290 G T 10: 100,538,997 (GRCm38) K1368N possibly damaging Het
Cep295 C A 9: 15,330,817 (GRCm38) D46Y Het
Cep89 G T 7: 35,397,081 (GRCm38) probably benign Het
Ces1b T A 8: 93,076,154 (GRCm38) T103S probably benign Het
Ces1h T A 8: 93,366,840 (GRCm38) probably null Het
Ces2b AGG AG 8: 104,832,595 (GRCm38) probably null Het
Ces2f G T 8: 104,948,235 (GRCm38) G90W probably damaging Het
Ces2g C A 8: 104,963,961 (GRCm38) L125M probably damaging Het
Ces3b G T 8: 105,085,083 (GRCm38) R77L probably damaging Het
Cfap157 A C 2: 32,778,207 (GRCm38) L407R probably damaging Het
Cfap221 C G 1: 119,984,743 (GRCm38) R138P probably damaging Het
Cfap44 G T 16: 44,432,044 (GRCm38) V839L probably benign Het
Cfap46 T A 7: 139,601,267 (GRCm38) Q2606L unknown Het
Cfap46 G T 7: 139,630,626 (GRCm38) P1768Q unknown Het
Cfap53 A T 18: 74,305,552 (GRCm38) K267* probably null Het
Cfap54 G T 10: 92,979,026 (GRCm38) P1315H probably damaging Het
Cfap57 C T 4: 118,598,956 (GRCm38) probably null Het
Cfap61 G C 2: 146,153,800 (GRCm38) C1095S probably damaging Het
Cfap61 G A 2: 146,012,162 (GRCm38) V365M possibly damaging Het
Cfap69 C T 5: 5,586,384 (GRCm38) C747Y possibly damaging Het
Cfap74 G T 4: 155,454,913 (GRCm38) probably benign Het
Cfh G T 1: 140,144,059 (GRCm38) P297H probably damaging Het
Chd1 G T 17: 15,747,801 (GRCm38) G866C probably damaging Het
Chd2 C G 7: 73,468,586 (GRCm38) A1095P possibly damaging Het
Cherp C A 8: 72,475,135 (GRCm38) probably benign Het
Cherp T G 8: 72,462,916 (GRCm38) K687Q Het
Chil5 G T 3: 106,028,818 (GRCm38) H53N probably damaging Het
Chl1 C A 6: 103,693,096 (GRCm38) Y482* probably null Het
Chl1 A T 6: 103,697,949 (GRCm38) probably benign Het
Chmp1a C G 8: 123,206,331 (GRCm38) V128L probably benign Het
Chmp3 C A 6: 71,543,804 (GRCm38) probably benign Het
Chodl C A 16: 78,941,463 (GRCm38) S106R possibly damaging Het
Chpf2 CGGG CGGGG 5: 24,591,519 (GRCm38) probably null Het
Chrm2 G C 6: 36,524,607 (GRCm38) R466S probably damaging Het
Chrna10 C A 7: 102,113,264 (GRCm38) V240L probably benign Het
Chrna10 C A 7: 102,114,987 (GRCm38) L63F possibly damaging Het
Chrna2 T A 14: 66,151,027 (GRCm38) L497Q probably null Het
Chrna4 C A 2: 181,024,813 (GRCm38) V611F probably damaging Het
Chrna4 G C 2: 181,028,285 (GRCm38) H559Q possibly damaging Het
Chrna5 G A 9: 55,004,956 (GRCm38) A347T possibly damaging Het
Chrna6 C G 8: 27,413,689 (GRCm38) R5P probably benign Het
Chrna7 C T 7: 63,107,551 (GRCm38) probably null Het
Chrna9 T A 5: 65,971,220 (GRCm38) L257Q probably damaging Het
Chrnb1 G T 11: 69,794,189 (GRCm38) A105D possibly damaging Het
Chrng C G 1: 87,205,995 (GRCm38) S14R unknown Het
Chrng C A 1: 87,206,298 (GRCm38) N87K probably benign Het
Chrng C A 1: 87,208,263 (GRCm38) Q245K probably benign Het
Chrng C T 1: 87,208,303 (GRCm38) T201I probably damaging Het
Chst2 C A 9: 95,404,841 (GRCm38) R484L probably damaging Het
Chst3 C A 10: 60,186,260 (GRCm38) G255V probably benign Het
Ciart G C 3: 95,879,023 (GRCm38) P247A probably damaging Het
Cidec G C 6: 113,434,496 (GRCm38) L8V probably damaging Het
Cilp TGGG TGG 9: 65,280,130 (GRCm38) probably null Het
Cilp2 G T 8: 69,884,546 (GRCm38) C204* probably null Het
Cilp2 A C 8: 69,884,542 (GRCm38) C206G probably damaging Het
Cilp2 C A 8: 69,882,808 (GRCm38) E513D probably damaging Het
Cirbp G T 10: 80,170,235 (GRCm38) A82S probably damaging Het
Ckap5 T G 2: 91,585,798 (GRCm38) L1023R probably damaging Het
Ckmt1 C A 2: 121,359,575 (GRCm38) P81H probably damaging Het
Clasp2 T A 9: 113,908,795 (GRCm38) L1079Q probably damaging Het
Clasp2 G T 9: 113,770,221 (GRCm38) G135C probably damaging Het
Clca2 C A 3: 145,086,451 (GRCm38) G350C probably damaging Het
Clcn4 C A 7: 7,294,756 (GRCm38) A165S probably damaging Het
Clcn4 C A 7: 7,293,040 (GRCm38) E268* probably null Het
Clcn6 C A 4: 148,023,370 (GRCm38) G193* probably null Het
Clcn7 G T 17: 25,153,015 (GRCm38) probably null Het
Clcnkb G T 4: 141,407,951 (GRCm38) T492K probably damaging Het
Cldn1 G T 16: 26,360,864 (GRCm38) P151H probably damaging Het
Cldn16 G T 16: 26,481,250 (GRCm38) R146L probably damaging Het
Cldn9 G C 17: 23,683,201 (GRCm38) P150R probably damaging Het
Cldnd1 G T 16: 58,729,681 (GRCm38) G76W probably damaging Het
Clec1a G A 6: 129,429,907 (GRCm38) P215L probably benign Het
Clec4a1 G T 6: 122,933,892 (GRCm38) R235S possibly damaging Het
Clec4d G T 6: 123,268,074 (GRCm38) W104C probably damaging Het
Clec4f C A 6: 83,645,221 (GRCm38) R546I possibly damaging Het
Clgn T A 8: 83,397,681 (GRCm38) M84K probably benign Het
Clic6 C T 16: 92,499,139 (GRCm38) S229F probably benign Het
Clip1 C A 5: 123,617,350 (GRCm38) A956S probably damaging Het
Clip2 C G 5: 134,516,835 (GRCm38) R334P probably damaging Het
Clip2 C A 5: 134,522,999 (GRCm38) G90C probably damaging Het
Clip4 G T 17: 71,799,097 (GRCm38) probably null Het
Clmn C A 12: 104,781,376 (GRCm38) K637N probably benign Het
Clp1 C A 2: 84,725,963 (GRCm38) D58Y probably benign Het
Clptm1 C T 7: 19,637,468 (GRCm38) probably null Het
Clpx C A 9: 65,299,997 (GRCm38) S59* probably null Het
Clspn G A 4: 126,566,177 (GRCm38) R399Q probably benign Het
Clstn2 C A 9: 97,461,356 (GRCm38) M679I probably benign Het
Clstn3 C A 6: 124,449,781 (GRCm38) G564V probably damaging Het
Clu A T 14: 65,975,921 (GRCm38) Q252L probably damaging Het
Cluh G C 11: 74,667,754 (GRCm38) K1217N possibly damaging Het
Cmah C A 13: 24,435,684 (GRCm38) Y277* probably null Het
Cmbl G T 15: 31,581,965 (GRCm38) R36L probably benign Het
Cmtr2 CGGG CGG 8: 110,221,499 (GRCm38) probably null Het
Cmya5 C G 13: 93,063,579 (GRCm38) A3414P probably benign Het
Cnga1 C A 5: 72,605,530 (GRCm38) probably null Het
Cngb1 A T 8: 95,252,136 (GRCm38) L1022Q probably damaging Het
Cnksr1 T C 4: 134,232,150 (GRCm38) D391G probably damaging Het
Cnnm3 G A 1: 36,513,033 (GRCm38) A375T possibly damaging Het
Cnot11 G T 1: 39,535,848 (GRCm38) G4C probably damaging Het
Cnot3 G T 7: 3,651,495 (GRCm38) R57L probably damaging Het
Cnpy1 C A 5: 28,207,209 (GRCm38) V109L possibly damaging Het
Cntn1 C A 15: 92,309,970 (GRCm38) P814H probably damaging Het
Cntn3 C A 6: 102,337,331 (GRCm38) V141L probably benign Het
Cntn4 G T 6: 106,550,425 (GRCm38) G423C probably damaging Het
Cntn4 C A 6: 106,662,618 (GRCm38) H570N probably damaging Het
Cntn5 C A 9: 9,673,962 (GRCm38) E712* probably null Het
Cntn5 C A 9: 10,090,236 (GRCm38) G198C probably damaging Het
Cntn6 C A 6: 104,832,584 (GRCm38) P527T probably damaging Het
Cntnap2 C T 6: 46,015,299 (GRCm38) P387S possibly damaging Het
Cntnap3 G C 13: 64,781,892 (GRCm38) P498A probably damaging Het
Cntnap5a A T 1: 116,412,168 (GRCm38) Q719L probably benign Het
Cntnap5b C T 1: 100,050,706 (GRCm38) A149V probably damaging Het
Cntrob C A 11: 69,311,449 (GRCm38) R439L possibly damaging Het
Cog4 A T 8: 110,879,015 (GRCm38) T570S probably benign Het
Cog5 G T 12: 31,801,985 (GRCm38) G280C probably damaging Het
Cog6 T C 3: 53,013,864 (GRCm38) D107G probably damaging Het
Col11a1 G T 3: 114,138,921 (GRCm38) G902C unknown Het
Col11a1 G C 3: 114,165,235 (GRCm38) probably null Het
Col11a2 G T 17: 34,051,666 (GRCm38) R537M probably benign Het
Col12a1 C CA 9: 79,639,696 (GRCm38) probably null Het
Col12a1 C A 9: 79,599,986 (GRCm38) G263V possibly damaging Het
Col13a1 C A 10: 61,905,262 (GRCm38) G150C probably damaging Het
Col14a1 A C 15: 55,372,570 (GRCm38) probably null Het
Col15a1 G T 4: 47,245,807 (GRCm38) R186L probably benign Het
Col17a1 G A 19: 47,650,304 (GRCm38) P1141L possibly damaging Het
Col18a1 T A 10: 77,112,838 (GRCm38) Q280L unknown Het
Col1a1 G A 11: 94,943,804 (GRCm38) M569I probably benign Het
Col22a1 G T 15: 71,915,120 (GRCm38) P752T unknown Het
Col24a1 G T 3: 145,342,499 (GRCm38) G619V probably damaging Het
Col25a1 G T 3: 130,522,461 (GRCm38) G297V probably damaging Het
Col27a1 G T 4: 63,281,289 (GRCm38) G928W probably damaging Het
Col28a1 T A 6: 8,175,630 (GRCm38) S73C unknown Het
Col28a1 C A 6: 8,127,352 (GRCm38) G366C probably damaging Het
Col28a1 G T 6: 8,062,283 (GRCm38) P669Q possibly damaging Het
Col2a1 C A 15: 97,983,973 (GRCm38) K781N probably damaging Het
Col2a1 G T 15: 97,998,345 (GRCm38) P162H unknown Het
Col3a1 C T 1: 45,311,800 (GRCm38) P18L unknown Het
Col4a1 C T 8: 11,235,218 (GRCm38) G388S unknown Het
Col4a1 C G 8: 11,239,024 (GRCm38) G311R unknown Het
Col4a3 G T 1: 82,690,039 (GRCm38) G1010C unknown Het
Col5a2 C A 1: 45,403,473 (GRCm38) G604V probably damaging Het
Col5a2 C G 1: 45,402,113 (GRCm38) G664A probably damaging Het
Col5a3 C A 9: 20,775,334 (GRCm38) A1332S unknown Het
Col6a2 C A 10: 76,596,350 (GRCm38) A990S possibly damaging Het
Col6a3 A T 1: 90,811,728 (GRCm38) D866E possibly damaging Het
Col6a5 C A 9: 105,930,785 (GRCm38) E1021D unknown Het
Col6a6 C A 9: 105,728,255 (GRCm38) G1644C probably damaging Het
Col6a6 C A 9: 105,788,895 (GRCm38) G21C probably null Het
Col7a1 G T 9: 108,974,923 (GRCm38) G2198W unknown Het
Col7a1 C G 9: 108,976,051 (GRCm38) D2322E unknown Het
Col7a1 C A 9: 108,984,077 (GRCm38) H2897N unknown Het
Col8a1 C A 16: 57,628,238 (GRCm38) G303V unknown Het
Col8a1 C A 16: 57,632,450 (GRCm38) L63F probably damaging Het
Col8a2 C A 4: 126,311,543 (GRCm38) P449T unknown Het
Colgalt1 G T 8: 71,623,208 (GRCm38) G500C probably damaging Het
Commd4 C A 9: 57,157,131 (GRCm38) R4L probably damaging Het
Comp G T 8: 70,377,221 (GRCm38) R365L probably benign Het
Copa AG A 1: 172,106,123 (GRCm38) probably null Het
Copg2 C T 6: 30,809,585 (GRCm38) R708Q probably benign Het
Coq7 C A 7: 118,510,149 (GRCm38) K225N unknown Het
Corin C A 5: 72,454,493 (GRCm38) R141S probably benign Het
Coro6 C A 11: 77,469,109 (GRCm38) A372D probably damaging Het
Cox10 C A 11: 63,976,470 (GRCm38) L233F possibly damaging Het
Cox4i1 G T 8: 120,668,280 (GRCm38) probably benign Het
Cpa4 G T 6: 30,574,403 (GRCm38) V64L possibly damaging Het
Cpa6 T A 1: 10,329,559 (GRCm38) probably null Het
Cpn1 C A 19: 43,973,976 (GRCm38) G178V probably damaging Het
Cpne5 C G 17: 29,159,182 (GRCm38) R541P probably damaging Het
Cpsf7 G T 19: 10,535,518 (GRCm38) S322I probably null Het
Cpt1a G T 19: 3,370,727 (GRCm38) R395L probably damaging Het
Cpt1a A T 19: 3,366,370 (GRCm38) Q307L probably damaging Het
Cpxm2 C G 7: 132,055,001 (GRCm38) A511P probably benign Het
Cpz G T 5: 35,511,761 (GRCm38) S342* probably null Het
Cracr2a A T 6: 127,669,063 (GRCm38) D706V probably damaging Het
Cracr2a G T 6: 127,607,244 (GRCm38) A89S probably benign Het
Crb1 CG C 1: 139,237,086 (GRCm38) probably null Het
Crb1 T A 1: 139,248,901 (GRCm38) Q448L possibly damaging Het
Crb1 A T 1: 139,337,028 (GRCm38) probably null Het
Crb2 G A 2: 37,787,365 (GRCm38) G290R probably damaging Het
Crb2 G C 2: 37,790,824 (GRCm38) R588P possibly damaging Het
Crebl2 G A 6: 134,830,433 (GRCm38) D2N probably damaging Het
Crispld1 TCC TC 1: 17,764,092 (GRCm38) probably null Het
Crmp1 G T 5: 37,278,124 (GRCm38) V308L probably benign Het
Crnn T G 3: 93,149,296 (GRCm38) V463G probably damaging Het
Crocc2 A T 1: 93,226,692 (GRCm38) Q1603L probably benign Het
Crocc2 A T 1: 93,213,595 (GRCm38) R1157W probably damaging Het
Crybb2 C A 5: 113,058,435 (GRCm38) G178V probably damaging Het
Crybb2 C A 5: 113,058,436 (GRCm38) G178W probably damaging Het
Crybg3 C A 16: 59,555,393 (GRCm38) E119* probably null Het
Crybg3 C T 16: 59,556,478 (GRCm38) S1471N probably benign Het
Csf1 C A 3: 107,749,080 (GRCm38) A212S possibly damaging Het
Csf2ra C T 19: 61,225,153 (GRCm38) D373N probably benign Het
Csmd1 C A 8: 16,200,019 (GRCm38) D982Y probably damaging Het
Csmd1 G T 8: 15,984,708 (GRCm38) P2488T probably damaging Het
Csmd2 C T 4: 128,530,797 (GRCm38) L2872F Het
Csmd3 A T 15: 47,733,417 (GRCm38) S1097R Het
Csmd3 C G 15: 47,675,734 (GRCm38) G1536R Het
Csnk1g1 A T 9: 66,012,750 (GRCm38) T335S probably benign Het
Cspp1 GAA GA 1: 10,095,878 (GRCm38) probably null Het
Cstf2 G C X: 134,062,488 (GRCm38) probably null Het
Ctag2 C A X: 65,047,929 (GRCm38) P82H probably damaging Het
Ctcfl A C 2: 173,102,036 (GRCm38) M507R probably benign Het
Ctdsp2 G T 10: 126,996,072 (GRCm38) R183L probably damaging Het
Ctla2a C A 13: 60,936,000 (GRCm38) E39D probably damaging Het
Ctnna2 G C 6: 76,973,781 (GRCm38) A569G possibly damaging Het
Ctnna2 G T 6: 76,980,740 (GRCm38) L509I probably damaging Het
Ctnna2 G C 6: 77,641,417 (GRCm38) N187K probably benign Het
Ctnna2 G A 6: 77,758,554 (GRCm38) S60F probably benign Het
Ctnnd1 C A 2: 84,615,172 (GRCm38) G507V probably damaging Het
Ctrb1 A T 8: 111,686,674 (GRCm38) S235R probably damaging Het
