Incidental Mutation 'Z1177:Eml1'
ID 626914
Institutional Source Beutler Lab
Gene Symbol Eml1
Ensembl Gene ENSMUSG00000058070
Gene Name echinoderm microtubule associated protein like 1
Synonyms A930030P13Rik, ELP79, 1110008N23Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.226) question?
Stock # Z1177 ()
Quality Score 99.0085
Status Not validated
Chromosome 12
Chromosomal Location 108370957-108539617 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) G to T at 108423139 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054955] [ENSMUST00000109857] [ENSMUST00000109860] [ENSMUST00000130999]
AlphaFold Q05BC3
Predicted Effect probably benign
Transcript: ENSMUST00000054955
SMART Domains Protein: ENSMUSP00000057209
Gene: ENSMUSG00000058070

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
WD40 228 277 5.6e-3 SMART
WD40 280 325 2.21e1 SMART
WD40 328 367 4.46e-1 SMART
WD40 375 413 5.73e0 SMART
WD40 416 456 5.75e-1 SMART
WD40 496 539 4.24e-3 SMART
WD40 542 580 1.37e2 SMART
WD40 583 622 1.7e-2 SMART
WD40 629 668 1.58e-2 SMART
Blast:WD40 694 735 7e-20 BLAST
WD40 741 781 2.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109857
SMART Domains Protein: ENSMUSP00000105483
Gene: ENSMUSG00000058070

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
WD40 245 294 5.6e-3 SMART
WD40 297 342 2.21e1 SMART
WD40 345 384 4.46e-1 SMART
WD40 392 430 5.73e0 SMART
WD40 433 473 5.75e-1 SMART
WD40 513 556 4.24e-3 SMART
WD40 559 597 1.37e2 SMART
WD40 600 639 1.7e-2 SMART
WD40 646 685 1.58e-2 SMART
Blast:WD40 711 752 7e-20 BLAST
WD40 758 798 2.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109860
SMART Domains Protein: ENSMUSP00000105486
Gene: ENSMUSG00000058070

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
coiled coil region 31 72 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 150 177 N/A INTRINSIC
Pfam:HELP 184 258 1.8e-35 PFAM
WD40 259 308 5.6e-3 SMART
WD40 311 356 2.21e1 SMART
WD40 359 398 4.46e-1 SMART
WD40 406 444 5.73e0 SMART
WD40 447 487 5.75e-1 SMART
WD40 527 570 4.24e-3 SMART
WD40 573 611 1.37e2 SMART
WD40 614 653 1.7e-2 SMART
WD40 660 699 1.58e-2 SMART
Blast:WD40 725 766 7e-20 BLAST
WD40 772 812 2.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130999
SMART Domains Protein: ENSMUSP00000118325
Gene: ENSMUSG00000058070

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
coiled coil region 31 72 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 150 177 N/A INTRINSIC
WD40 259 308 5.6e-3 SMART
WD40 311 356 2.21e1 SMART
WD40 359 398 4.46e-1 SMART
WD40 406 444 5.73e0 SMART
WD40 447 487 5.75e-1 SMART
WD40 527 570 4.24e-3 SMART
WD40 573 611 1.37e2 SMART
WD40 614 653 1.7e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human echinoderm microtubule-associated protein-like is a strong candidate for the Usher syndrome type 1A gene. Usher syndromes (USHs) are a group of genetic disorders consisting of congenital deafness, retinitis pigmentosa, and vestibular dysfunction of variable onset and severity depending on the genetic type. The disease process in USHs involves the entire brain and is not limited to the posterior fossa or auditory and visual systems. The USHs are catagorized as type I (USH1A, USH1B, USH1C, USH1D, USH1E and USH1F), type II (USH2A and USH2B) and type III (USH3). The type I is the most severe form. Gene loci responsible for these three types are all mapped. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit subcortical band heterotopia associated with seizures, developmental delay and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 4376 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik C A 18: 38,254,303 (GRCm38) H199N probably benign Het
0610010F05Rik C A 11: 23,624,960 (GRCm38) D105Y probably benign Het
1110032F04Rik G T 3: 68,870,272 (GRCm38) V189L probably benign Het
1110032F04Rik C G 3: 68,869,907 (GRCm38) P67R probably damaging Het
1500011B03Rik G T 5: 114,809,287 (GRCm38) L60I possibly damaging Het
1500011B03Rik C G 5: 114,813,872 (GRCm38) C14S possibly damaging Het
1700007G11Rik C A 5: 98,801,834 (GRCm38) S209Y probably damaging Het
1700011L22Rik G A 8: 79,248,296 (GRCm38) R53W probably damaging Het
1700015F17Rik C T 5: 5,457,284 (GRCm38) probably null Het
1700018B08Rik G T 8: 121,539,982 (GRCm38) P36H probably benign Het
1700024G13Rik T A 14: 32,388,365 (GRCm38) probably benign Het
1700061G19Rik AT ATT 17: 56,883,463 (GRCm38) probably null Het
1700080E11Rik G A 9: 105,144,460 (GRCm38) P129L possibly damaging Het
1700093K21Rik T A 11: 23,518,144 (GRCm38) probably null Het
2010111I01Rik G T 13: 63,170,990 (GRCm38) R537L probably damaging Het
2410089E03Rik G T 15: 8,174,972 (GRCm38) G78V probably damaging Het
2410089E03Rik C T 15: 8,209,989 (GRCm38) L1225F probably damaging Het
2700049A03Rik G T 12: 71,164,484 (GRCm38) G664V probably damaging Het
2810021J22Rik C G 11: 58,880,103 (GRCm38) S137C probably damaging Het
3425401B19Rik G T 14: 32,661,398 (GRCm38) P870H probably damaging Het
3425401B19Rik G T 14: 32,659,808 (GRCm38) T1400K possibly damaging Het
4833420G17Rik C A 13: 119,477,808 (GRCm38) T484K not run Het
4921504E06Rik C A 2: 19,480,532 (GRCm38) E441D possibly damaging Het
4921507P07Rik G T 6: 50,591,692 (GRCm38) R86S probably benign Het
4921524L21Rik G A 18: 6,635,865 (GRCm38) G306D probably benign Het
4921530L21Rik C A 14: 95,882,130 (GRCm38) P108T probably benign Het
4930402H24Rik C T 2: 130,710,867 (GRCm38) R1091K probably benign Het
4930444P10Rik T A 1: 16,082,022 (GRCm38) probably benign Het
4930452B06Rik G A 14: 8,517,953 (GRCm38) Q289* probably null Het
4930504O13Rik G T 11: 58,446,274 (GRCm38) N124K probably benign Het
4930516K23Rik C A 7: 104,059,418 (GRCm38) M61I probably damaging Het
4930578C19Rik C A X: 18,420,607 (GRCm38) M236I probably benign Het
4931406P16Rik C G 7: 34,284,755 (GRCm38) A148P probably damaging Het