Cts3 A T 13: 61,568,747 (GRCm38) L25* probably null Het
Cts7 T A 13: 61,355,632 (GRCm38) T173S probably benign Het
Ctse G A 1: 131,672,444 (GRCm38) probably null Het
Ctsq C T 13: 61,037,096 (GRCm38) G259R probably damaging Het
Cul7 AGGGG AGGG 17: 46,652,805 (GRCm38) probably null Het
Cul7 A T 17: 46,658,738 (GRCm38) Q977L probably damaging Het
Cul7 G T 17: 46,659,569 (GRCm38) R1071L probably damaging Het
Cul9 C A 17: 46,537,797 (GRCm38) R671L probably benign Het
Cux2 C T 5: 121,873,680 (GRCm38) R564H probably damaging Het
Cux2 G T 5: 121,877,129 (GRCm38) P234T probably benign Het
Cwf19l2 G T 9: 3,428,782 (GRCm38) G256V probably damaging Het
Cwh43 C G 5: 73,430,470 (GRCm38) N477K probably damaging Het
Cxxc4 G T 3: 134,240,050 (GRCm38) A131S unknown Het
Cyfip1 G T 7: 55,898,320 (GRCm38) G586V possibly damaging Het
Cyfip2 G A 11: 46,222,615 (GRCm38) S968F not run Het
Cylc1 C G X: 111,122,279 (GRCm38) P110A probably benign Het
Cyp17a1 G A 19: 46,672,659 (GRCm38) P62L possibly damaging Het
Cyp1a1 G A 9: 57,700,514 (GRCm38) A142T probably damaging Het
Cyp20a1 G T 1: 60,353,010 (GRCm38) R75M probably damaging Het
Cyp26b1 C G 6: 84,577,119 (GRCm38) W172S probably damaging Het
Cyp27a1 C T 1: 74,737,335 (GRCm38) R477W probably damaging Het
Cyp2ab1 C A 16: 20,313,881 (GRCm38) W222C possibly damaging Het
Cyp2b9 A T 7: 26,201,163 (GRCm38) N409Y probably benign Het
Cyp2c54 G A 19: 40,073,757 (GRCm38) L19F probably benign Het
Cyp2c66 T A 19: 39,186,626 (GRCm38) I490N probably damaging Het
Cyp2c67 C T 19: 39,643,679 (GRCm38) A82T possibly damaging Het
Cyp2d11 G T 15: 82,392,499 (GRCm38) P80T probably damaging Het
Cyp2f2 C A 7: 27,121,907 (GRCm38) Q82K possibly damaging Het
Cyp2j5 C A 4: 96,659,480 (GRCm38) probably null Het
Cyp2r1 T A 7: 114,553,339 (GRCm38) R128* probably null Het
Cyp2t4 T A 7: 27,158,240 (GRCm38) L426Q probably damaging Het
Cyp3a57 C A 5: 145,365,633 (GRCm38) P80T probably damaging Het
Cyp4a14 C T 4: 115,491,453 (GRCm38) D305N possibly damaging Het
Cyp4a32 G T 4: 115,611,345 (GRCm38) E341D probably benign Het
Cyp4f18 G T 8: 71,998,283 (GRCm38) R180S probably benign Het
Cyp4f40 G T 17: 32,671,159 (GRCm38) D268Y probably benign Het
Cyp4f40 G C 17: 32,676,449 (GRCm38) R515P probably damaging Het
Cyp4x1 G T 4: 115,110,103 (GRCm38) D425E probably damaging Het
Cyp4x1 C T 4: 115,127,525 (GRCm38) A79T probably damaging Het
Cyp8b1 G A 9: 121,916,146 (GRCm38) P40L probably damaging Het
Cyp8b1 A T 9: 121,915,531 (GRCm38) L245Q probably benign Het
Cypt14 G A X: 39,863,558 (GRCm38) P9L probably damaging Het
Cypt15 C A X: 39,346,330 (GRCm38) A15E probably damaging Het
Cyr61 C A 3: 145,648,655 (GRCm38) S167I probably benign Het
Cyth4 G T 15: 78,619,919 (GRCm38) R363L probably damaging Het
D130043K22Rik G C 13: 24,856,834 (GRCm38) V80L probably benign Het
D130043K22Rik C A 13: 24,856,709 (GRCm38) P38H probably damaging Het
D130043K22Rik C A 13: 24,872,248 (GRCm38) T521N possibly damaging Het
D130043K22Rik G T 13: 24,880,847 (GRCm38) G749C probably damaging Het
D430041D05Rik C T 2: 104,241,191 (GRCm38) A571T possibly damaging Het
D8Ertd738e C A 8: 84,249,646 (GRCm38) A20S probably benign Het
D930020B18Rik C A 10: 121,689,912 (GRCm38) A573D probably damaging Het
Daam2 C G 17: 49,464,620 (GRCm38) A833P probably damaging Het
Daam2 G A 17: 49,489,016 (GRCm38) R268W probably damaging Het
Dab1 G T 4: 104,727,740 (GRCm38) G359V probably benign Het
Dact1 G C 12: 71,310,051 (GRCm38) R23P possibly damaging Het
Daglb G C 5: 143,473,118 (GRCm38) S140T probably null Het
Dand5 C A 8: 84,816,523 (GRCm38) R108M probably damaging Het
Dand5 C T 8: 84,816,337 (GRCm38) R170K probably benign Het
Dapk3 GC GCC 10: 81,191,769 (GRCm38) probably null Het
Daw1 G T 1: 83,210,214 (GRCm38) R318S unknown Het
Dbt G C 3: 116,546,091 (GRCm38) R376P probably damaging Het
Dcaf12l1 G T X: 44,788,824 (GRCm38) H366N probably damaging Het
Dcaf7 G T 11: 106,053,795 (GRCm38) C268F probably benign Het
Dchs1 T A 7: 105,757,693 (GRCm38) S2202C probably damaging Het
Dchs1 G C 7: 105,758,551 (GRCm38) Q2025E probably benign Het
Dchs2 T A 3: 83,271,140 (GRCm38) S1167T possibly damaging Het
Dclk1 G T 3: 55,256,013 (GRCm38) E175D probably benign Het
Dcstamp G T 15: 39,759,596 (GRCm38) G438W probably benign Het
Ddb1 G C 19: 10,608,396 (GRCm38) R158P probably damaging Het
Ddc G T 11: 11,880,552 (GRCm38) P31T probably damaging Het
Ddhd1 C A 14: 45,657,594 (GRCm38) A140S possibly damaging Het
Ddhd2 G T 8: 25,754,385 (GRCm38) T71N unknown Het
Ddhd2 C A 8: 25,754,374 (GRCm38) A75S probably benign Het
Ddr2 C A 1: 169,990,622 (GRCm38) D439Y possibly damaging Het
Ddx1 C A 12: 13,229,259 (GRCm38) G460W probably damaging Het
Ddx10 C A 9: 53,204,511 (GRCm38) A508S probably damaging Het
Ddx17 T A 15: 79,530,172 (GRCm38) Q600L probably benign Het
Ddx21 C A 10: 62,587,538 (GRCm38) probably null Het
Ddx27 G C 2: 167,033,841 (GRCm38) E697D probably benign Het
Ddx56 C G 11: 6,267,445 (GRCm38) M65I probably benign Het
Ddx60 G C 8: 62,000,588 (GRCm38) R1247P possibly damaging Het
Defa17 G T 8: 21,656,594 (GRCm38) G79W probably damaging Het
Defb11 A T 8: 21,906,346 (GRCm38) C12S probably null Het
Defb37 G T 8: 18,986,383 (GRCm38) N40K unknown Het
Degs2 G T 12: 108,692,597 (GRCm38) P41H probably benign Het
Dek C A 13: 47,105,626 (GRCm38) E35* probably null Het
Dennd1a C A 2: 37,800,257 (GRCm38) G944W probably damaging Het
Dennd1c G T 17: 57,074,330 (GRCm38) Q131K probably benign Het
Dennd2a C A 6: 39,523,474 (GRCm38) Q52H probably benign Het
Dennd5a C G 7: 109,934,024 (GRCm38) G180R probably benign Het
Deptor G T 15: 55,133,459 (GRCm38) probably benign Het
Deup1 C A 9: 15,600,903 (GRCm38) Q181H probably null Het
Deup1 G A 9: 15,607,832 (GRCm38) S126F probably benign Het
Dgcr14 C G 16: 17,909,922 (GRCm38) G131A probably benign Het
Dgka C T 10: 128,731,165 (GRCm38) R275Q possibly damaging Het
Dgka C G 10: 128,720,468 (GRCm38) M716I probably benign Het
Dgkd G A 1: 87,916,886 (GRCm38) S258N probably damaging Het
Dgkg G T 16: 22,558,084 (GRCm38) H508Q probably benign Het
Dgki G T 6: 36,975,225 (GRCm38) L740M probably damaging Het
Dgkz C T 2: 91,942,334 (GRCm38) V370I probably damaging Het
Dhtkd1 C G 2: 5,942,628 (GRCm38) R15P unknown Het
Dhx29 G A 13: 112,955,517 (GRCm38) R896Q probably null Het
Dhx37 C T 5: 125,424,980 (GRCm38) R484Q possibly damaging Het
Dhx37 C A 5: 125,425,472 (GRCm38) S449I probably benign Het
Dhx38 C T 8: 109,556,085 (GRCm38) V650I probably benign Het
Dhx8 C A 11: 101,757,660 (GRCm38) T928K probably damaging Het
Dhx9 C T 1: 153,456,575 (GRCm38) G1216R unknown Het
Diaph3 C A 14: 87,002,814 (GRCm38) G278V probably damaging Het
Diexf C A 1: 193,114,675 (GRCm38) V583L probably damaging Het
Dio2 C A 12: 90,729,912 (GRCm38) E101* probably null Het
Dip2a C A 10: 76,296,400 (GRCm38) V545L probably damaging Het
Dip2a C A 10: 76,266,322 (GRCm38) S1446I possibly damaging Het
Diras1 C A 10: 81,022,282 (GRCm38) R45L possibly damaging Het
Disp2 G T 2: 118,789,702 (GRCm38) R305L probably damaging Het
Disp2 C A 2: 118,790,827 (GRCm38) P680H probably damaging Het
Disp3 G T 4: 148,249,746 (GRCm38) P1030Q probably damaging Het
Disp3 G C 4: 148,249,847 (GRCm38) S996R probably benign Het
Disp3 G C 4: 148,250,714 (GRCm38) P958A probably damaging Het
Disp3 C A 4: 148,270,567 (GRCm38) E331* probably null Het
Dlec1 T A 9: 119,147,409 (GRCm38) S1677R probably damaging Het
Dlec1 C A 9: 119,134,473 (GRCm38) L952I probably benign Het
Dlgap1 G T 17: 70,662,743 (GRCm38) V515L probably benign Het
Dlgap2 G T 8: 14,727,659 (GRCm38) W301C probably damaging Het
Dlgap3 C G 4: 127,194,984 (GRCm38) D124E probably damaging Het
Dlgap3 G T 4: 127,235,498 (GRCm38) K895N probably damaging Het
Dlgap5 T A 14: 47,388,063 (GRCm38) R794* probably null Het
Dll3 G T 7: 28,301,383 (GRCm38) S82R probably damaging Het
Dlst C T 12: 85,110,893 (GRCm38) probably benign Het
Dlx1 G T 2: 71,530,015 (GRCm38) E8* probably null Het
Dlx3 C G 11: 95,120,392 (GRCm38) A24G probably benign Het
Dmbt1 A T 7: 131,082,485 (GRCm38) probably null Het
Dmd C A X: 83,627,271 (GRCm38) T220N probably damaging Het
Dmgdh G T 13: 93,709,288 (GRCm38) W483C probably damaging Het
Dmgdh G T 13: 93,677,183 (GRCm38) A79S probably damaging Het
Dmp1 C A 5: 104,211,652 (GRCm38) H65N probably benign Het
Dmrta1 G T 4: 89,688,408 (GRCm38) V34L probably damaging Het
Dmrta1 G A 4: 89,688,454 (GRCm38) G49D probably benign Het
Dmrta1 G A 4: 89,688,498 (GRCm38) A64T probably benign Het
Dmxl2 GC G 9: 54,382,034 (GRCm38) probably null Het
Dna2 G C 10: 62,962,424 (GRCm38) M635I probably benign Het
Dnaaf5 G T 5: 139,185,585 (GRCm38) R834L probably damaging Het
Dnaaf5 G A 5: 139,185,542 (GRCm38) D820N probably benign Het
Dnaaf5 G C 5: 139,177,975 (GRCm38) W662C probably damaging Het
Dnah10 G C 5: 124,741,955 (GRCm38) R435P probably damaging Het
Dnah10 C T 5: 124,747,619 (GRCm38) A613V possibly damaging Het
Dnah10 G T 5: 124,817,988 (GRCm38) probably null Het
Dnah12 G T 14: 26,875,215 (GRCm38) W3510C probably damaging Het
Dnah14 G A 1: 181,690,320 (GRCm38) G2073E probably benign Het
Dnah14 T C 1: 181,763,334 (GRCm38) L3264P probably damaging Het
Dnah14 G T 1: 181,766,304 (GRCm38) R3404L probably damaging Het
Dnah17 G T 11: 118,078,563 (GRCm38) P2257T possibly damaging Het
Dnah17 C A 11: 118,086,960 (GRCm38) G1849C probably damaging Het
Dnah17 C A 11: 118,127,142 (GRCm38) E176* probably null Het
Dnah2 C T 11: 69,544,557 (GRCm38) probably null Het
Dnah2 G T 11: 69,463,453 (GRCm38) R2290S possibly damaging Het
Dnah3 G C 7: 119,967,901 (GRCm38) S2367R probably damaging Het
Dnah3 C A 7: 120,007,862 (GRCm38) R1840L probably benign Het
Dnah5 T A 15: 28,387,763 (GRCm38) S3123T possibly damaging Het
Dnah5 C T 15: 28,295,311 (GRCm38) P1397S probably damaging Het
Dnah5 G T 15: 28,270,403 (GRCm38) E950D probably benign Het
Dnah5 T G 15: 28,270,354 (GRCm38) L934R probably benign Het
Dnah6 C A 6: 73,155,272 (GRCm38) R1149L possibly damaging Het
Dnah6 G T 6: 73,041,138 (GRCm38) P3566H probably damaging Het
Dnah6 G T 6: 73,032,526 (GRCm38) Q3813K probably damaging Het
Dnah6 C A 6: 73,021,237 (GRCm38) L4067F probably benign Het
Dnah7a C G 1: 53,411,656 (GRCm38) V3872L probably benign Het
Dnah7a C A 1: 53,559,102 (GRCm38) A1425S probably benign Het
Dnah7a A C 1: 53,643,457 (GRCm38) W285G possibly damaging Het
Dnah7c C A 1: 46,654,103 (GRCm38) L1961I possibly damaging Het
Dnah8 A T 17: 30,713,095 (GRCm38) Q1479L probably null Het
Dnah8 C A 17: 30,694,033 (GRCm38) T1067N probably benign Het
Dnah9 C A 11: 66,126,650 (GRCm38) D379Y probably damaging Het
Dnaic1 C T 4: 41,569,809 (GRCm38) probably benign Het
Dnaja2 C A 8: 85,540,071 (GRCm38) W342C probably benign Het
Dnajb11 G A 16: 22,865,496 (GRCm38) G90S probably damaging Het
Dnajb11 G A 16: 22,866,961 (GRCm38) R122H probably benign Het
Dnajc10 G C 2: 80,319,233 (GRCm38) R93P probably damaging Het
Dnajc12 A T 10: 63,397,260 (GRCm38) Q60L probably damaging Het
Dnajc6 G T 4: 101,639,428 (GRCm38) V931L possibly damaging Het
Dner C A 1: 84,445,433 (GRCm38) R483L probably damaging Het
Dner C G 1: 84,445,430 (GRCm38) S484T probably damaging Het
Dner C T 1: 84,405,989 (GRCm38) C558Y probably damaging Het
Dnhd1 C A 7: 105,682,841 (GRCm38) R102S possibly damaging Het
Dntt A T 19: 41,055,815 (GRCm38) D473V probably damaging Het
Doc2g C A 19: 4,004,105 (GRCm38) P112T probably damaging Het
Dock1 G T 7: 134,782,400 (GRCm38) E667* probably null Het
Dock10 C G 1: 80,559,200 (GRCm38) M989I probably benign Het
Dock2 T G 11: 34,312,553 (GRCm38) H934P possibly damaging Het
Dock4 G C 12: 40,817,641 (GRCm38) Q1405H possibly damaging Het
Dock5 C A 14: 67,813,933 (GRCm38) A696S possibly damaging Het
Dock8 G T 19: 25,132,123 (GRCm38) A890S probably benign Het
Dock8 C T 19: 25,155,972 (GRCm38) T1161I probably benign Het
Donson G A 16: 91,688,472 (GRCm38) R81W probably benign Het
Dopey2 G T 16: 93,763,895 (GRCm38) V874L probably damaging Het
Dpp6 C A 5: 27,712,642 (GRCm38) F610L probably damaging Het
Dpp8 CTGTGTGT CTGTGT 9: 65,063,866 (GRCm38) probably null Het
Dpp8 G T 9: 65,066,485 (GRCm38) G664C probably damaging Het
Dpy19l2 C A 9: 24,646,359 (GRCm38) M373I probably benign Het
Dpys A T 15: 39,842,099 (GRCm38) M206K probably benign Het
Dpysl2 C A 14: 66,862,490 (GRCm38) G99V probably damaging Het
Drc1 A T 5: 30,345,507 (GRCm38) N125Y possibly damaging Het
Drc1 C A 5: 30,348,697 (GRCm38) S238Y probably benign Het
Drd1 G T 13: 54,052,857 (GRCm38) T446N possibly damaging Het