4931409K22Rik G T 5: 24,550,795 (GRCm38) P243H probably benign Het
4931429L15Rik G A 9: 46,305,838 (GRCm38) S213L probably damaging Het
4932411N23Rik C A X: 126,814,533 (GRCm38) W316C probably damaging Het
4932415D10Rik C A 10: 82,287,126 (GRCm38) R3350M possibly damaging Het
4932415D10Rik G T 10: 82,287,417 (GRCm38) A3253E probably damaging Het
4932415D10Rik G A 10: 82,289,686 (GRCm38) Q2497* probably null Het
4932415D10Rik G T 10: 82,285,798 (GRCm38) H3793N possibly damaging Het
4932438A13Rik G C 3: 36,919,950 (GRCm38) M616I probably benign Het
4932438A13Rik A T 3: 37,036,707 (GRCm38) S782C Het
4932438A13Rik G C 3: 36,983,440 (GRCm38) M2463I possibly damaging Het
4933402J07Rik G C 8: 87,586,117 (GRCm38) G177R probably damaging Het
4933402N22Rik G T 5: 11,918,127 (GRCm38) R28M probably damaging Het
4933405L10Rik C G 8: 105,709,973 (GRCm38) S267C possibly damaging Het
4933405L10Rik A C 8: 105,709,975 (GRCm38) S268R possibly damaging Het
4933406M09Rik G A 1: 134,390,158 (GRCm38) V223M probably damaging Het
4933436I01Rik G T X: 67,920,992 (GRCm38) P87Q probably damaging Het
5031439G07Rik C G 15: 84,950,642 (GRCm38) E372Q possibly damaging Het
5430401F13Rik T G 6: 131,552,721 (GRCm38) L93V possibly damaging Het
5430419D17Rik G T 7: 131,265,866 (GRCm38) V1419F unknown Het
6430628N08Rik G A 4: 115,898,259 (GRCm38) R85H unknown Het
6720489N17Rik C T 13: 62,607,126 (GRCm38) R64K probably null Het
6720489N17Rik C A 13: 62,605,310 (GRCm38) M67I probably benign Het
9130204L05Rik C A 3: 91,088,356 (GRCm38) V80L probably benign Het
9130409I23Rik C A 1: 181,055,417 (GRCm38) P248H probably damaging Het
9130409I23Rik G A 1: 181,059,771 (GRCm38) S307N probably benign Het
9330161L09Rik C G 12: 103,407,507 (GRCm38) R35S unknown Het
9430007A20Rik C G 4: 144,528,500 (GRCm38) Y163* probably null Het
9430007A20Rik C A 4: 144,528,712 (GRCm38) S234* probably null Het
9430015G10Rik A T 4: 156,122,377 (GRCm38) M91L probably benign Het
9530003J23Rik C A 10: 117,235,641 (GRCm38) W111L probably benign Het
9530053A07Rik C T 7: 28,139,898 (GRCm38) P379S probably benign Het
9630041A04Rik C A 9: 101,942,813 (GRCm38) P144Q probably damaging Het
A1bg G T 15: 60,918,074 (GRCm38) H442N possibly damaging Het
A2ml1 C G 6: 128,575,607 (GRCm38) V223L possibly damaging Het
A2ml1 G A 6: 128,561,616 (GRCm38) Q614* probably null Het
A2ml1 G T 6: 128,545,076 (GRCm38) P1261H probably benign Het
A530016L24Rik G T 12: 112,495,076 (GRCm38) G25W probably damaging Het
A530064D06Rik G A 17: 48,166,506 (GRCm38) S81F probably damaging Het
Abat G T 16: 8,603,753 (GRCm38) probably null Het
Abca1 C A 4: 53,086,133 (GRCm38) D457Y possibly damaging Het
Abca1 C A 4: 53,079,584 (GRCm38) K881N probably benign Het
Abca1 C A 4: 53,080,799 (GRCm38) V837L probably benign Het
Abca12 A T 1: 71,276,082 (GRCm38) F1893L possibly damaging Het
Abca12 G T 1: 71,292,531 (GRCm38) L1287I probably damaging Het
Abca12 C A 1: 71,282,811 (GRCm38) D1707Y probably damaging Het
Abca13 AGTGCCTTG AG 11: 9,314,545 (GRCm38) probably null Het
Abca14 G T 7: 120,317,987 (GRCm38) R1458S probably damaging Het
Abca3 CGGG CGGGG 17: 24,408,236 (GRCm38) probably null Het
Abca4 G T 3: 122,173,914 (GRCm38) M2204I probably benign Het
Abca4 C A 3: 122,147,786 (GRCm38) H1634Q possibly damaging Het
Abca5 C G 11: 110,279,328 (GRCm38) V1314L probably benign Het
Abcb11 C A 2: 69,329,269 (GRCm38) probably null Het
Abcb11 C A 2: 69,306,529 (GRCm38) G196V probably damaging Het
Abcb1a G T 5: 8,746,544 (GRCm38) Q1171H probably damaging Het
Abcb1b G T 5: 8,837,596 (GRCm38) M827I probably benign Het
Abcb4 C T 5: 8,939,906 (GRCm38) Q820* probably null Het
Abcb6 C T 1: 75,176,125 (GRCm38) G414D probably damaging Het
Abcc1 A C 16: 14,411,493 (GRCm38) Q363P probably damaging Het
Abcc10 C A 17: 46,307,062 (GRCm38) R1095L probably damaging Het
Abcc12 C A 8: 86,527,384 (GRCm38) A924S possibly damaging Het
Abcc2 T A 19: 43,803,734 (GRCm38) V318E probably benign Het
Abcc2 G A 19: 43,823,100 (GRCm38) W1001* probably null Het
Abcc2 G T 19: 43,803,736 (GRCm38) V319L probably benign Het
Abcc3 C A 11: 94,357,008 (GRCm38) G1220W probably damaging Het
Abcc8 C T 7: 46,154,509 (GRCm38) A414T probably benign Het
Abcc8 A T 7: 46,122,885 (GRCm38) H823Q probably benign Het
Abcc9 T A 6: 142,645,938 (GRCm38) Q788L probably null Het
Abcc9 C A 6: 142,625,982 (GRCm38) G1140V probably benign Het
Abcc9 T A 6: 142,594,758 (GRCm38) Q1485L probably damaging Het
Abce1 C A 8: 79,687,469 (GRCm38) V538F probably benign Het
Abcg1 C G 17: 31,106,166 (GRCm38) A322G probably benign Het
Abcg5 C A 17: 84,676,271 (GRCm38) E113D probably benign Het
Abcg8 C A 17: 84,696,118 (GRCm38) P460T probably damaging Het
Abcg8 A T 17: 84,692,006 (GRCm38) R178W possibly damaging Het
Abcg8 G T 17: 84,695,030 (GRCm38) E336* probably null Het
Abhd12 T A 2: 150,904,414 (GRCm38) K45M probably benign Het
Abhd16a G C 17: 35,099,001 (GRCm38) probably null Het
Abhd16a G T 17: 35,102,475 (GRCm38) G516V probably damaging Het
Abi2 G C 1: 60,437,165 (GRCm38) R132P probably damaging Het
Abl2 A T 1: 156,641,106 (GRCm38) R647W probably damaging Het
Abl2 CA C 1: 156,641,553 (GRCm38) probably null Het
Ablim2 GATCGGTCCTA GA 5: 35,841,293 (GRCm38) probably benign Het
Ablim2 C G 5: 35,824,043 (GRCm38) H232D probably damaging Het
Abtb2 G C 2: 103,711,196 (GRCm38) G815R probably damaging Het
Acad12 C T 5: 121,599,194 (GRCm38) probably null Het
Acads C A 5: 115,111,129 (GRCm38) A351S probably benign Het
Acan A C 7: 79,111,354 (GRCm38) H1938P probably benign Het
Acan C T 7: 79,094,170 (GRCm38) P650S probably damaging Het
Acan G A 7: 79,100,137 (GRCm38) G1552E probably damaging Het
Acap1 T A 11: 69,882,443 (GRCm38) T671S probably benign Het
Acap3 G T 4: 155,905,518 (GRCm38) G748C probably damaging Het
Acat3 G T 17: 12,934,883 (GRCm38) Q104K probably damaging Het
Accs C G 2: 93,848,153 (GRCm38) A19P probably benign Het