Drd5 C T 5: 38,320,386 (GRCm38) R241C possibly damaging Het
Drosha G T 15: 12,842,092 (GRCm38) G327V probably benign Het
Drp2 A G X: 134,437,042 (GRCm38) E359G probably damaging Het
Dsc3 C T 18: 19,966,315 (GRCm38) V715I probably benign Het
Dscam C G 16: 96,608,189 (GRCm38) E1845Q probably damaging Het
Dscaml1 C A 9: 45,672,791 (GRCm38) T518N probably damaging Het
Dsel C A 1: 111,861,716 (GRCm38) R363L probably damaging Het
Dsg1c C A 18: 20,264,949 (GRCm38) P69T probably damaging Het
Dsg2 G T 18: 20,602,249 (GRCm38) E1095* probably null Het
Dsp CAAA CAAAA 13: 38,192,854 (GRCm38) probably null Het
Dsp G C 13: 38,151,689 (GRCm38) G34A probably benign Het
Dst A C 1: 34,194,518 (GRCm38) K3436Q probably damaging Het
Dst G T 1: 34,181,232 (GRCm38) G2039V probably benign Het
Dtx1 C A 5: 120,681,351 (GRCm38) G594V probably damaging Het
Duox2 G T 2: 122,293,452 (GRCm38) P417Q probably damaging Het
Dusp1 CT C 17: 26,507,195 (GRCm38) probably null Het
Dusp10 G C 1: 184,068,992 (GRCm38) E319Q probably damaging Het
Dusp4 G T 8: 34,808,090 (GRCm38) S121I probably benign Het
Dvl1 G T 4: 155,847,637 (GRCm38) probably benign Het
Dvl3 G T 16: 20,517,088 (GRCm38) probably benign Het
Dynap C A 18: 70,241,030 (GRCm38) V142L unknown Het
Dync1h1 G T 12: 110,658,517 (GRCm38) E3793* probably null Het
Dync1h1 G A 12: 110,637,554 (GRCm38) D2304N probably damaging Het
Dync1h1 G GT 12: 110,641,177 (GRCm38) probably null Het
Dync1i1 G A 6: 5,767,057 (GRCm38) V46I probably benign Het
Dync2h1 C A 9: 7,102,427 (GRCm38) G2658C probably damaging Het
Dyrk1a G T 16: 94,691,580 (GRCm38) probably null Het
Dysf G T 6: 84,087,817 (GRCm38) V478L probably benign Het
Dysf G A 6: 84,064,523 (GRCm38) M171I probably benign Het
Dytn G A 1: 63,633,454 (GRCm38) R597* probably null Het
Dyx1c1 G T 9: 72,961,964 (GRCm38) R152L possibly damaging Het
Dzip1 T A 14: 118,911,376 (GRCm38) K297I probably damaging Het
Dzip1l G T 9: 99,665,854 (GRCm38) Q720H probably null Het
E130308A19Rik T A 4: 59,720,223 (GRCm38) I585K probably benign Het
E2f8 A T 7: 48,875,546 (GRCm38) I226K probably benign Het
Eaf2 A T 16: 36,824,662 (GRCm38) I66K probably damaging Het
Ear6 C G 14: 51,854,255 (GRCm38) C86W probably damaging Het
Ear6 A AT 14: 51,854,403 (GRCm38) probably null Het
Ecd C T 14: 20,337,019 (GRCm38) G216S possibly damaging Het
Ecm1 T C 3: 95,734,876 (GRCm38) I466V probably benign Het
Ect2l C A 10: 18,172,672 (GRCm38) R267L probably null Het
Eddm3b G A 14: 51,116,722 (GRCm38) V56I probably damaging Het
Eddm3b C A 14: 51,116,989 (GRCm38) L145I probably benign Het
Edil3 G T 13: 88,822,012 (GRCm38) V11F probably benign Het
Edn1 C A 13: 42,303,631 (GRCm38) P47T possibly damaging Het
Eed C A 7: 89,980,515 (GRCm38) R4M probably benign Het
Eed C A 7: 89,980,514 (GRCm38) R4S probably benign Het
Eef1d C A 15: 75,902,878 (GRCm38) A311S possibly damaging Het
Eef2k G A 7: 120,858,453 (GRCm38) G12S probably damaging Het
Efcab14 G T 4: 115,738,702 (GRCm38) G15V probably damaging Het
Efcab8 G T 2: 153,798,680 (GRCm38) D354Y probably null Het
Efemp1 A T 11: 28,867,909 (GRCm38) E129D probably benign Het
Efhb C A 17: 53,437,126 (GRCm38) R479L possibly damaging Het
Efhb G C 17: 53,437,183 (GRCm38) A460G probably benign Het
Efhd2 C A 4: 141,874,683 (GRCm38) R62L probably damaging Het
Efnb1 G T X: 99,147,504 (GRCm38) A339S probably damaging Het
Efnb2 C A 8: 8,623,147 (GRCm38) probably null Het
Egfem1 C A 3: 29,148,453 (GRCm38) P66T probably benign Het
Egfr G T 11: 16,869,319 (GRCm38) G283V probably damaging Het
Egfr A T 11: 16,862,954 (GRCm38) I145F probably benign Het
Egln2 C T 7: 27,164,990 (GRCm38) S170N probably benign Het
Egr1 G C 18: 34,863,230 (GRCm38) R355P probably damaging Het
Ehbp1l1 C A 19: 5,719,101 (GRCm38) A725S probably benign Het
Ehbp1l1 C A 19: 5,718,762 (GRCm38) G838W probably damaging Het
Ehbp1l1 C G 19: 5,719,434 (GRCm38) A614P probably benign Het
Ehbp1l1 C T 19: 5,719,102 (GRCm38) M724I probably benign Het
Ehd2 T A 7: 15,957,905 (GRCm38) probably null Het
Ehd3 G T 17: 73,830,105 (GRCm38) G423V probably benign Het
Ehhadh C A 16: 21,762,288 (GRCm38) W651C probably damaging Het
Eif2a G T 3: 58,531,120 (GRCm38) G21V probably damaging Het
Eif2b2 G C 12: 85,219,564 (GRCm38) M1I probably null Het
Eif2b2 G C 12: 85,223,415 (GRCm38) G243A probably damaging Het
Eif3b G T 5: 140,430,128 (GRCm38) G401C probably damaging Het
Eif3h C A 15: 51,865,438 (GRCm38) G7V probably damaging Het
Eif3m C T 2: 105,001,274 (GRCm38) D314N probably damaging Het
Eif4g1 GT GTT 16: 20,686,366 (GRCm38) probably null Het
Eif4g1 G A 16: 20,683,905 (GRCm38) D988N probably benign Het
Elfn1 G T 5: 139,972,308 (GRCm38) V356L probably benign Het
Elmod2 T A 8: 83,317,777 (GRCm38) S186C possibly damaging Het
Elmod2 C A 8: 83,321,501 (GRCm38) D111Y probably damaging Het
Elmod3 T A 6: 72,566,689 (GRCm38) H373L probably benign Het
Elmsan1 C A 12: 84,162,358 (GRCm38) E657* probably null Het
Elmsan1 G C 12: 84,152,991 (GRCm38) A985G probably benign Het
Eln C T 5: 134,718,026 (GRCm38) G420E unknown Het
Elovl2 C A 13: 41,189,978 (GRCm38) W158L probably damaging Het
Elovl6 G T 3: 129,605,112 (GRCm38) R54L probably damaging Het
Emilin3 T A 2: 160,907,801 (GRCm38) Q676L probably damaging Het
Eml1 G T 12: 108,534,656 (GRCm38) G637W probably damaging Het
Eml1 G T 12: 108,423,139 (GRCm38) probably benign Het
Eml3 A T 19: 8,937,561 (GRCm38) probably null Het
En1 G T 1: 120,607,005 (GRCm38) R341L unknown Het
En1 G T 1: 120,603,663 (GRCm38) A211S unknown Het
En1 G T 1: 120,603,453 (GRCm38) A141S probably benign Het
Engase G T 11: 118,485,757 (GRCm38) R473S possibly damaging Het
Enox1 C T 14: 77,668,747 (GRCm38) T522I probably benign Het
Enpep C A 3: 129,276,680 (GRCm38) W859C probably damaging Het
Enpp1 C A 10: 24,661,942 (GRCm38) V382F probably damaging Het
Entpd7 G T 19: 43,725,497 (GRCm38) G432C probably damaging Het
Ep300 ACCC ACCCC 15: 81,630,097 (GRCm38) probably null Het
Ep400 C A 5: 110,683,364 (GRCm38) K2181N unknown Het
Ep400 C A 5: 110,733,743 (GRCm38) R793S unknown Het
Epb41 G T 4: 132,006,083 (GRCm38) T172N probably benign Het
Epb41l1 G T 2: 156,508,827 (GRCm38) E347D probably benign Het
Epb41l2 G T 10: 25,479,741 (GRCm38) C481F probably damaging Het
Epb41l4b A T 4: 57,063,191 (GRCm38) F500I probably benign Het
Epb41l5 C A 1: 119,609,211 (GRCm38) V317L probably damaging Het
Epb42 T A 2: 121,027,725 (GRCm38) I251F probably damaging Het
Epha10 G T 4: 124,881,960 (GRCm38) R29L probably damaging Het
Epha2 A G 4: 141,318,998 (GRCm38) T503A probably benign Het
Ephb4 G T 5: 137,361,359 (GRCm38) R397L probably benign Het
Ephx1 C A 1: 180,999,769 (GRCm38) Q106H possibly damaging Het
Ephx2 G T 14: 66,085,325 (GRCm38) P500T probably damaging Het
Epn2 C G 11: 61,546,424 (GRCm38) K107N probably damaging Het
Epo C G 5: 137,485,732 (GRCm38) probably null Het
Eps15l1 G T 8: 72,381,437 (GRCm38) Q414K probably benign Het
Eps15l1 T A 8: 72,373,078 (GRCm38) probably null Het
Eps8 C A 6: 137,499,581 (GRCm38) probably null Het
Eps8l2 G C 7: 141,342,095 (GRCm38) A29P probably benign Het
Eps8l3 G T 3: 107,881,666 (GRCm38) probably null Het
Epx C G 11: 87,869,261 (GRCm38) R509P probably damaging Het
Epx C A 11: 87,869,894 (GRCm38) R404M possibly damaging Het
Epx C T 11: 87,872,767 (GRCm38) R209H probably benign Het
Eqtn C A 4: 94,907,551 (GRCm38) E304D probably benign Het
Erbb4 CTGT CT 1: 68,259,183 (GRCm38) probably null Het
Erbb4 C A 1: 68,290,476 (GRCm38) G627C probably damaging Het
Erbb4 C A 1: 68,309,643 (GRCm38) R525L probably benign Het
Ercc3 G T 18: 32,254,161 (GRCm38) D476Y probably damaging Het
Ergic1 G A 17: 26,654,887 (GRCm38) V94I Het
Ermap G T 4: 119,185,561 (GRCm38) T255K probably benign Het
Erp27 C A 6: 136,911,646 (GRCm38) probably null Het
Esco2 C G 14: 65,824,936 (GRCm38) probably null Het
Espnl T A 1: 91,323,555 (GRCm38) L124H probably damaging Het
Esrrg G C 1: 188,043,555 (GRCm38) G93A probably benign Het
Etfbkmt G C 6: 149,144,337 (GRCm38) R63P probably damaging Het
Evi5 C A 5: 107,748,379 (GRCm38) G733* probably null Het
Evx1 C A 6: 52,316,687 (GRCm38) P280H probably benign Het
Exoc3l2 G T 7: 19,480,028 (GRCm38) V460L unknown Het
Exoc8 C A 8: 124,897,186 (GRCm38) E147D possibly damaging Het
Exog G T 9: 119,448,498 (GRCm38) M165I probably damaging Het
Exog G T 9: 119,445,080 (GRCm38) G44W unknown Het
Exosc10 G T 4: 148,565,386 (GRCm38) W424C probably damaging Het
Exph5 G T 9: 53,377,419 (GRCm38) E1933D probably benign Het
Exph5 A T 9: 53,374,213 (GRCm38) S865C probably benign Het
Ext2 ACC AC 2: 93,703,275 (GRCm38) probably benign Het
Eya1 C A 1: 14,184,429 (GRCm38) G422V probably damaging Het
Eya1 G T 1: 14,253,090 (GRCm38) T185N possibly damaging Het
Eya2 C A 2: 165,685,593 (GRCm38) A61E probably damaging Het
F10 G A 8: 13,037,845 (GRCm38) S15N probably benign Het
Fabp1 G T 6: 71,201,736 (GRCm38) G66W probably damaging Het
Fam114a2 T G 11: 57,513,258 (GRCm38) E126D probably benign Het
Fam117a G T 11: 95,375,025 (GRCm38) R169L probably damaging Het
Fam122a T G 19: 24,476,803 (GRCm38) Q185P probably damaging Het
Fam124b C G 1: 80,200,088 (GRCm38) R398P probably benign Het
Fam131b C T 6: 42,318,920 (GRCm38) V181I possibly damaging Het
Fam135b C T 15: 71,622,076 (GRCm38) M1I probably null Het
Fam160b2 G T 14: 70,586,204 (GRCm38) S575R not run Het
Fam168b C A 1: 34,819,882 (GRCm38) E64* probably null Het
Fam171a1 G T 2: 3,224,934 (GRCm38) R368L possibly damaging Het
Fam174b G A 7: 73,740,581 (GRCm38) A27T unknown Het
Fam184a C A 10: 53,699,086 (GRCm38) M142I probably damaging Het
Fam196b C A 11: 34,402,725 (GRCm38) P256T probably benign Het
Fam196b G A 11: 34,403,188 (GRCm38) C410Y probably damaging Het
Fam208a C T 14: 27,448,250 (GRCm38) P379S probably damaging Het
Fam208b C A 13: 3,574,234 (GRCm38) R1905S probably damaging Het
Fam221b G T 4: 43,666,039 (GRCm38) P191T probably benign Het
Fam234b A T 6: 135,198,008 (GRCm38) probably benign Het
Fam26e C A 10: 34,096,329 (GRCm38) V37L probably damaging Het
Fam35a C A 14: 34,241,471 (GRCm38) A713S probably benign Het
Fam35a T G 14: 34,268,598 (GRCm38) Q117P probably damaging Het
Fam3b C T 16: 97,512,487 (GRCm38) R8Q probably benign Het
Fam53a C A 5: 33,607,817 (GRCm38) A182S probably benign Het
Fam53c G T 18: 34,770,850 (GRCm38) E392* probably null Het
Fam71e2 G T 7: 4,757,728 (GRCm38) L662I Het
Fam83d A T 2: 158,785,188 (GRCm38) S266C probably damaging Het
Fam83h G T 15: 76,006,541 (GRCm38) R3S probably damaging Het
Fam83h G A 15: 76,002,962 (GRCm38) P842L probably benign Het
Fam90a1b C A X: 94,357,042 (GRCm38) A61S possibly damaging Het
Fam91a1 C A 15: 58,432,548 (GRCm38) S371Y possibly damaging Het
Fanca C T 8: 123,312,629 (GRCm38) R181H probably benign Het
Fancb G T X: 164,982,555 (GRCm38) C11F probably damaging Het
Fancd2 A T 6: 113,545,025 (GRCm38) M194L probably benign Het
Fap G T 2: 62,502,446 (GRCm38) A726E probably damaging Het
Fars2 C A 13: 36,204,731 (GRCm38) Q68K probably benign Het
Fasn C A 11: 120,815,471 (GRCm38) probably null Het
Fastkd2 G T 1: 63,734,836 (GRCm38) probably null Het
Fastkd2 T C 1: 63,734,837 (GRCm38) probably null Het
Fat2 G T 11: 55,278,966 (GRCm38) S2989* probably null Het
Fat3 C A 9: 15,969,835 (GRCm38) G3247V probably damaging Het
Fat3 G T 9: 15,965,991 (GRCm38) T3442K possibly damaging Het
Fat3 C A 9: 15,947,538 (GRCm38) C3794F probably damaging Het
Fat3 C A 9: 15,923,026 (GRCm38) C4090F possibly damaging Het
Fat4 C A 3: 38,981,838 (GRCm38) T3213N probably damaging Het
Fat4 G T 3: 38,888,584 (GRCm38) R542L probably damaging Het
Fat4 G T 3: 38,890,347 (GRCm38) G1130W probably damaging Het
Fbl G A 7: 28,174,832 (GRCm38) G81R unknown Het
Fbn1 C A 2: 125,389,231 (GRCm38) G472C probably damaging Het
Fbn2 G T 18: 58,010,379 (GRCm38) T2868N probably benign Het
Fbn2 G C 18: 58,055,482 (GRCm38) T1620S probably benign Het
Fbn2 C A 18: 58,069,190 (GRCm38) G1297V probably damaging Het
Fbxl2 C G 9: 113,989,345 (GRCm38) G183R probably benign Het
Fbxo15 C A 18: 84,958,308 (GRCm38) Y57* probably null Het
Fbxo16 C A 14: 65,299,358 (GRCm38) T227N probably damaging Het
Fbxo2 G T 4: 148,165,062 (GRCm38) A190S possibly damaging Het
Fbxo21 G T 5: 117,989,171 (GRCm38) D263Y probably damaging Het
Fbxo24 G C 5: 137,621,299 (GRCm38) R222G probably damaging Het
Fbxo38 C T 18: 62,515,464 (GRCm38) E668K probably damaging Het
Fbxo40 C A 16: 36,970,262 (GRCm38) G162V possibly damaging Het
Fbxw11 G T 11: 32,738,480 (GRCm38) R447L probably null Het
Fbxw14 G T 9: 109,276,246 (GRCm38) P284T probably benign Het