Ace C A 11: 105,988,134 (GRCm38) L1172M probably damaging Het
Acin1 C T 14: 54,642,750 (GRCm38) R1332Q unknown Het
Aco2 G T 15: 81,895,312 (GRCm38) A106S probably damaging Het
Aco2 T A 15: 81,895,310 (GRCm38) M105K probably damaging Het
Acot5 G T 12: 84,069,894 (GRCm38) R143L probably benign Het
Acox1 G T 11: 116,175,065 (GRCm38) Q503K probably benign Het
Acox1 C A 11: 116,175,063 (GRCm38) Q503H probably benign Het
Acox1 C A 11: 116,183,545 (GRCm38) E117* probably null Het
Acox2 G A 14: 8,256,852 (GRCm38) P4S probably benign Het
Acpp G T 9: 104,314,418 (GRCm38) P223H probably damaging Het
Acr G A 15: 89,569,879 (GRCm38) E140K possibly damaging Het
Acsbg1 C A 9: 54,614,934 (GRCm38) G499C probably damaging Het
Acsbg1 C G 9: 54,621,966 (GRCm38) S321T possibly damaging Het
Acsbg2 C A 17: 56,853,898 (GRCm38) G249W probably benign Het
Acsf3 G T 8: 122,779,964 (GRCm38) probably benign Het
Acsl6 G T 11: 54,320,172 (GRCm38) E24* probably null Het
Acsm1 C A 7: 119,662,278 (GRCm38) L573I probably benign Het
Acsm2 T A 7: 119,578,093 (GRCm38) L277Q probably damaging Het
Acsm4 C A 7: 119,711,371 (GRCm38) H494N probably damaging Het
Acss2 G T 2: 155,517,957 (GRCm38) probably benign Het
Acss3 G C 10: 107,004,777 (GRCm38) F374L probably damaging Het
Acta1 C A 8: 123,893,471 (GRCm38) probably null Het
Actc1 C A 2: 114,047,513 (GRCm38) E363* probably null Het
Actg1 G T 11: 120,348,109 (GRCm38) L52I probably benign Het
Actl9 G T 17: 33,433,113 (GRCm38) G49V probably damaging Het
Actn2 G T 13: 12,288,562 (GRCm38) L451M probably damaging Het
Actn4 T G 7: 28,919,049 (GRCm38) N62T probably damaging Het
Actr5 G A 2: 158,636,705 (GRCm38) V492I probably benign Het
Actr8 G T 14: 29,986,401 (GRCm38) W212L probably damaging Het
Actr8 G T 14: 29,987,242 (GRCm38) V268L probably damaging Het
Actrt3 A T 3: 30,598,003 (GRCm38) L314Q possibly damaging Het
Adam2 C T 14: 66,056,521 (GRCm38) A286T probably damaging Het
Adam26b G A 8: 43,521,422 (GRCm38) T181I probably benign Het
Adam26b G T 8: 43,520,698 (GRCm38) S422R probably benign Het
Adam28 C A 14: 68,626,784 (GRCm38) W523C probably damaging Het
Adam29 A G 8: 55,871,496 (GRCm38) I641T probably damaging Het
Adam30 A T 3: 98,160,979 (GRCm38) T43S probably damaging Het
Adam33 T A 2: 131,058,662 (GRCm38) H86L possibly damaging Het
Adam39 C A 8: 40,825,295 (GRCm38) T241K probably benign Het
Adamdec1 G T 14: 68,580,643 (GRCm38) T34K probably benign Het
Adamts10 G T 17: 33,545,594 (GRCm38) R696L probably damaging Het
Adamts10 G C 17: 33,545,429 (GRCm38) E676Q possibly damaging Het
Adamts12 G T 15: 11,336,383 (GRCm38) C1518F not run Het
Adamts12 G A 15: 11,317,324 (GRCm38) C1370Y probably damaging Het
Adamts14 C A 10: 61,198,843 (GRCm38) G1086C possibly damaging Het
Adamts15 G T 9: 30,902,491 (GRCm38) R793S probably damaging Het
Adamts19 G T 18: 58,838,075 (GRCm38) G244C probably damaging Het
Adamts19 G T 18: 58,890,374 (GRCm38) R280S possibly damaging Het