Fbxw20 AC A 9: 109,225,887 (GRCm38) probably null Het
Fbxw21 T C 9: 109,145,537 (GRCm38) H305R probably benign Het
Fbxw27 C A 9: 109,772,178 (GRCm38) W291C probably damaging Het
Fcrl1 A T 3: 87,389,363 (GRCm38) Q284L probably damaging Het
Fer1l4 C G 2: 156,048,429 (GRCm38) Q228H probably null Het
Fer1l5 G T 1: 36,409,194 (GRCm38) W1046L probably benign Het
Fermt3 C A 19: 7,014,679 (GRCm38) R111L probably benign Het
Fes T A 7: 80,378,030 (GRCm38) R791W probably damaging Het
Fez1 G T 9: 36,867,759 (GRCm38) R244L probably benign Het
Fezf2 G C 14: 12,344,765 (GRCm38) L141V probably benign Het
Fgb G T 3: 83,045,056 (GRCm38) Q169K probably benign Het
Fgd2 C A 17: 29,378,326 (GRCm38) A540E probably benign Het
Fgfr1 G T 8: 25,570,768 (GRCm38) Q485H possibly damaging Het
Fgfr1 G T 8: 25,563,398 (GRCm38) A230S probably benign Het
Fgfr2 C T 7: 130,198,457 (GRCm38) G368E probably damaging Het
Fgfr4 G T 13: 55,161,707 (GRCm38) D492Y probably damaging Het
Fgfr4 A C 13: 55,165,929 (GRCm38) E517A probably damaging Het
Fhit G C 14: 9,870,128 (GRCm38) H51D probably benign Het
Fhod3 C A 18: 25,020,706 (GRCm38) P415H probably damaging Het
Fign C G 2: 63,979,385 (GRCm38) G514R probably damaging Het
Fign C T 2: 63,979,690 (GRCm38) G412E probably damaging Het
Fitm1 G A 14: 55,576,649 (GRCm38) A201T probably benign Het
Fjx1 C A 2: 102,450,997 (GRCm38) A198S probably benign Het
Fkbp4 T A 6: 128,433,111 (GRCm38) N343Y probably damaging Het
Flg2 G T 3: 93,202,738 (GRCm38) G691V unknown Het
Flg2 G T 3: 93,202,420 (GRCm38) G585V unknown Het
Flnc G T 6: 29,457,130 (GRCm38) G2344C probably damaging Het
Flnc G C 6: 29,447,545 (GRCm38) G1116R probably damaging Het
Flt3 G T 5: 147,383,401 (GRCm38) P51Q probably benign Het
Fmo4 G T 1: 162,803,720 (GRCm38) P226H probably benign Het
Fn3k C G 11: 121,440,274 (GRCm38) Q197E unknown Het
Fnbp1 C A 2: 31,083,059 (GRCm38) R143L probably damaging Het
Folh1 A T 7: 86,744,447 (GRCm38) F385L probably damaging Het
Folh1 A T 7: 86,761,822 (GRCm38) F237L probably benign Het
Fosl2 G C 5: 32,152,933 (GRCm38) R242P probably damaging Het
Foxa1 G T 12: 57,542,417 (GRCm38) T339K probably benign Het
Foxc1 G T 13: 31,807,308 (GRCm38) G34V probably benign Het
Foxd2 C A 4: 114,907,887 (GRCm38) G312V unknown Het
Foxf1 G T 8: 121,084,435 (GRCm38) G13W probably damaging Het
Foxh1 G C 15: 76,669,021 (GRCm38) N164K probably benign Het
Foxi1 G T 11: 34,207,710 (GRCm38) P105H probably damaging Het
Foxi2 G A 7: 135,410,415 (GRCm38) A11T probably benign Het
Foxi2 C A 7: 135,411,958 (GRCm38) P306T probably benign Het
Foxj1 A T 11: 116,332,267 (GRCm38) W237R probably benign Het
Foxn3 T A 12: 99,388,597 (GRCm38) M103L probably benign Het
Foxp1 C A 6: 98,978,161 (GRCm38) V312F unknown Het
Fras1 C A 5: 96,740,811 (GRCm38) R2739S probably benign Het
Fras1 C A 5: 96,740,983 (GRCm38) A2796D possibly damaging Het
Fras1 T C 5: 96,758,142 (GRCm38) L3135P probably benign Het
Fras1 G T 5: 96,700,251 (GRCm38) E1773D possibly damaging Het
Fras1 G T 5: 96,691,457 (GRCm38) G1612C probably damaging Het
Frat2 C G 19: 41,847,287 (GRCm38) A209P probably damaging Het
Frem1 C T 4: 83,016,464 (GRCm38) D87N probably damaging Het
Frem1 C A 4: 83,000,269 (GRCm38) V479L probably benign Het
Frem1 C T 4: 82,940,315 (GRCm38) probably null Het
Frem2 T A 3: 53,535,166 (GRCm38) Q2650L probably null Het
Frem2 C A 3: 53,655,607 (GRCm38) S493I probably benign Het
Frem3 G T 8: 80,616,129 (GRCm38) G1684C possibly damaging Het
Frk T C 10: 34,584,005 (GRCm38) Y199H probably benign Het
Frmpd1 C A 4: 45,275,272 (GRCm38) S475Y probably damaging Het
Frmpd2 G T 14: 33,530,451 (GRCm38) A657S possibly damaging Het
Frmpd2 A C 14: 33,543,026 (GRCm38) M921L probably benign Het
Frmpd2 A T 14: 33,530,505 (GRCm38) K675* probably null Het
Frmpd2 G T 14: 33,530,504 (GRCm38) Q674H probably damaging Het
Frmpd3 C A X: 140,362,232 (GRCm38) D27E possibly damaging Het
Frrs1 G A 3: 116,881,818 (GRCm38) A132T probably damaging Het
Frs2 C A 10: 117,074,379 (GRCm38) W359C probably damaging Het
Fry C G 5: 150,310,437 (GRCm38) R30G possibly damaging Het
Fryl T C 5: 73,041,595 (GRCm38) probably null Het
Fscb G A 12: 64,472,628 (GRCm38) A688V unknown Het
Fsd1 A C 17: 55,996,083 (GRCm38) I351L probably benign Het
Fsd2 C T 7: 81,559,752 (GRCm38) R114Q probably damaging Het
Fsip2 G C 2: 82,946,960 (GRCm38) K110N probably damaging Het
Fsip2 G T 2: 82,984,524 (GRCm38) D3534Y probably damaging Het
Fsip2 C A 2: 82,987,203 (GRCm38) L4427I possibly damaging Het
Fstl3 G T 10: 79,780,108 (GRCm38) E143* probably null Het
Fut1 C A 7: 45,619,229 (GRCm38) S202R probably benign Het
Fyco1 C A 9: 123,828,323 (GRCm38) E929D probably benign Het
Fyttd1 G T 16: 32,877,784 (GRCm38) probably benign Het
Fzd4 CTT CT 7: 89,407,250 (GRCm38) probably null Het
Fzd6 G A 15: 39,031,341 (GRCm38) V301M probably damaging Het
Fzd6 G T 15: 39,007,561 (GRCm38) G59W possibly damaging Het
Gabarapl1 G T 6: 129,541,221 (GRCm38) R42L unknown Het
Gabbr1 G C 17: 37,048,424 (GRCm38) R97P possibly damaging Het
Gabra2 C T 5: 71,007,992 (GRCm38) G212S probably benign Het
Gad1 C A 2: 70,579,130 (GRCm38) N188K probably damaging Het
Gad2 T G 2: 22,635,014 (GRCm38) V270G probably benign Het
Gak AG A 5: 108,585,352 (GRCm38) probably null Het
Galns C T 8: 122,598,523 (GRCm38) E297K probably benign Het
Galns C A 8: 122,605,206 (GRCm38) D57Y probably damaging Het
Galnt10 G C 11: 57,737,000 (GRCm38) E142Q probably benign Het
Galnt15 G T 14: 32,052,365 (GRCm38) W486L probably damaging Het
Galnt16 G T 12: 80,601,810 (GRCm38) W552L probably damaging Het
Galnt16 G A 12: 80,572,347 (GRCm38) A76T probably benign Het
Galnt18 G T 7: 111,485,151 (GRCm38) P536T probably damaging Het
Galnt2 G A 8: 124,343,318 (GRCm38) E525K probably benign Het
Galr1 C A 18: 82,405,772 (GRCm38) A127S probably benign Het
Ganc G T 2: 120,433,794 (GRCm38) W409C probably damaging Het
Gapvd1 T A 2: 34,699,864 (GRCm38) K980I possibly damaging Het
Gata4 A C 14: 63,241,265 (GRCm38) probably benign Het
Gata4 G T 14: 63,200,382 (GRCm38) T441N probably damaging Het
Gatb G T 3: 85,636,973 (GRCm38) R416M probably damaging Het
Gbf1 G T 19: 46,259,142 (GRCm38) K226N probably damaging Het
Gbgt1 C A 2: 28,505,188 (GRCm38) C279* probably null Het
Gbp2b C A 3: 142,604,316 (GRCm38) P289Q possibly damaging Het
Gbp4 T A 5: 105,119,449 (GRCm38) R535* probably null Het
Gbp4 C A 5: 105,125,135 (GRCm38) G215C probably null Het
Gchfr A T 2: 119,169,745 (GRCm38) K36* probably null Het
Gck G T 11: 5,910,958 (GRCm38) Q38K possibly damaging Het
Gclc G T 9: 77,786,739 (GRCm38) S325I probably benign Het
Gcn1l1 A T 5: 115,614,149 (GRCm38) H2108L probably damaging Het
Gcnt4 G A 13: 96,946,453 (GRCm38) G86S probably damaging Het
Gcnt7 G T 2: 172,454,886 (GRCm38) T6N possibly damaging Het
Gdf2 G T 14: 33,945,317 (GRCm38) R332M probably damaging Het
Gdf5 C T 2: 155,942,072 (GRCm38) G320D possibly damaging Het
Gdpd2 T A X: 100,733,982 (GRCm38) C214S probably damaging Het
Gfer TCCC TCC 17: 24,695,887 (GRCm38) probably null Het
Gfm2 C A 13: 97,162,992 (GRCm38) T407K possibly damaging Het
Gfm2 G T 13: 97,162,993 (GRCm38) probably null Het
Gfra2 A T 14: 70,978,492 (GRCm38) Q464L not run Het
Gfral G C 9: 76,205,389 (GRCm38) L87V probably benign Het
Gfy CGGG CGG 7: 45,176,464 (GRCm38) probably null Het
Ggcx G C 6: 72,426,519 (GRCm38) G350R probably benign Het
Ggt6 C A 11: 72,436,599 (GRCm38) R103S probably benign Het
Gimap5 G T 6: 48,752,885 (GRCm38) V130L possibly damaging Het
Gimap7 AG A 6: 48,724,321 (GRCm38) probably null Het
Gimd1 G T 3: 132,635,070 (GRCm38) V116L probably benign Het
Gipr G T 7: 19,157,565 (GRCm38) Q396K probably benign Het
Gja8 G C 3: 96,920,236 (GRCm38) L37V probably damaging Het
Gjb4 T A 4: 127,352,127 (GRCm38) Q7L possibly damaging Het
Gjc2 A T 11: 59,177,617 (GRCm38) L13Q probably damaging Het
Gjc3 C A 5: 137,957,561 (GRCm38) G154V probably damaging Het
Glb1 G C 9: 114,420,422 (GRCm38) E106D probably damaging Het
Glb1l3 A T 9: 26,818,245 (GRCm38) L642Q probably damaging Het
Gldc A T 19: 30,145,748 (GRCm38) V249D possibly damaging Het
Gldc C A 19: 30,110,779 (GRCm38) M826I probably damaging Het
Gldc C A 19: 30,110,778 (GRCm38) G827C probably damaging Het
Gldn C G 9: 54,286,660 (GRCm38) A46G probably benign Het
Gli1 G C 10: 127,335,998 (GRCm38) R296G probably damaging Het
Gli1 G T 10: 127,336,691 (GRCm38) P194Q probably benign Het
Gli1 T A 10: 127,334,257 (GRCm38) K343M probably damaging Het
Glipr1l1 C A 10: 112,078,390 (GRCm38) H219N probably benign Het
Glra4 C A X: 136,757,817 (GRCm38) R417L possibly damaging Het
Glrp1 C T 1: 88,509,802 (GRCm38) G29R not run Het
Glud1 C T 14: 34,310,869 (GRCm38) probably benign Het
Glyr1 C A 16: 5,031,973 (GRCm38) D179Y probably null Het
Gm10324 A G 13: 66,122,394 (GRCm38) K458R probably damaging Het
Gm10378 G T 14: 42,657,124 (GRCm38) M76I Het
Gm10382 C A 5: 125,389,424 (GRCm38) P35T unknown Het
Gm10696 G T 3: 94,176,102 (GRCm38) P134Q probably benign Het
Gm11397 C A 13: 33,404,510 (GRCm38) F359L possibly damaging Het
Gm11492 C G 11: 87,567,922 (GRCm38) T374R probably benign Het
Gm11559 CTGTGTGT CTGTGT 11: 99,864,763 (GRCm38) probably null Het
Gm11639 C A 11: 104,739,338 (GRCm38) S965* probably null Het
Gm11639 C A 11: 104,820,518 (GRCm38) T1860K probably benign Het
Gm11639 C A 11: 104,924,019 (GRCm38) A3243D unknown Het
Gm11808 G C 4: 3,973,193 (GRCm38) P123R probably benign Het
Gm12185 C T 11: 48,916,302 (GRCm38) V21M probably benign Het
Gm12394 C T 4: 42,793,520 (GRCm38) R204H probably damaging Het
Gm12394 G C 4: 42,793,428 (GRCm38) P235A probably damaging Het
Gm12666 A T 4: 92,191,703 (GRCm38) F16Y probably damaging Het
Gm12666 C A 4: 92,191,236 (GRCm38) S116I possibly damaging Het
Gm12695 C A 4: 96,749,223 (GRCm38) K352N probably damaging Het
Gm12794 A T 4: 101,941,125 (GRCm38) K98* probably null Het
Gm12886 A T 4: 121,416,719 (GRCm38) L100* probably null Het
Gm13023 C A 4: 143,794,981 (GRCm38) A389D probably damaging Het
Gm13083 C T 4: 143,616,160 (GRCm38) T279I probably benign Het
Gm13084 C A 4: 143,812,018 (GRCm38) V128F probably benign Het
Gm13101 T A 4: 143,965,775 (GRCm38) T219S probably benign Het
Gm13101 C A 4: 143,965,591 (GRCm38) G280V probably benign Het
Gm13102 G C 4: 144,109,302 (GRCm38) M513I unknown Het
Gm13119 A G 4: 144,362,973 (GRCm38) H287R possibly damaging Het
Gm13128 C A 4: 144,331,193 (GRCm38) D123E probably benign Het
Gm13178 G C 4: 144,703,646 (GRCm38) L258V possibly damaging Het
Gm13889 C G 2: 93,956,825 (GRCm38) E101D unknown Het
Gm13941 T A 2: 111,094,778 (GRCm38) D160V unknown Het
Gm14124 G T 2: 150,268,324 (GRCm38) K311N possibly damaging Het
Gm14124 C G 2: 150,268,317 (GRCm38) A309G possibly damaging Het
Gm14569 G T X: 36,433,871 (GRCm38) P395Q probably benign Het
Gm15557 G T 2: 155,942,468 (GRCm38) A226S probably benign Het
Gm15737 G T 6: 92,879,891 (GRCm38) W100C unknown Het
Gm16486 C G 8: 70,717,103 (GRCm38) R1281G possibly damaging Het
Gm17019 A C 5: 15,032,931 (GRCm38) L3W probably damaging Het
Gm17067 A C 7: 42,708,298 (GRCm38) V260G probably benign Het
Gm17455 G T 10: 60,403,015 (GRCm38) A20S probably benign Het
Gm18596 C T 10: 77,742,621 (GRCm38) M6I unknown Het
Gm19410 A T 8: 35,808,965 (GRCm38) Q1592L possibly damaging Het
Gm20379 C G 13: 92,306,159 (GRCm38) P60R unknown Het
Gm21083 T G 5: 15,577,458 (GRCm38) V41G probably benign Het
Gm21149 G T 5: 15,472,148 (GRCm38) A236D probably damaging Het
Gm21149 G C 5: 15,476,412 (GRCm38) R18G not run Het
Gm21188 C T 13: 120,034,952 (GRCm38) C127Y possibly damaging Het
Gm21190 G T 5: 15,525,807 (GRCm38) Q184K probably benign Het
Gm21190 A C 5: 15,524,974 (GRCm38) D215E not run Het
Gm21190 G A 5: 15,524,894 (GRCm38) P242L probably benign Het
Gm21680 A T 5: 25,972,495 (GRCm38) S32T probably benign Het
Gm21731 C A 13: 120,241,172 (GRCm38) P168Q unknown Het
Gm281 G T 14: 13,845,421 (GRCm38) P497Q Het
Gm281 G T 14: 13,823,754 (GRCm38) T807N Het
Gm28710 C A 5: 16,835,979 (GRCm38) H591Q possibly damaging Het
Gm28710 G T 5: 16,856,724 (GRCm38) D823Y probably damaging Het
Gm28729 C A 9: 96,497,007 (GRCm38) probably null Het
Gm29776 C G 14: 54,696,508 (GRCm38) D205H probably damaging Het
Gm30302 G T 13: 49,787,175 (GRCm38) P353H probably benign Het
Gm32742 T A 9: 51,149,306 (GRCm38) H899L probably benign Het
Gm32742 C T 9: 51,158,276 (GRCm38) probably null Het
Gm3327 G T 14: 44,124,800 (GRCm38) G52V Het
Gm3404 C A 5: 146,526,216 (GRCm38) Y69* probably null Het
Gm35339 G A 15: 76,354,930 (GRCm38) R69H Het
Gm35339 G T 15: 76,363,130 (GRCm38) E1530D Het
Gm38394 C A 1: 133,659,116 (GRCm38) G161V probably damaging Het
Gm40460 C T 7: 142,240,906 (GRCm38) S58N unknown Het
Gm40460 A T 7: 142,240,772 (GRCm38) C103S unknown Het
Gm4131 T A 14: 62,481,022 (GRCm38) H45L possibly damaging Het
Gm42669 C A 5: 107,578,590 (GRCm38) Q558K unknown Het
Gm43302 T A 5: 105,276,796 (GRCm38) Q326L probably damaging Het
Gm44511 T A 6: 128,820,338 (GRCm38) probably null Het
Gm4559 C A 7: 142,274,034 (GRCm38) Q110H unknown Het
Gm45837 G A 7: 101,451,465 (GRCm38) A51T probably benign Het
Gm45861 G T 8: 27,569,951 (GRCm38) G1147C unknown Het
Gm45861 G C 8: 27,535,369 (GRCm38) E772Q unknown Het
Gm4756 C A 12: 72,628,738 (GRCm38) G39V probably damaging Het
Gm4847 G C 1: 166,634,773 (GRCm38) L383V probably damaging Het
Gm4869 G C 5: 140,478,985 (GRCm38) R619P probably damaging Het
Gm4869 A T 5: 140,460,860 (GRCm38) probably null Het
Gm4869 G C 5: 140,446,422 (GRCm38) Q39H probably damaging Het
Gm4884 G T 7: 41,032,737 (GRCm38) probably benign Het
Gm4894 C T 9: 49,278,779 (GRCm38) A118V unknown Het
Gm49358 G T 10: 86,811,582 (GRCm38) G88V Het
Gm49368 G T 7: 128,113,067 (GRCm38) G825V probably damaging Het
Gm4951 C G 18: 60,246,296 (GRCm38) T301S probably benign Het
Gm5114 G T 7: 39,409,326 (GRCm38) Q290K probably benign Het
Gm5145 G T 17: 20,571,052 (GRCm38) G231C probably damaging Het
Gm5148 G A 3: 37,715,005 (GRCm38) A22V probably benign Het
Gm5157 C T 7: 21,185,316 (GRCm38) E101K probably benign Het
Gm5294 G T 5: 138,821,495 (GRCm38) S176I probably damaging Het
Gm5346 C A 8: 43,626,546 (GRCm38) V214L probably damaging Het
Gm5460 C G 14: 34,045,834 (GRCm38) C191W probably benign Het
Gm5678 C A 16: 93,629,932 (GRCm38) S140R probably damaging Het
Gm5737 G T 7: 120,814,534 (GRCm38) D97Y probably damaging Het
Gm5797 G A 14: 7,329,383 (GRCm38) Q202* probably null Het
Gm5868 G T 5: 72,586,346 (GRCm38) H10N probably benign Het
Gm5936 G A X: 74,842,553 (GRCm38) A520T possibly damaging Het
Gm6358 T A 16: 89,141,087 (GRCm38) C71* probably null Het
Gm6583 G C 5: 112,354,918 (GRCm38) H307D probably damaging Het
Gm6588 TACACA TACA 5: 112,450,961 (GRCm38) probably null Het
Gm6588 C A 5: 112,450,006 (GRCm38) L140M probably damaging Het
Gm6592 C A X: 8,846,184 (GRCm38) S120R probably benign Het
Gm6614 A T 6: 141,994,202 (GRCm38) S192T probably damaging Het
Gm6970 G A 19: 47,171,131 (GRCm38) P2S probably benign Het
Gm7102 CGGGG CGGG 19: 61,175,750 (GRCm38) probably null Het
Gm7168 A T 17: 13,949,757 (GRCm38) K462M probably benign Het
Gm7168 G A 17: 13,949,670 (GRCm38) C433Y probably damaging Het
Gm7168 G C 17: 13,949,082 (GRCm38) G237A probably damaging Het
Gm7361 C G 5: 26,261,188 (GRCm38) H183D probably benign Het
Gm765 G C 6: 98,238,240 (GRCm38) H141D probably benign Het
Gm8297 G T 14: 4,986,822 (GRCm38) R150L probably benign Het
Gm8332 G C 12: 88,249,802 (GRCm38) A100G possibly damaging Het
Gm8765 C A 13: 50,702,144 (GRCm38) P606H probably damaging Het
Gm8909 C A 17: 36,165,712 (GRCm38) G262V probably damaging Het
Gm8947 C A 1: 151,192,584 (GRCm38) S56Y possibly damaging Het
Gm9195 AGGGGG AGGGGGGG 14: 72,453,434 (GRCm38) probably null Het
Gm9195 C A 14: 72,443,002 (GRCm38) L2207F possibly damaging Het
Gm9573 G T 17: 35,620,925 (GRCm38) P790T unknown Het
Gm9573 G T 17: 35,621,059 (GRCm38) P745H unknown Het
Gm973 C T 1: 59,541,330 (GRCm38) A124V probably damaging Het
Gm9758 C G 5: 14,913,539 (GRCm38) V92L probably benign Het
Gm9758 T A 5: 14,911,458 (GRCm38) Q169L possibly damaging Het
Gm9758 C T 5: 14,910,585 (GRCm38) A212T Het
Gm9805 A G 17: 22,689,871 (GRCm38) Y34C probably benign Het
Gm9958 G T 5: 90,367,998 (GRCm38) R52M unknown Het
Gna13 G T 11: 109,396,202 (GRCm38) V284F probably damaging Het
Gnai1 C A 5: 18,308,552 (GRCm38) probably null Het
Gnas G T 2: 174,284,887 (GRCm38) A72S unknown Het
Gnat2 T A 3: 108,100,044 (GRCm38) F259L Het
Gnat3 C A 5: 18,015,313 (GRCm38) C224* probably null Het
Gnaz G T 10: 75,014,960 (GRCm38) K272N Het
Gnpat G A 8: 124,863,296 (GRCm38) S20N probably benign Het
Gnptab G T 10: 88,440,270 (GRCm38) A1140S probably damaging Het
Golga5 A T 12: 102,472,005 (GRCm38) probably benign Het
Gon4l C T 3: 88,859,036 (GRCm38) P461S probably damaging Het
Gopc C T 10: 52,350,663 (GRCm38) G277S probably damaging Het
Gp1ba C G 11: 70,639,407 (GRCm38) probably benign Het
Gpatch2 G T 1: 187,225,691 (GRCm38) W81L probably damaging Het
Gpc1 G T 1: 92,857,486 (GRCm38) K382N probably damaging Het
Gpha2 C G 19: 6,227,023 (GRCm38) H51Q probably damaging Het
Gpi1 C A 7: 34,205,645 (GRCm38) probably null Het
Gpkow C T X: 7,697,292 (GRCm38) R23C probably damaging Het
Gpr1 G T 1: 63,183,639 (GRCm38) H146N probably benign Het
Gpr108 C A 17: 57,237,316 (GRCm38) G365C probably damaging Het
Gpr139 C A 7: 119,144,513 (GRCm38) R283L possibly damaging Het
Gpr141 C A 13: 19,752,444 (GRCm38) A54S possibly damaging Het
Gpr149 CA C 3: 62,603,959 (GRCm38) probably null Het
Gpr150 G T 13: 76,056,150 (GRCm38) Y225* probably null Het
Gpr156 G T 16: 38,004,863 (GRCm38) A481S probably benign Het
Gpr158 A T 2: 21,827,272 (GRCm38) D1061V possibly damaging Het
Gpr17 C A 18: 31,947,664 (GRCm38) M115I possibly damaging Het
Gpr174 T A X: 107,293,193 (GRCm38) C204S possibly damaging Het
Gpr179 G T 11: 97,351,239 (GRCm38) L260I probably damaging Het
Gpr180 G T 14: 118,148,201 (GRCm38) G142W probably damaging Het
Gpr35 G T 1: 92,983,016 (GRCm38) W150L probably benign Het
Gpr62 A T 9: 106,465,489 (GRCm38) V80E possibly damaging Het
Gpr87 C A 3: 59,180,070 (GRCm38) V6L probably benign Het
Gprc6a C A 10: 51,615,209 (GRCm38) V815L probably damaging Het
Gprin2 G A 14: 34,195,123 (GRCm38) P230L probably damaging Het
Greb1 C A 12: 16,702,491 (GRCm38) G950V probably damaging Het
Grem1 C G 2: 113,749,649 (GRCm38) R169T possibly damaging Het
Grhl2 G T 15: 37,333,287 (GRCm38) G429W unknown Het
Grhl3 G C 4: 135,552,686 (GRCm38) I352M possibly damaging Het
Grid2 G T 6: 64,345,857 (GRCm38) G614W probably damaging Het
Grid2 T A 6: 64,345,856 (GRCm38) Y613* probably null Het
Grik1 C T 16: 87,946,684 (GRCm38) G537S Het
Grik3 C A 4: 125,650,506 (GRCm38) A340E possibly damaging Het
Grik5 T A 7: 25,015,825 (GRCm38) T674S probably damaging Het
Grin2a C A 16: 9,663,577 (GRCm38) K453N possibly damaging Het
Grin2d C A 7: 45,833,177 (GRCm38) G1192V unknown Het
Grip1 G T 10: 119,986,444 (GRCm38) M437I probably benign Het
Grm2 C A 9: 106,645,065 (GRCm38) V580F possibly damaging Het
Grm4 C A 17: 27,450,194 (GRCm38) E367* probably null Het
Grm4 G T 17: 27,450,221 (GRCm38) R358S probably benign Het
Grm6 G C 11: 50,851,262 (GRCm38) V41L probably benign Het
Grm6 C T 11: 50,851,500 (GRCm38) A120V probably benign Het
Grm6 A T 11: 50,859,867 (GRCm38) Y619F probably damaging Het
Grpel2 C T 18: 61,719,772 (GRCm38) G53E possibly damaging Het
Grrp1 G T 4: 134,251,570 (GRCm38) T199K probably benign Het
Gsap G T 5: 21,251,032 (GRCm38) R409I probably damaging Het
Gse1 A C 8: 120,229,852 (GRCm38) T361P unknown Het
Gsg1l C A 7: 126,082,242 (GRCm38) probably benign Het
Gsk3a C A 7: 25,237,528 (GRCm38) G45C unknown Het
Gsta1 G T 9: 78,232,242 (GRCm38) M1I probably null Het
Gstp2 C T 19: 4,041,583 (GRCm38) probably null Het
Gstp3 C G 19: 4,058,154 (GRCm38) V90L probably benign Het
Gtf3c1 C T 7: 125,667,122 (GRCm38) S1014N probably benign Het
Gtf3c4 T A 2: 28,835,073 (GRCm38) S216C probably damaging Het
Gtpbp3 A T 8: 71,489,069 (GRCm38) probably null Het
Gtse1 G T 15: 85,875,737 (GRCm38) A710S probably damaging Het
Guca1a T C 17: 47,400,410 (GRCm38) I4V probably benign Het
Gucy1a2 C T 9: 3,797,245 (GRCm38) T565I probably damaging Het
Gucy1b1 G T 3: 82,061,112 (GRCm38) A29E probably damaging Het
Gucy1b2 C A 14: 62,453,453 (GRCm38) G42C unknown Het
Gucy2c C A 6: 136,719,687 (GRCm38) R704L probably damaging Het
Gucy2c G T 6: 136,767,196 (GRCm38) T135K probably benign Het
Gucy2g C T 19: 55,210,377 (GRCm38) R778H probably benign Het
Gusb C T 5: 130,002,736 (GRCm38) M27I probably benign Het
Gykl1 G T 18: 52,695,132 (GRCm38) V471L possibly damaging Het
Gypa C A 8: 80,500,998 (GRCm38) H92N unknown Het
Gzmm TGG T 10: 79,695,006 (GRCm38) probably null Het
H1fnt G T 15: 98,257,247 (GRCm38) P7H probably damaging Het
H2afy2 T G 10: 61,739,350 (GRCm38) S356R probably damaging Het
H2-M10.3 G T 17: 36,366,579 (GRCm38) A269D probably damaging Het
H2-M10.3 C A 17: 36,367,544 (GRCm38) G130W probably damaging Het
H2-Q2 C G 17: 35,342,342 (GRCm38) R4G unknown Het
H2-Q5 G T 17: 35,394,504 (GRCm38) R71L Het
H2-Q7 G T 17: 35,442,500 (GRCm38) V282L probably damaging Het
H2-Q7 G T 17: 35,439,162 (GRCm38) probably benign Het
H3f3b C G 11: 116,023,907 (GRCm38) G35R probably benign Het
Habp2 G GT 19: 56,319,553 (GRCm38) probably null Het
Habp4 T G 13: 64,174,068 (GRCm38) V173G probably benign Het
Habp4 G C 13: 64,174,070 (GRCm38) D174H probably damaging Het
Hal G T 10: 93,489,335 (GRCm38) E69* probably null Het
Hand2 G A 8: 57,322,013 (GRCm38) S36N probably benign Het
Hao2 G T 3: 98,882,041 (GRCm38) S110R probably damaging Het
Hao2 C A 3: 98,881,942 (GRCm38) Q143H probably benign Het
Hars2 A T 18: 36,789,575 (GRCm38) E387V probably damaging Het
Hars2 G T 18: 36,790,598 (GRCm38) V481L possibly damaging Het
Has2 C A 15: 56,681,583 (GRCm38) V208L probably benign Het
Has3 C G 8: 106,874,018 (GRCm38) H37Q probably benign Het
Haus4 C A 14: 54,549,960 (GRCm38) L44F probably damaging Het
Havcr1 C T 11: 46,775,498 (GRCm38) L263F probably benign Het
Hbb-bt G C 7: 103,813,589 (GRCm38) I55M possibly damaging Het
Hc T A 2: 35,013,610 (GRCm38) S1011C probably damaging Het
Hcar2 G T 5: 123,865,206 (GRCm38) P78Q probably damaging Het
Hcrtr1 C A 4: 130,133,873 (GRCm38) E263* probably null Het
Hdac11 G T 6: 91,167,834 (GRCm38) R148L possibly damaging Het
Hdac3 C A 18: 37,945,751 (GRCm38) E102D probably benign Het
Hdac4 A T 1: 91,987,611 (GRCm38) N303K probably damaging Het
Hdac4 C A 1: 91,956,047 (GRCm38) D870Y probably damaging Het
Hdac6 C A X: 7,937,985 (GRCm38) E450* probably null Het
Hdgfl2 G T 17: 56,099,343 (GRCm38) G576V unknown Het
Heatr4 C G 12: 83,980,478 (GRCm38) A2P probably benign Het
Heatr6 G T 11: 83,766,081 (GRCm38) A390S probably benign Het
Heatr6 G T 11: 83,781,382 (GRCm38) R1072L probably damaging Het
Hectd3 G T 4: 116,998,760 (GRCm38) D419Y probably damaging Het
Hectd4 T A 5: 121,358,320 (GRCm38) M3925K probably benign Het
Hecw2 T A 1: 53,923,943 (GRCm38) Q803L possibly damaging Het
Heg1 G T 16: 33,720,687 (GRCm38) G405C probably damaging Het
Helb T G 10: 120,092,690 (GRCm38) probably null Het
Helz2 C A 2: 181,235,961 (GRCm38) G1015C probably damaging Het
Hemgn G A 4: 46,400,693 (GRCm38) L56F possibly damaging Het
Hepacam2 G T 6: 3,483,352 (GRCm38) T219N probably benign Het
Hephl1 A C 9: 15,090,054 (GRCm38) D258E probably damaging Het
Herc1 G A 9: 66,458,425 (GRCm38) S354N probably null Het
Herc1 G A 9: 66,471,911 (GRCm38) S3493N probably damaging Het
Herc2 G T 7: 56,121,589 (GRCm38) R1033L possibly damaging Het
Herc2 G A 7: 56,131,292 (GRCm38) G1235D probably benign Het
Herpud2 C G 9: 25,130,622 (GRCm38) V85L not run Het
Hes5 G T 4: 154,961,442 (GRCm38) G91C probably damaging Het
Hfe C A 13: 23,706,037 (GRCm38) W251L probably damaging Het
Hfe2 G T 3: 96,528,087 (GRCm38) M220I probably benign Het
Hfe2 G A 3: 96,527,197 (GRCm38) R84Q possibly damaging Het
Hfm1 C G 5: 106,871,820 (GRCm38) D1116H probably benign Het
Hgd T G 16: 37,589,719 (GRCm38) L39R probably damaging Het
Hgs A T 11: 120,478,565 (GRCm38) Q360L probably benign Het
Hhat C A 1: 192,661,492 (GRCm38) probably null Het
Hhip GCCCC GCCCCC 8: 80,057,251 (GRCm38) probably null Het
Hhla1 G A 15: 65,941,775 (GRCm38) T236I probably damaging Het
Hibadh C A 6: 52,619,995 (GRCm38) D155Y probably damaging Het
Hid1 G T 11: 115,352,725 (GRCm38) S499Y probably damaging Het
Hip1 C A 5: 135,428,606 (GRCm38) R722I probably benign Het
Hira G T 16: 18,912,149 (GRCm38) K199N probably damaging Het
Hist1h1c G T 13: 23,739,219 (GRCm38) G124V unknown Het
Hist1h2ag C A 13: 22,042,804 (GRCm38) E42* probably null Het
Hist1h2ah C G 13: 22,035,350 (GRCm38) G68A probably damaging Het
Hist1h3a C T 13: 23,762,022 (GRCm38) C111Y probably damaging Het
Hist1h3a C A 13: 23,762,250 (GRCm38) G35V possibly damaging Het
Hist1h3f G T 13: 23,544,556 (GRCm38) K24N probably damaging Het
Hist1h3i C T 13: 21,783,103 (GRCm38) V90I probably benign Het
Hist2h3c2 G T 3: 96,238,548 (GRCm38) R132S probably damaging Het