Adamts3 C T 5: 89,775,351 (GRCm38) V199I not run Het
Adamts3 G T 5: 89,707,864 (GRCm38) C382* probably null Het
Adamts5 C A 16: 85,870,074 (GRCm38) G510V probably damaging Het
Adamts9 C A 6: 92,854,346 (GRCm38) G1342V probably damaging Het
Adarb2 C T 13: 8,570,200 (GRCm38) P241S probably benign Het
Adck2 C T 6: 39,574,088 (GRCm38) probably benign Het
Adcy1 G T 11: 7,100,642 (GRCm38) E287* probably null Het
Adcy1 A T 11: 7,144,802 (GRCm38) Q576L probably damaging Het
Adcy10 C A 1: 165,510,276 (GRCm38) T153N possibly damaging Het
Adcy5 G A 16: 35,291,544 (GRCm38) V924M not run Het
Adcy8 G T 15: 64,699,177 (GRCm38) P1236T probably benign Het
Adgrb1 G T 15: 74,547,683 (GRCm38) W791L probably damaging Het
Adgrb1 G T 15: 74,541,676 (GRCm38) G570C probably damaging Het
Adgrb2 G T 4: 130,011,826 (GRCm38) D822Y probably damaging Het
Adgrb2 G C 4: 130,019,119 (GRCm38) G1313R probably damaging Het
Adgre1 G T 17: 57,419,374 (GRCm38) C415F probably damaging Het
Adgre4 A T 17: 55,814,152 (GRCm38) probably null Het
Adgrf1 G C 17: 43,310,147 (GRCm38) G425A probably benign Het
Adgrf5 C T 17: 43,445,053 (GRCm38) P634L probably benign Het
Adgrg1 T A 8: 95,007,630 (GRCm38) C377S probably damaging Het
Adgrv1 C G 13: 81,419,256 (GRCm38) W5266S possibly damaging Het
Adipor2 C A 6: 119,357,322 (GRCm38) G309V possibly damaging Het
Adora1 G C 1: 134,234,124 (GRCm38) H78D possibly damaging Het
Adora1 G A 1: 134,234,228 (GRCm38) A43V possibly damaging Het
Adora1 C A 1: 134,203,009 (GRCm38) R308L probably benign Het
Adora2b G A 11: 62,249,426 (GRCm38) V109I probably benign Het
Adora3 G T 3: 105,907,785 (GRCm38) A284S probably damaging Het
Adprhl1 G C 8: 13,245,476 (GRCm38) H212Q possibly damaging Het
Adrm1 G T 2: 180,175,372 (GRCm38) G279V possibly damaging Het
Adrm1 A T 2: 180,174,915 (GRCm38) S198C unknown Het
Aebp2 G T 6: 140,624,094 (GRCm38) A134S unknown Het
Aen G C 7: 78,902,766 (GRCm38) R158P possibly damaging Het
AF529169 G T 9: 89,603,162 (GRCm38) P61T probably damaging Het
Afap1l1 C A 18: 61,752,508 (GRCm38) probably null Het
Aff1 G T 5: 103,783,753 (GRCm38) R79L possibly damaging Het
Afm C A 5: 90,551,383 (GRCm38) T562K possibly damaging Het
Afm C A 5: 90,531,506 (GRCm38) N286K probably benign Het
Afm C A 5: 90,531,616 (GRCm38) P323Q probably damaging Het
Afm C A 5: 90,521,946 (GRCm38) T44K probably benign Het
Agbl1 C A 7: 76,720,206 (GRCm38) S936R unknown Het
Agbl3 T G 6: 34,799,408 (GRCm38) F283C probably damaging Het
Agl T A 3: 116,781,036 (GRCm38) I40F Het
Agmat C A 4: 141,746,979 (GRCm38) P57Q possibly damaging Het
Ago1 C A 4: 126,453,656 (GRCm38) W433C probably damaging Het
Agrn C G 4: 156,179,576 (GRCm38) V184L possibly damaging Het
Agrn C A 4: 156,171,544 (GRCm38) E1447* probably null Het
Ahctf1 C G 1: 179,793,730 (GRCm38) A157P probably damaging Het
Ahcyl1 C T 3: 107,673,435 (GRCm38) probably null Het
Ahi1 G T 10: 21,041,007 (GRCm38) probably benign Het