Hivep1 G T 13: 42,159,981 (GRCm38) R1899M possibly damaging Het
Hivep2 G T 10: 14,143,307 (GRCm38) V1941F probably damaging Het
Hivep2 G A 10: 14,131,786 (GRCm38) G1376E probably damaging Het
Hivep3 G T 4: 120,095,946 (GRCm38) R486S possibly damaging Het
Hivep3 G T 4: 120,131,778 (GRCm38) E1809* probably null Het
Hk3 C A 13: 55,010,708 (GRCm38) G615C probably damaging Het
Hk3 A G 13: 55,010,710 (GRCm38) L614P probably damaging Het
Hmces G T 6: 87,936,130 (GRCm38) W289L possibly damaging Het
Hmcn2 C A 2: 31,426,824 (GRCm38) S3805Y probably damaging Het
Hmcn2 G T 2: 31,344,506 (GRCm38) G311V probably damaging Het
Hmox2 G T 16: 4,757,128 (GRCm38) probably benign Het
Hmx2 GC G 7: 131,555,534 (GRCm38) probably null Het
Hmx3 G T 7: 131,543,120 (GRCm38) R53L probably benign Het
Hnrnpa2b1 C A 6: 51,464,529 (GRCm38) S247I unknown Het
Hnrnpc C A 14: 52,077,429 (GRCm38) R180M possibly damaging Het
Hnrnpll C A 17: 80,048,610 (GRCm38) R316L probably benign Het
Hnrnpm C A 17: 33,646,745 (GRCm38) G637V probably damaging Het
Hnrnpm C A 17: 33,658,401 (GRCm38) M368I probably benign Het
Hoxa11 C A 6: 52,245,110 (GRCm38) E204* probably null Het
Hoxa4 G A 6: 52,191,636 (GRCm38) P18L unknown Het
Hoxb2 C A 11: 96,351,989 (GRCm38) A60D probably damaging Het
Hoxd11 G T 2: 74,682,415 (GRCm38) G8V probably damaging Het
Hoxd9 C A 2: 74,698,525 (GRCm38) P157Q probably benign Het
Hp1bp3 C T 4: 138,221,673 (GRCm38) L16F not run Het
Hpf1 A G 8: 60,895,635 (GRCm38) H128R probably damaging Het
Hps1 T G 19: 42,766,218 (GRCm38) probably null Het
Hps1 C A 19: 42,759,831 (GRCm38) G552C probably damaging Het
Hps1 C A 19: 42,755,696 (GRCm38) V693L probably benign Het
Hps3 C A 3: 20,008,901 (GRCm38) G833C probably damaging Het
Hps4 G T 5: 112,370,377 (GRCm38) G412V probably damaging Het
Hrc C T 7: 45,336,970 (GRCm38) P515L probably benign Het
Hrg G T 16: 22,953,712 (GRCm38) W90C probably damaging Het
Hsd17b1 G T 11: 101,079,745 (GRCm38) D209Y probably damaging Het
Hsd17b4 G A 18: 50,181,980 (GRCm38) V605M probably benign Het
Hsf5 G T 11: 87,638,133 (GRCm38) G565* probably null Het
Hsp90aa1 G A 12: 110,693,466 (GRCm38) P396L probably damaging Het
Hspa1l C T 17: 34,978,016 (GRCm38) R344C probably benign Het
Hspa8 A C 9: 40,802,802 (GRCm38) K159Q probably damaging Het
Hspa8 G A 9: 40,802,805 (GRCm38) D160N probably damaging Het
Hspa9 C A 18: 34,943,145 (GRCm38) Q371H possibly damaging Het
Hspd1 T G 1: 55,080,266 (GRCm38) T351P probably damaging Het
Hspg2 G T 4: 137,550,467 (GRCm38) G2959V probably damaging Het
Hspg2 G T 4: 137,568,373 (GRCm38) Q4239H possibly damaging Het
Hspg2 C A 4: 137,564,518 (GRCm38) L3975I probably damaging Het
Htatsf1 A G X: 57,065,713 (GRCm38) E378G probably damaging Het
Htr1a T G 13: 105,444,876 (GRCm38) L208R probably damaging Het
Htr4 C G 18: 62,437,608 (GRCm38) Q245E probably benign Het
Htr5b C T 1: 121,527,739 (GRCm38) D151N probably damaging Het
Htra2 C T 6: 83,053,756 (GRCm38) D190N probably damaging Het
Htt G T 5: 34,852,231 (GRCm38) A1519S probably null Het
Hunk G T 16: 90,481,321 (GRCm38) K415N possibly damaging Het
Hus1b C A 13: 30,946,992 (GRCm38) R228L probably benign Het
Hydin C A 8: 110,450,232 (GRCm38) H973Q possibly damaging Het
Hydin C A 8: 110,380,610 (GRCm38) P473Q probably damaging Het
Hydin CG C 8: 110,587,142 (GRCm38) probably null Het
Hydin T A 8: 110,609,989 (GRCm38) C5133S probably benign Het
Hykk G T 9: 54,946,429 (GRCm38) W345L possibly damaging Het
Iars2 T A 1: 185,315,895 (GRCm38) R547* probably null Het
Icam5 G T 9: 21,035,548 (GRCm38) L457F possibly damaging Het
Idh3a G T 9: 54,596,149 (GRCm38) R164L probably damaging Het
Idi1 G T 13: 8,888,019 (GRCm38) R167L probably damaging Het
Idua G C 5: 108,679,584 (GRCm38) G128R probably null Het
Idua AGG AG 5: 108,680,623 (GRCm38) probably null Het
Ifi207 C A 1: 173,729,579 (GRCm38) G531V probably damaging Het
Ifi27l2b C A 12: 103,455,860 (GRCm38) V82F probably damaging Het
Ifi44 G T 3: 151,749,438 (GRCm38) T50N probably damaging Het
Ifi47 G T 11: 49,096,275 (GRCm38) E290* probably null Het
Ifna13 C A 4: 88,644,378 (GRCm38) R3M probably benign Het
Igf2bp3 G T 6: 49,214,428 (GRCm38) P15H possibly damaging Het
Igf2r G T 17: 12,697,399 (GRCm38) L1691M probably damaging Het
Igfn1 C A 1: 135,955,809 (GRCm38) G2653V probably damaging Het
Igfn1 C A 1: 135,969,567 (GRCm38) W1087L probably benign Het
Igfn1 C T 1: 135,982,426 (GRCm38) C140Y possibly damaging Het
Ighg2c C A 12: 113,287,680 (GRCm38) L238F Het
Ighmbp2 C A 19: 3,271,665 (GRCm38) E365* probably null Het
Ighmbp2 C A 19: 3,267,242 (GRCm38) Q543H probably null Het
Ighmbp2 C A 19: 3,265,635 (GRCm38) R595L probably damaging Het
Ighv1-23 A C 12: 114,764,685 (GRCm38) L39R probably damaging Het
Ighv1-4 G T 12: 114,487,404 (GRCm38) A28D possibly damaging Het
Ighv1-58 C T 12: 115,312,324 (GRCm38) E65K possibly damaging Het
Ighv16-1 T C 12: 114,069,125 (GRCm38) E19G possibly damaging Het
Ighv1-64 G A 12: 115,507,666 (GRCm38) T77I probably benign Het
Ighv1-69 A C 12: 115,623,253 (GRCm38) S87A probably benign Het
Ighv1-72 C T 12: 115,758,201 (GRCm38) G45D probably damaging Het
Ighv1-9 C A 12: 114,583,699 (GRCm38) S74I probably benign Het
Ighv2-3 G C 12: 113,611,591 (GRCm38) C9W possibly damaging Het
Ighv7-3 C G 12: 114,153,288 (GRCm38) V85L probably benign Het
Igkv1-117 C A 6: 68,121,594 (GRCm38) C42* probably null Het
Igkv13-84 AGG AG 6: 68,939,860 (GRCm38) probably null Het
Igkv3-2 G T 6: 70,699,015 (GRCm38) E103* probably null Het
Igkv3-2 A T 6: 70,699,046 (GRCm38) Q113L probably benign Het
Igkv3-5 C A 6: 70,663,670 (GRCm38) A45D probably damaging Het
Igkv4-79 C T 6: 69,043,059 (GRCm38) G91R probably damaging Het
Igkv8-19 C T 6: 70,340,922 (GRCm38) E107K possibly damaging Het
Igkv8-19 T A 6: 70,340,921 (GRCm38) E107V probably damaging Het
Iglv3 G A 16: 19,241,452 (GRCm38) T42I probably damaging Het
Igsf10 C A 3: 59,329,605 (GRCm38) E1052* probably null Het
Igsf5 C A 16: 96,378,333 (GRCm38) Q209K probably benign Het
Igsf9 C A 1: 172,494,872 (GRCm38) P545T probably damaging Het
Igsf9b C A 9: 27,334,292 (GRCm38) P1185H probably damaging Het
Ikzf4 C A 10: 128,642,640 (GRCm38) R92L possibly damaging Het
Il10 G C 1: 131,021,395 (GRCm38) A98P probably damaging Het
Il17rd A C 14: 27,100,261 (GRCm38) H648P probably damaging Het
Il17re G T 6: 113,464,792 (GRCm38) R216L possibly damaging Het
Il1b C A 2: 129,369,745 (GRCm38) E18D probably benign Het
Il1rapl1 C A X: 86,748,464 (GRCm38) D417Y probably damaging Het
Il20 C T 1: 130,911,387 (GRCm38) probably benign Het
Il22ra1 C A 4: 135,737,406 (GRCm38) P141H probably damaging Het
Il25 G T 14: 54,935,207 (GRCm38) G120C probably damaging Het
Il27ra TCCC TCC 8: 84,040,975 (GRCm38) probably null Het
Il31 C A 5: 123,480,579 (GRCm38) W111L probably benign Het
Il31 G T 5: 123,480,705 (GRCm38) S69* probably null Het
Il5ra C A 6: 106,741,134 (GRCm38) G120* probably null Het
Il7r C T 15: 9,508,057 (GRCm38) G393D probably benign Het
Il7r G T 15: 9,510,229 (GRCm38) T246N probably benign Het
Ildr2 G T 1: 166,309,049 (GRCm38) G486C probably damaging Het
Ilvbl A T 10: 78,581,124 (GRCm38) N374Y probably damaging Het
Impa1 C A 3: 10,316,074 (GRCm38) Q249H probably benign Het
Impa2 G T 18: 67,309,052 (GRCm38) R114S probably benign Het
Impact G T 18: 12,988,366 (GRCm38) R246L probably damaging Het
Ina G T 19: 47,014,911 (GRCm38) A53S Het
Inafm1 C G 7: 16,273,217 (GRCm38) G25A unknown Het
Incenp C A 19: 9,899,364 (GRCm38) probably benign Het
Inpp5a T G 7: 139,525,775 (GRCm38) L214R probably damaging Het
Inpp5j G T 11: 3,502,191 (GRCm38) P353Q probably damaging Het
Insm2 C T 12: 55,600,356 (GRCm38) P295L probably benign Het
Insrr C G 3: 87,800,827 (GRCm38) S192W possibly damaging Het
Ints1 C A 5: 139,771,638 (GRCm38) V375L possibly damaging Het
Ints3 C T 3: 90,406,356 (GRCm38) G322S probably damaging Het
Ints5 G T 19: 8,894,973 (GRCm38) G99C probably damaging Het
Ints5 G T 19: 8,894,935 (GRCm38) R86L probably benign Het
Ints7 G T 1: 191,610,458 (GRCm38) S522I probably benign Het
Intu A T 3: 40,697,516 (GRCm38) H801L possibly damaging Het
Ipo8 T G 6: 148,796,712 (GRCm38) K604Q probably damaging Het
Iqcf1 AC A 9: 106,502,114 (GRCm38) probably null Het
Iqcg G A 16: 33,029,020 (GRCm38) Q299* probably null Het
Iqgap3 G T 3: 88,088,971 (GRCm38) probably null Het
Irf4 T G 13: 30,750,661 (GRCm38) L28V probably damaging Het
Irf4 G C 13: 30,750,663 (GRCm38) L28F probably damaging Het
Irgc1 C A 7: 24,432,955 (GRCm38) V146L probably benign Het
Irs1 C G 1: 82,288,996 (GRCm38) A500P possibly damaging Het
Irs1 C A 1: 82,290,394 (GRCm38) A34S probably benign Het
Irx2 C T 13: 72,629,089 (GRCm38) Q10* probably null Het
Isx GCCCC GCCC 8: 74,891,859 (GRCm38) probably null Het
Itch A T 2: 155,209,059 (GRCm38) R555S probably damaging Het
Itga1 C T 13: 114,985,071 (GRCm38) probably null Het
Itga2 C G 13: 114,853,701 (GRCm38) probably null Het
Itga2b C A 11: 102,467,076 (GRCm38) G200V probably damaging Het
Itga3 C T 11: 95,056,774 (GRCm38) G668E probably damaging Het
Itga7 G T 10: 128,943,214 (GRCm38) W369C probably damaging Het
Itga8 C A 2: 12,300,933 (GRCm38) S82I possibly damaging Het
Itgad C T 7: 128,189,501 (GRCm38) P467S probably damaging Het
Itgax G T 7: 128,148,062 (GRCm38) W982C probably benign Het
Itgb2l G T 16: 96,437,356 (GRCm38) P81H probably damaging Het
Itgb4 T A 11: 115,986,811 (GRCm38) L552Q probably damaging Het
Itgb4 C G 11: 115,998,058 (GRCm38) R1076G probably benign Het
Itih1 C G 14: 30,929,572 (GRCm38) D892H possibly damaging Het
Itm2a C A X: 107,399,128 (GRCm38) D137Y probably damaging Het
Itpka C A 2: 119,749,421 (GRCm38) H214N probably benign Het
Itpka C T 2: 119,750,775 (GRCm38) R430W probably damaging Het
Itpkc TC T 7: 27,227,781 (GRCm38) probably null Het
Itpr3 G C 17: 27,114,929 (GRCm38) R2020P probably damaging Het
Itpr3 G A 17: 27,119,987 (GRCm38) D2581N probably damaging Het
Jade2 C T 11: 51,816,990 (GRCm38) D799N probably damaging Het
Jade2 C A 11: 51,848,994 (GRCm38) G20C probably null Het
Jag1 C A 2: 137,085,019 (GRCm38) S940I probably benign Het
Jakmip1 C T 5: 37,091,583 (GRCm38) R196C probably damaging Het
Jakmip1 AG A 5: 37,175,307 (GRCm38) probably null Het
Jmjd1c A G 10: 67,246,125 (GRCm38) I2161M probably damaging Het
Jmjd1c T C 10: 67,238,174 (GRCm38) L1896P probably benign Het
Jmjd4 G T 11: 59,450,274 (GRCm38) E10D probably benign Het
Jph2 T A 2: 163,376,377 (GRCm38) probably null Het
Jph4 C A 14: 55,114,926 (GRCm38) G117C probably damaging Het
Kalrn C A 16: 34,035,506 (GRCm38) G1920V probably damaging Het
Kank2 T A 9: 21,795,249 (GRCm38) T158S probably damaging Het
Kat6a G T 8: 22,940,166 (GRCm38) G1846W unknown Het
Kazn G T 4: 142,154,504 (GRCm38) H142N Het
Kbtbd11 G C 8: 15,027,694 (GRCm38) E98Q probably benign Het
Kbtbd12 C A 6: 88,618,668 (GRCm38) C60F probably damaging Het
Kcna5 G T 6: 126,533,990 (GRCm38) R392S probably damaging Het
Kcna7 G C 7: 45,409,183 (GRCm38) R298P probably damaging Het
Kcnab1 C A 3: 65,357,133 (GRCm38) H268N probably benign Het
Kcnab1 C A 3: 65,266,510 (GRCm38) L81I probably damaging Het
Kcnb2 G T 1: 15,710,958 (GRCm38) G685C possibly damaging Het
Kcnc1 C G 7: 46,397,852 (GRCm38) R59G probably damaging Het
Kcnc2 G T 10: 112,272,306 (GRCm38) G201W probably damaging Het
Kcnc3 G T 7: 44,596,106 (GRCm38) G607W probably damaging Het
Kcnd2 G T 6: 21,216,416 (GRCm38) D40Y probably damaging Het
Kcnd3 ACC A 3: 105,459,570 (GRCm38) probably null Het
Kcnh5 G T 12: 75,007,797 (GRCm38) L458I possibly damaging Het
Kcnh5 G C 12: 75,114,522 (GRCm38) P204R probably damaging Het
Kcnh8 C G 17: 52,978,093 (GRCm38) C1030W possibly damaging Het
Kcnh8 G C 17: 52,803,471 (GRCm38) V237L probably damaging Het
Kcnip3 C A 2: 127,510,881 (GRCm38) A73S probably benign Het
Kcnj1 C T 9: 32,397,359 (GRCm38) L360F probably damaging Het
Kcnj10 C A 1: 172,369,135 (GRCm38) S72Y possibly damaging Het
Kcnj10 C A 1: 172,369,221 (GRCm38) P101T probably benign Het
Kcnj14 G T 7: 45,819,909 (GRCm38) C57* probably null Het
Kcnj16 G T 11: 111,024,553 (GRCm38) D14Y possibly damaging Het
Kcnj16 G A 11: 111,025,770 (GRCm38) M419I probably benign Het
Kcnj4 C G 15: 79,485,169 (GRCm38) W203C probably damaging Het
Kcnj5 G T 9: 32,317,698 (GRCm38) P381H possibly damaging Het
Kcnj9 G T 1: 172,323,183 (GRCm38) Q288K possibly damaging Het
Kcnk1 A C 8: 126,029,653 (GRCm38) T305P probably benign Het
Kcnk12 G A 17: 87,746,043 (GRCm38) P397L probably benign Het
Kcnk13 A T 12: 100,061,529 (GRCm38) N288Y possibly damaging Het
Kcnk18 C CA 19: 59,225,479 (GRCm38) probably null Het
Kcnk3 G T 5: 30,588,274 (GRCm38) probably benign Het
Kcnk3 G C 5: 30,622,493 (GRCm38) A296P probably benign Het
Kcnk3 G T 5: 30,622,704 (GRCm38) G366V possibly damaging Het
Kcnk5 C A 14: 20,181,374 (GRCm38) E27* probably null Het
Kcnk5 G C 14: 20,145,050 (GRCm38) P124R probably damaging Het
Kcnn3 G T 3: 89,661,136 (GRCm38) A574S possibly damaging Het
Kcnn3 G A 3: 89,520,923 (GRCm38) G152E probably damaging Het
Kcnq1 G T 7: 143,108,464 (GRCm38) probably benign Het
Kcnq3 G C 15: 65,995,452 (GRCm38) R781G possibly damaging Het
Kcnt1 C T 2: 25,909,265 (GRCm38) R949* probably null Het
Kcnt1 G T 2: 25,901,228 (GRCm38) E528* probably null Het
Kcnt2 C A 1: 140,609,648 (GRCm38) P1115H possibly damaging Het
Kcnu1 G T 8: 25,849,764 (GRCm38) G37W probably damaging Het
Kcnv1 C A 15: 45,114,435 (GRCm38) G69V probably damaging Het
Kcnv2 C A 19: 27,323,241 (GRCm38) A164E probably benign Het
Kcp C A 6: 29,485,525 (GRCm38) V1157L probably benign Het
Kctd12 C G 14: 102,981,918 (GRCm38) G175R not run Het
Kctd19 G T 8: 105,388,517 (GRCm38) H471N probably damaging Het
Kdelr1 G T 7: 45,872,948 (GRCm38) probably benign Het
Kdm2b C A 5: 122,880,797 (GRCm38) R860L probably damaging Het
Kdm4a C T 4: 118,147,169 (GRCm38) D691N probably benign Het
Kdm5b AGG AG 1: 134,595,798 (GRCm38) probably null Het
Kdm6b T A 11: 69,403,866 (GRCm38) Q1162L unknown Het
Kdr C A 5: 75,968,475 (GRCm38) K170N probably benign Het
Kel T A 6: 41,689,559 (GRCm38) Q446L probably benign Het
Khdrbs2 C G 1: 32,243,967 (GRCm38) I53M probably benign Het
Khdrbs3 G T 15: 68,928,831 (GRCm38) R29L probably benign Het
Kif11 G T 19: 37,413,287 (GRCm38) G904V possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 (GRCm38) probably benign Het
Kif14 G T 1: 136,478,365 (GRCm38) A556S probably benign Het
Kif15 G T 9: 122,951,051 (GRCm38) probably benign Het
Kif16b C G 2: 142,711,824 (GRCm38) R1018P probably damaging Het
Kif17 G T 4: 138,287,930 (GRCm38) E463D probably benign Het
Kif18a G T 2: 109,294,957 (GRCm38) D240Y probably damaging Het
Kif19a C A 11: 114,781,315 (GRCm38) Q243K probably benign Het
Kif19a C G 11: 114,784,904 (GRCm38) R401G probably benign Het
Kif1c G T 11: 70,702,893 (GRCm38) G32C probably damaging Het
Kif20b G T 19: 34,950,466 (GRCm38) E1043* probably null Het
Kif21b C G 1: 136,148,312 (GRCm38) R280G probably damaging Het
Kif23 C G 9: 61,924,163 (GRCm38) Q708H possibly damaging Het
Kif26a G T 12: 112,177,611 (GRCm38) R1433L probably damaging Het
Kif26b C G 1: 178,821,548 (GRCm38) A411G probably benign Het
Kif26b G T 1: 178,821,550 (GRCm38) E412* probably null Het
Kif26b C A 1: 178,915,405 (GRCm38) S1022* probably null Het
Kif28 C T 1: 179,728,219 (GRCm38) R333Q not run Het
Kif3c G T 12: 3,367,245 (GRCm38) G422V probably damaging Het
Kif5a G T 10: 127,229,823 (GRCm38) D1013E probably benign Het
Kif5a T A 10: 127,236,967 (GRCm38) K685* probably null Het
Kif6 G A 17: 49,715,100 (GRCm38) A343T probably damaging Het
Kifap3 G T 1: 163,862,062 (GRCm38) W538C probably damaging Het
Kifc2 G T 15: 76,661,288 (GRCm38) E78D possibly damaging Het
Kirrel C A 3: 87,083,875 (GRCm38) E629* probably null Het
Kirrel2 C A 7: 30,452,746 (GRCm38) G479V probably benign Het
Kiz C A 2: 146,935,827 (GRCm38) H468Q possibly damaging Het
Klb G T 5: 65,348,741 (GRCm38) W110C probably damaging Het
Klc4 C T 17: 46,635,409 (GRCm38) probably null Het
Klf6 G T 13: 5,864,882 (GRCm38) E107* probably null Het
Klhdc3 C A 17: 46,676,751 (GRCm38) R292L probably damaging Het
Klhdc7a G C 4: 139,967,000 (GRCm38) T212R probably benign Het
Klhdc7a G T 4: 139,965,662 (GRCm38) T658N probably benign Het
Klhl11 T A 11: 100,463,966 (GRCm38) Q343L probably benign Het
Klhl14 G C 18: 21,652,104 (GRCm38) Q89E probably benign Het
Klhl15 A T X: 94,252,872 (GRCm38) R151W probably damaging Het
Klhl25 G C 7: 75,866,122 (GRCm38) D259H possibly damaging Het
Klhl29 C A 12: 5,081,152 (GRCm38) *876L probably null Het
Klhl3 C A 13: 58,009,409 (GRCm38) V588L probably benign Het
Klhl38 T A 15: 58,314,936 (GRCm38) Y546F possibly damaging Het
Klhl4 C A X: 114,551,602 (GRCm38) S560R probably damaging Het
Klhl40 G T 9: 121,780,693 (GRCm38) A515S probably benign Het
Klhl6 C A 16: 19,982,961 (GRCm38) E15* probably null Het
Klhl8 C A 5: 103,886,039 (GRCm38) R37S probably benign Het
Klk11 C A 7: 43,778,335 (GRCm38) L183M possibly damaging Het
Klkb1 G A 8: 45,275,472 (GRCm38) H417Y probably damaging Het
Klra3 C A 6: 130,330,121 (GRCm38) probably null Het
Klrb1c G T 6: 128,788,447 (GRCm38) P60Q probably damaging Het
Klrb1f G C 6: 129,052,503 (GRCm38) G44R possibly damaging Het
Klrc2 A T 6: 129,660,417 (GRCm38) L47Q probably benign Het
Klrg2 G A 6: 38,636,916 (GRCm38) R51C probably damaging Het
Kmo C A 1: 175,649,186 (GRCm38) L162I probably damaging Het
Kmt2a G T 9: 44,819,121 (GRCm38) P3300T unknown Het
Kmt2b C A 7: 30,575,024 (GRCm38) G2085V probably benign Het
Kmt2b G A 7: 30,584,163 (GRCm38) P924L probably damaging Het
Kmt2b C A 7: 30,586,416 (GRCm38) R350S unknown Het
Kmt2c C G 5: 25,295,397 (GRCm38) probably null Het
Kmt2c C A 5: 25,300,003 (GRCm38) A3436S probably benign Het
Kmt2c C A 5: 25,366,197 (GRCm38) probably null Het
Kmt2e G T 5: 23,481,208 (GRCm38) probably null Het
Kmt5c G T 7: 4,746,700 (GRCm38) V406L probably damaging Het
Kndc1 G T 7: 139,921,912 (GRCm38) S955I possibly damaging Het
Kng1 T G 16: 23,073,389 (GRCm38) M234R probably benign Het
Kras C A 6: 145,246,772 (GRCm38) G12C probably damaging Het
Krba1 G T 6: 48,415,894 (GRCm38) R914L probably damaging Het
Krba1 G T 6: 48,413,256 (GRCm38) W686C probably damaging Het
Krt1 C A 15: 101,846,016 (GRCm38) G600C unknown Het
Krt1 T A 15: 101,850,535 (GRCm38) S65C unknown Het
Krt10 G T 11: 99,386,232 (GRCm38) H460N unknown Het
Krt12 C A 11: 99,422,104 (GRCm38) G38V unknown Het
Krt17 A G 11: 100,259,196 (GRCm38) Y217H probably damaging Het
Krt17 C T 11: 100,259,711 (GRCm38) D167N possibly damaging Het
Krt2 C A 15: 101,811,550 (GRCm38) G562* probably null Het
Krt32 G T 11: 100,084,069 (GRCm38) R351S possibly damaging Het
Krt35 G T 11: 100,096,057 (GRCm38) R44S probably benign Het
Krt42 C A 11: 100,267,068 (GRCm38) R190L probably damaging Het
Krt6b C G 15: 101,678,332 (GRCm38) E283Q probably damaging Het
Krt7 G T 15: 101,423,467 (GRCm38) K388N probably damaging Het
Krt72 A T 15: 101,778,308 (GRCm38) L401Q probably damaging Het
Krt73 C A 15: 101,793,811 (GRCm38) R539I probably damaging Het
Krt75 G T 15: 101,571,054 (GRCm38) D280E probably benign Het
Krt78 C T 15: 101,947,660 (GRCm38) G572E probably benign Het
Krt8 T A 15: 101,999,435 (GRCm38) E235V probably damaging Het
Krt84 TG T 15: 101,525,982 (GRCm38) probably null Het
Krt86 G C 15: 101,476,897 (GRCm38) R316P probably damaging Het
Krtap1-5 G C 11: 99,580,857 (GRCm38) P37A unknown Het
Krtap28-10 C A 1: 83,042,159 (GRCm38) G87C unknown Het
Krtap5-1 C G 7: 142,296,960 (GRCm38) G37A unknown Het
Krtap5-2 C A 7: 142,175,781 (GRCm38) G54V unknown Het
Krtap5-3 G T 7: 142,202,053 (GRCm38) C209F unknown Het
Ksr2 C A 5: 117,747,408 (GRCm38) Q766K probably damaging Het
Ksr2 G C 5: 117,708,200 (GRCm38) E711Q probably damaging Het
Ktn1 G T 14: 47,692,438 (GRCm38) probably null Het
L3mbtl3 C A 10: 26,280,402 (GRCm38) E636* probably null Het
L3mbtl3 C A 10: 26,302,663 (GRCm38) G551C unknown Het
Lama1 G A 17: 67,752,883 (GRCm38) D656N probably benign Het
Lama3 A T 18: 12,429,879 (GRCm38) probably null Het
Lama4 G T 10: 39,005,424 (GRCm38) G70* probably null Het
Lama4 G T 10: 39,005,425 (GRCm38) G70V probably damaging Het
Lama5 C T 2: 180,198,810 (GRCm38) G599R probably damaging Het
Lama5 G C 2: 180,183,630 (GRCm38) D2450E probably benign Het
Lama5 C A 2: 180,190,714 (GRCm38) A1681S possibly damaging Het
Lama5 C A 2: 180,189,419 (GRCm38) V1816L probably damaging Het
Lao1 C A 4: 118,968,371 (GRCm38) P463T probably damaging Het
Larp1 G T 11: 58,049,787 (GRCm38) E580* probably null Het
Lars2 G T 9: 123,454,782 (GRCm38) R705M probably damaging Het
Lbp C T 2: 158,320,306 (GRCm38) P263S probably benign Het
Lce1b A T 3: 92,656,035 (GRCm38) C64S unknown Het
Lce1f C T 3: 92,719,198 (GRCm38) G51S unknown Het
Lcn12 C A 2: 25,492,241 (GRCm38) G151C probably benign Het
Ldb3 G A 14: 34,544,103 (GRCm38) R512W probably damaging Het
Ldlr G A 9: 21,739,830 (GRCm38) A515T probably benign Het
Ldlrad2 G T 4: 137,574,533 (GRCm38) R13S probably benign Het
Lef1 C A 3: 131,193,181 (GRCm38) P257T probably damaging Het
Lefty2 C A 1: 180,894,778 (GRCm38) P227Q possibly damaging Het
Lep A C 6: 29,071,097 (GRCm38) Y140S probably damaging Het
Lep T A 6: 29,071,096 (GRCm38) Y140N probably damaging Het
Lepr G T 4: 101,735,595 (GRCm38) D136Y probably damaging Het
Lgals12 T A 19: 7,598,080 (GRCm38) Q297L probably benign Het
Lgals4 G C 7: 28,841,497 (GRCm38) R282P probably damaging Het
Lgr5 C G 10: 115,456,669 (GRCm38) A511P probably benign Het
Lhcgr C A 17: 88,764,981 (GRCm38) probably null Het
Lhcgr C A 17: 88,753,905 (GRCm38) Q239H probably benign Het
Lhfpl1 T G X: 145,291,165 (GRCm38) D215A probably benign Het
Lhx9 G T 1: 138,831,498 (GRCm38) P355T probably damaging Het
Lilr4b G T 10: 51,481,349 (GRCm38) G94C probably damaging Het
Lilra6 G T 7: 3,912,581 (GRCm38) T385K possibly damaging Het
Limch1 G T 5: 67,028,799 (GRCm38) W647C probably damaging Het
Limd1 G C 9: 123,480,021 (GRCm38) A262P probably damaging Het
Lims1 T A 10: 58,409,656 (GRCm38) I169K probably benign Het
Lin28b C A 10: 45,420,606 (GRCm38) G99C probably damaging Het
Lin9 G C 1: 180,650,802 (GRCm38) W58S probably benign Het
Lingo1 C T 9: 56,620,942 (GRCm38) R127H possibly damaging Het
Lingo2 C A 4: 35,709,656 (GRCm38) R108L probably benign Het
Lingo4 C A 3: 94,402,994 (GRCm38) P413H probably damaging Het
Lipg T A 18: 74,941,340 (GRCm38) probably null Het
Lipi G T 16: 75,550,287 (GRCm38) R415S probably benign Het
Lmcd1 G C 6: 112,310,676 (GRCm38) G108R probably benign Het
Lmcd1 C A 6: 112,310,674 (GRCm38) T107N possibly damaging Het
Lmna G C 3: 88,486,236 (GRCm38) L302V probably benign Het
Lmo3 C A 6: 138,416,496 (GRCm38) C42F probably damaging Het
Lmo3 C A 6: 138,416,500 (GRCm38) A41S probably benign Het
Lmo7 G T 14: 101,896,518 (GRCm38) Q666H possibly damaging Het
Lmo7 G A 14: 101,898,557 (GRCm38) D689N probably damaging Het
Lnpk C T 2: 74,573,562 (GRCm38) M1I probably null Het
Lnx1 G T 5: 74,627,441 (GRCm38) L73I possibly damaging Het
Loxl3 G T 6: 83,038,578 (GRCm38) G222* probably null Het
Loxl3 A T 6: 83,048,160 (GRCm38) T290S probably benign Het
Lpar5 T G 6: 125,082,018 (GRCm38) L234R probably damaging Het
Lpin1 C A 12: 16,579,947 (GRCm38) D75Y Het
Lpp G T 16: 24,661,712 (GRCm38) D77Y probably damaging Het
Lrat G T 3: 82,903,490 (GRCm38) P75T probably damaging Het
Lrba G C 3: 86,540,049 (GRCm38) G2067R probably null Het
Lrfn2 CAA CAAA 17: 49,070,012 (GRCm38) probably null Het
Lrfn2 G C 17: 49,070,095 (GRCm38) G68A probably benign Het
Lrfn2 C A 17: 49,096,715 (GRCm38) S622Y probably damaging Het
Lrfn3 C A 7: 30,360,659 (GRCm38) G47V possibly damaging Het
Lrfn5 G T 12: 61,839,817 (GRCm38) L130F probably damaging Het
Lrmp C A 6: 145,148,074 (GRCm38) Q121K probably benign Het
Lrp10 A T 14: 54,467,561 (GRCm38) Q107L possibly damaging Het
Lrp1b C T 2: 41,188,848 (GRCm38) G1864E Het
Lrp1b C G 2: 40,637,749 (GRCm38) G4367R Het
Lrp2 G C 2: 69,509,289 (GRCm38) L1093V probably benign Het
Lrp2 C A 2: 69,501,641 (GRCm38) R1590L probably damaging Het
Lrp2 C A 2: 69,496,468 (GRCm38) R1753I probably damaging Het
Lrp2 G T 2: 69,472,453 (GRCm38) D2977E probably benign Het
Lrp2 C T 2: 69,451,280 (GRCm38) D3916N probably damaging Het
Lrp3 C A 7: 35,203,012 (GRCm38) E568* probably null Het
Lrp5 C T 19: 3,628,345 (GRCm38) W503* probably null Het
Lrp6 C A 6: 134,462,541 (GRCm38) C1243F probably damaging Het
Lrp8 G C 4: 107,843,332 (GRCm38) G156R probably benign Het
Lrrc18 T A 14: 33,008,888 (GRCm38) L128Q probably damaging Het
Lrrc37a G T 11: 103,503,027 (GRCm38) P524H probably benign Het
Lrrc37a G T 11: 103,500,598 (GRCm38) P1334T probably benign Het
Lrrc37a A T 11: 103,500,520 (GRCm38) S1360T probably benign Het
Lrrc37a A T 11: 103,499,967 (GRCm38) L1544Q possibly damaging Het
Lrrc3c T G 11: 98,599,314 (GRCm38) C166G probably damaging Het
Lrrc45 A C 11: 120,718,665 (GRCm38) E418A possibly damaging Het
Lrrc45 G T 11: 120,718,653 (GRCm38) R414L probably benign Het
Lrrc49 C T 9: 60,598,093 (GRCm38) D632N possibly damaging Het
Lrrc4b G T 7: 44,444,979 (GRCm38) G24W unknown Het
Lrrc4b G T 7: 44,444,980 (GRCm38) G24V unknown Het
Lrrc4b C A 7: 44,461,911 (GRCm38) N402K probably damaging Het
Lrrc4b G T 7: 44,462,617 (GRCm38) G638* probably null Het
Lrrc4c G T 2: 97,630,483 (GRCm38) E485* probably null Het
Lrrc6 T A 15: 66,469,899 (GRCm38) K116M probably damaging Het
Lrrc71 G T 3: 87,742,821 (GRCm38) H291N probably benign Het
Lrrc72 T A 12: 36,247,693 (GRCm38) probably null Het
Lrrc74b C A 16: 17,558,168 (GRCm38) probably null Het
Lrrc74b C T 16: 17,558,172 (GRCm38) A205T probably damaging Het
Lrrc8a G T 2: 30,256,313 (GRCm38) D380Y probably damaging Het
Lrrfip1 G T 1: 91,122,494 (GRCm38) G516C possibly damaging Het
Lrriq4 C G 3: 30,649,996 (GRCm38) Q58E probably benign Het
Lrrn2 T A 1: 132,938,978 (GRCm38) W594R probably benign Het
Lrrn2 G T 1: 132,937,898 (GRCm38) E234* probably null Het
Lrrtm4 C G 6: 80,022,717 (GRCm38) R371G probably benign Het
Lrwd1 T A 5: 136,131,541 (GRCm38) Q313L possibly damaging Het
Lsg1 C A 16: 30,573,289 (GRCm38) Q221H probably damaging Het
Ltbp2 C T 12: 84,829,316 (GRCm38) V506M possibly damaging Het
Ltbp3 A G 19: 5,747,730 (GRCm38) T466A probably damaging Het
Ltf C G 9: 111,024,393 (GRCm38) P237R probably damaging Het
Ltf G T 9: 111,021,005 (GRCm38) V68L probably benign Het
Ltn1 C T 16: 87,402,037 (GRCm38) C1158Y probably benign Het
Luc7l G T 17: 26,281,661 (GRCm38) W337C unknown Het
Luc7l3 GC G 11: 94,321,775 (GRCm38) probably null Het
Ly6g6f C T 17: 35,083,032 (GRCm38) V149M possibly damaging Het
Ly75 C A 2: 60,352,133 (GRCm38) R566L possibly damaging Het
Ly75 C A 2: 60,350,004 (GRCm38) E610* probably null Het
Lypd5 A C 7: 24,352,613 (GRCm38) N118H probably damaging Het
Lypd6 TC T 2: 50,190,807 (GRCm38) probably null Het
Lypd6b C A 2: 49,942,596 (GRCm38) P58T probably damaging Het
Lyst G T 13: 13,680,134 (GRCm38) R2363L possibly damaging Het
Macf1 C A 4: 123,471,475 (GRCm38) E3164D probably benign Het
Mad1l1 C A 5: 140,105,582 (GRCm38) G510V probably benign Het
Mad2l1bp C T 17: 46,147,941 (GRCm38) R221H probably damaging Het
Madd C G 2: 91,142,831 (GRCm38) Q1526H probably damaging Het
Mafb T A 2: 160,366,505 (GRCm38) T58S possibly damaging Het
Magel2 G T 7: 62,379,607 (GRCm38) R753L unknown Het
Magi2 G T 5: 20,702,412 (GRCm38) G1342V probably benign Het
Magix G C X: 7,675,850 (GRCm38) R226G probably benign Het
Malt1 G T 18: 65,448,284 (GRCm38) G261V probably damaging Het
Malt1 G T 18: 65,431,373 (GRCm38) G68C probably damaging Het
Maml2 G T 9: 13,706,590 (GRCm38) G411* probably null Het
Man2a1 G C 17: 64,735,054 (GRCm38) S989T probably benign Het
Man2a1 A C 17: 64,659,020 (GRCm38) K318Q probably damaging Het
Man2b2 C G 5: 36,813,797 (GRCm38) D742H probably damaging Het
Mansc4 G A 6: 147,086,961 (GRCm38) R2W unknown Het
Map10 G T 8: 125,670,070 (GRCm38) K67N probably damaging Het
Map1a G T 2: 121,305,279 (GRCm38) C2192F probably damaging Het
Map1s G T 8: 70,914,517 (GRCm38) D689Y probably damaging Het
Map2 G A 1: 66,380,680 (GRCm38) A57T probably benign Het
Map2 G T 1: 66,438,361 (GRCm38) V1756L probably damaging Het
Map3k1 C A 13: 111,755,946 (GRCm38) G925V probably benign Het
Map3k19 G T 1: 127,822,034 (GRCm38) S1193R probably benign Het
Map3k20 C T 2: 72,298,315 (GRCm38) R32* probably null Het
Map3k4 C A 17: 12,271,697 (GRCm38) Q282H probably damaging Het
Map3k9 C A 12: 81,780,846 (GRCm38) C10F unknown Het
Map3k9 G C 12: 81,722,279 (GRCm38) S998R probably damaging Het
Map4 G C 9: 110,068,523 (GRCm38) probably null Het
Map4k1 G C 7: 29,000,008 (GRCm38) R614P probably damaging Het
Map7d1 C A 4: 126,234,377 (GRCm38) R617L unknown Het
Mapk15 C A 15: 75,998,461 (GRCm38) S441* probably null Het
Mapk7 C A 11: 61,491,362 (GRCm38) Q241H probably damaging Het
Marc1 G T 1: 184,803,937 (GRCm38) P203Q possibly damaging Het
March4 C A 1: 72,428,957 (GRCm38) Q305H probably damaging Het
March8 G T 6: 116,338,272 (GRCm38) probably benign Het
Mast1 C A 8: 84,920,446 (GRCm38) R650L probably benign Het
Mast3 T A 8: 70,789,038 (GRCm38) probably null Het
Maz C A 7: 127,025,896 (GRCm38) A151S unknown Het
Mbd1 G T 18: 74,276,939 (GRCm38) K501N probably null Het
Mbl2 C A 19: 30,233,997 (GRCm38) S6Y probably damaging Het
Mblac2 C G 13: 81,750,167 (GRCm38) R221G probably benign Het
Mboat1 C T 13: 30,226,378 (GRCm38) H273Y probably benign Het
Mbp A T 18: 82,561,845 (GRCm38) H80L probably benign Het
Mbp C A 18: 82,513,010 (GRCm38) P27T unknown Het
Mbtd1 G C 11: 93,912,459 (GRCm38) probably null Het
Mc2r T A 18: 68,407,712 (GRCm38) H170L possibly damaging Het
Mc3r C A 2: 172,249,816 (GRCm38) S319R probably benign Het
Mcam G T 9: 44,134,590 (GRCm38) probably benign Het
Mcc C A 18: 44,491,246 (GRCm38) A411S probably benign Het
Mcf2l G T 8: 13,009,654 (GRCm38) E720* probably null Het
Mcm4 C A 16: 15,629,454 (GRCm38) D549Y probably damaging Het
Mcm4 A C 16: 15,632,216 (GRCm38) D317E possibly damaging Het
Mcm5 G T 8: 75,121,672 (GRCm38) M516I possibly damaging Het
Mcoln2 A T 3: 146,175,704 (GRCm38) Q233L probably damaging Het
Mcpt8 C G 14: 56,082,336 (GRCm38) C219S probably benign Het
Mcu C A 10: 59,456,771 (GRCm38) V29L probably benign Het
Mcub C T 3: 129,916,943 (GRCm38) R280Q probably damaging Het
Mcub C A 3: 129,916,942 (GRCm38) A227S unknown Het
Mdm1 G T 10: 118,158,496 (GRCm38) R470M possibly damaging Het
Mecr A T 4: 131,854,583 (GRCm38) probably null Het
Med10 A G 13: 69,809,970 (GRCm38) K14E probably benign Het
Med12l G T 3: 59,247,875 (GRCm38) G1159W probably damaging Het
Med15 T A 16: 17,653,232 (GRCm38) H698L possibly damaging Het
Mef2c C A 13: 83,625,266 (GRCm38) T87K probably benign Het
Mef2d G A 3: 88,158,128 (GRCm38) R118Q possibly damaging Het
Megf11 T G 9: 64,680,326 (GRCm38) C469G probably damaging Het
Megf6 C A 4: 154,237,826 (GRCm38) P37T probably benign Het
Megf6 G C 4: 154,250,849 (GRCm38) G255A probably damaging Het
Megf6 G T 4: 154,267,681 (GRCm38) K1214N possibly damaging Het
Megf6 G T 4: 154,267,682 (GRCm38) D1215Y probably damaging Het
Megf6 C A 4: 154,267,747 (GRCm38) C1236* probably null Het
Megf6 C A 4: 154,269,741 (GRCm38) C1367* probably null Het
Megf8 G T 7: 25,347,369 (GRCm38) G1559V probably damaging Het
Megf8 G T 7: 25,346,162 (GRCm38) G1403C probably damaging Het
Meioc TCC TC 11: 102,666,364 (GRCm38) probably null Het
Meltf G T 16: 31,880,234 (GRCm38) C54F probably damaging Het
Mep1a C G 17: 43,486,306 (GRCm38) G290A probably damaging Het
Mep1a T A 17: 43,486,297 (GRCm38) Q293L probably damaging Het
Mest C A 6: 30,723,575 (GRCm38) probably benign Het
Mettl21e G T 1: 44,206,550 (GRCm38) L179M probably damaging Het
Mettl8 C G 2: 70,973,338 (GRCm38) D202H probably damaging Het
Mettl9 G T 7: 121,057,330 (GRCm38) V228F probably damaging Het
Mex3d C G 10: 80,381,350 (GRCm38) A678P unknown Het
Mfge8 G T 7: 79,145,737 (GRCm38) F27L probably benign Het
Mfhas1 G T 8: 35,590,385 (GRCm38) Q671H possibly damaging Het
Mfn1 G T 3: 32,564,291 (GRCm38) E550* probably null Het
Mfrp G C 9: 44,102,519 (GRCm38) G109R probably damaging Het
Mfsd2b G A 12: 4,865,794 (GRCm38) S406L probably damaging Het
Mfsd5 G A 15: 102,281,255 (GRCm38) C354Y possibly damaging Het
Mfsd6 C G 1: 52,658,501 (GRCm38) Q742H probably benign Het
Mfsd6l G T 11: 68,556,982 (GRCm38) V220F possibly damaging Het
Mfsd6l A T 11: 68,557,714 (GRCm38) S464C probably damaging Het
Mfsd8 C A 3: 40,846,861 (GRCm38) probably benign Het
Mgam G T 6: 40,740,071 (GRCm38) L229F probably damaging Het
Mgat4a G T 1: 37,490,372 (GRCm38) P142H probably damaging Het
Mgat4c G T 10: 102,388,602 (GRCm38) D226Y probably damaging Het
Mgat4c C A 10: 102,388,450 (GRCm38) P175H probably damaging Het
Mgat5 G C 1: 127,482,692 (GRCm38) K730N probably damaging Het
Mgme1 G T 2: 144,276,476 (GRCm38) V223F probably damaging Het
Mgrn1 A T 16: 4,922,724 (GRCm38) Q309L probably benign Het
Mgst2 C G 3: 51,661,270 (GRCm38) L8V probably damaging Het
Mib1 G T 18: 10,763,309 (GRCm38) R453I probably damaging Het
Mib2 C G 4: 155,655,521 (GRCm38) probably null Het
Mical1 G T 10: 41,481,705 (GRCm38) R436L probably null Het
Mical3 C G 6: 120,959,728 (GRCm38) R1279P possibly damaging Het
Micall2 C T 5: 139,710,302 (GRCm38) E844K unknown Het
Micu1 G T 10: 59,728,041 (GRCm38) Q28H probably benign Het
Micu3 G T 8: 40,308,224 (GRCm38) W58C probably damaging Het
Midn G A 10: 80,150,240 (GRCm38) E55K probably damaging Het
Mier2 C A 10: 79,540,461 (GRCm38) G210V unknown Het
Mindy4 G A 6: 55,224,341 (GRCm38) R337H probably benign Het
Miox G T 15: 89,335,644 (GRCm38) D112Y probably damaging Het
Mitf A T 6: 98,006,121 (GRCm38) probably null Het
Mkl2 G T 16: 13,385,606 (GRCm38) G161V probably benign Het
Mkrn1 T A 6: 39,400,456 (GRCm38) N282Y probably null Het
Mks1 GCCC GCC 11: 87,860,723 (GRCm38) probably null Het
Mkx G T 18: 6,937,195 (GRCm38) P283Q probably benign Het
Mlf2 G T 6: 124,934,306 (GRCm38) G95W probably damaging Het
Mllt10 G C 2: 18,171,076 (GRCm38) probably null Het
Mllt6 G T 11: 97,676,425 (GRCm38) G676C possibly damaging Het
Mmd G T 11: 90,259,888 (GRCm38) W57L probably damaging Het
Mmel1 G T 4: 154,894,074 (GRCm38) probably null Het
Mmgt2 A C 11: 62,665,074 (GRCm38) T83P probably damaging Het
Mmp13 C T 9: 7,277,953 (GRCm38) P282L probably damaging Het
Mmp13 C A 9: 7,280,200 (GRCm38) P377T possibly damaging Het
Mmp17 G A 5: 129,595,661 (GRCm38) D226N possibly damaging Het
Mmp1a G T 9: 7,464,230 (GRCm38) A12S probably benign Het
Mmp1a C T 9: 7,467,033 (GRCm38) T237M possibly damaging Het
Mmp1b C A 9: 7,369,322 (GRCm38) probably null Het
Mmp20 G T 9: 7,644,062 (GRCm38) Q250H probably benign Het
Mmp21 G T 7: 133,674,933 (GRCm38) P447H probably damaging Het
Mmp25 G C 17: 23,644,137 (GRCm38) A100G possibly damaging Het
Mmp7 C A 9: 7,695,178 (GRCm38) P47H probably benign Het
Mmrn1 G T 6: 60,987,098 (GRCm38) S1028I possibly damaging Het
Mms19 C A 19: 41,957,140 (GRCm38) probably null Het
Mn1 G T 5: 111,420,068 (GRCm38) G635C probably damaging Het
Mndal A T 1: 173,874,404 (GRCm38) S111T unknown Het
Mogat1 G T 1: 78,529,253 (GRCm38) probably null Het
Mogat2 C A 7: 99,223,629 (GRCm38) G116V probably damaging Het
Morc1 C G 16: 48,565,706 (GRCm38) A564G probably benign Het
Morc2b C A 17: 33,137,402 (GRCm38) W465C probably damaging Het
Morn3 CGG CG 5: 123,046,720 (GRCm38) probably null Het
Mov10l1 G T 15: 88,996,136 (GRCm38) R275I probably benign Het
Mov10l1 G T 15: 89,018,168 (GRCm38) D754Y probably damaging Het
Mov10l1 G T 15: 89,053,411 (GRCm38) D1138Y probably damaging Het
Moxd1 G C 10: 24,284,804 (GRCm38) V452L probably benign Het
Mpdz C A 4: 81,320,490 (GRCm38) L1150F probably damaging Het
Mpl C A 4: 118,443,655 (GRCm38) C559F Het
Mplkip G T 13: 17,695,442 (GRCm38) probably benign Het
Mpp7 C A 18: 7,355,062 (GRCm38) V455F probably damaging Het
Mpped2 G T 2: 106,861,592 (GRCm38) G214V probably damaging Het
Mpped2 G T 2: 106,744,803 (GRCm38) G78W probably damaging Het
Mprip G C 11: 59,757,637 (GRCm38) Q722H probably damaging Het
Mrc1 C T 2: 14,289,116 (GRCm38) P638L probably damaging Het
Mrc1 A C 2: 14,244,138 (GRCm38) N162H probably damaging Het
Mrgpra3 C A 7: 47,601,301 (GRCm38) G2* probably null Het
Mrgpra6 G T 7: 47,189,162 (GRCm38) S65Y possibly damaging Het
Mrgprb2 C A 7: 48,552,973 (GRCm38) M1I probably null Het
Mrgprh T A 17: 12,877,587 (GRCm38) M238K probably damaging Het
Mroh1 G A 15: 76,423,761 (GRCm38) G421S probably damaging Het
Mroh2b G C 15: 4,905,005 (GRCm38) Q119H probably damaging Het
Mroh3 C A 1: 136,192,136 (GRCm38) E442D probably benign Het
Mroh4 A T 15: 74,627,720 (GRCm38) L104Q probably damaging Het
Mroh4 T A 15: 74,628,002 (GRCm38) H84L possibly damaging Het
Mroh6 G T 15: 75,887,818 (GRCm38) P170H probably damaging Het
Mrpl19 A T 6: 81,964,310 (GRCm38) L90Q probably damaging Het
Mrpl9 G T 3: 94,443,373 (GRCm38) G8V probably benign Het
Mrps27 G C 13: 99,414,843 (GRCm38) E371D possibly damaging Het
Mrps28 C A 3: 8,923,746 (GRCm38) L17F probably damaging Het
Mrps36 C A 13: 100,736,270 (GRCm38) G99W probably damaging Het
Mrps9 A G 1: 42,899,458 (GRCm38) T274A probably benign Het
Ms4a13 G T 19: 11,172,584 (GRCm38) P138T probably benign Het
Ms4a4b C A 19: 11,449,938 (GRCm38) T7N possibly damaging Het
Ms4a4c G C 19: 11,421,309 (GRCm38) V164L probably benign Het
Ms4a6b C G 19: 11,520,423 (GRCm38) P29A probably benign Het
Msh4 T A 3: 153,901,443 (GRCm38) probably benign Het
Msh4 C G 3: 153,879,368 (GRCm38) E454D probably benign Het
Msr1 G C 8: 39,631,302 (GRCm38) P71A probably damaging Het
Msx1 C T 5: 37,824,015 (GRCm38) D107N possibly damaging Het
Mt1 C A 8: 94,179,333 (GRCm38) S8Y unknown Het