Ahnak G T 19: 9,017,468 (GRCm38) G5372V probably damaging Het
Ahnak2 C A 12: 112,781,199 (GRCm38) G1676V Het
Ahrr T G 13: 74,224,776 (GRCm38) H185P probably benign Het
Ahsg C A 16: 22,899,047 (GRCm38) P337Q probably damaging Het
AI182371 A C 2: 35,095,759 (GRCm38) probably null Het
AI314180 C A 4: 58,861,614 (GRCm38) D322Y probably damaging Het
AI413582 G T 17: 27,564,645 (GRCm38) P10T probably benign Het
AI593442 G T 9: 52,677,912 (GRCm38) P122T possibly damaging Het
AI597479 G T 1: 43,111,119 (GRCm38) A130S probably benign Het
Aifm3 G T 16: 17,503,720 (GRCm38) R479L probably benign Het
Aifm3 G T 16: 17,500,934 (GRCm38) G206C probably benign Het
Ajap1 C A 4: 153,432,435 (GRCm38) G150C probably benign Het
Ajap1 C A 4: 153,432,436 (GRCm38) Q149H probably damaging Het
Akap13 G C 7: 75,615,005 (GRCm38) G532A probably benign Het
Akap2 G A 4: 57,856,348 (GRCm38) G559E probably damaging Het
Akap9 A T 5: 4,046,189 (GRCm38) N2355Y probably damaging Het
Akp3 G T 1: 87,126,445 (GRCm38) probably null Het
Akr1c12 G C 13: 4,272,954 (GRCm38) L219V probably damaging Het
Akr1c20 G T 13: 4,523,244 (GRCm38) S24Y probably benign Het
Alb A T 5: 90,468,512 (GRCm38) Q292L probably damaging Het
Aldh16a1 C A 7: 45,145,903 (GRCm38) G444V probably null Het
Aldh1a2 T A 9: 71,283,522 (GRCm38) V349E probably benign Het
Aldh1b1 G C 4: 45,802,692 (GRCm38) D77H probably damaging Het
Aldh1l1 C A 6: 90,564,449 (GRCm38) A275E probably benign Het
Aldh1l2 G T 10: 83,493,480 (GRCm38) A822D probably damaging Het
Aldh1l2 G A 10: 83,534,005 (GRCm38) R4W probably benign Het
Aldh5a1 C G 13: 24,911,638 (GRCm38) G499R probably damaging Het
Aldh7a1 T A 18: 56,526,991 (GRCm38) T528S probably benign Het
Alg1 G C 16: 5,239,967 (GRCm38) G268R probably benign Het
Alg8 G T 7: 97,371,662 (GRCm38) A9S probably benign Het
Alg9 G C 9: 50,788,173 (GRCm38) G166A probably damaging Het
Alk G T 17: 72,603,063 (GRCm38) S216Y probably damaging Het
Alox12 C A 11: 70,251,479 (GRCm38) G308C possibly damaging Het
Alox8 G A 11: 69,185,221 (GRCm38) R635W probably damaging Het
Alpk1 C A 3: 127,685,307 (GRCm38) W30C Het
Als2cl C A 9: 110,895,817 (GRCm38) Y786* probably null Het
Als2cl G A 9: 110,888,528 (GRCm38) G279S probably benign Het
Alx3 C A 3: 107,604,834 (GRCm38) P263T probably damaging Het
Alx4 G T 2: 93,642,656 (GRCm38) probably benign Het
Ambra1 C A 2: 91,900,608 (GRCm38) N1030K possibly damaging Het
Ambra1 G T 2: 91,768,999 (GRCm38) A155S possibly damaging Het
Ambra1 G T 2: 91,875,786 (GRCm38) W865C probably damaging Het
Amer3 C A 1: 34,587,196 (GRCm38) S172* probably null Het
Amh G C 10: 80,807,586 (GRCm38) E535Q possibly damaging Het
Amot C A X: 145,480,458 (GRCm38) R110S Het
Ampd3 A T 7: 110,788,780 (GRCm38) Q131L probably damaging Het
Amph G C 13: 19,139,334 (GRCm38) D589H possibly damaging Het
Amy1 A T 3: 113,558,353 (GRCm38) W397R probably damaging Het
Amy2a1 C A 3: 113,530,532 (GRCm38) A120S not run Het
Anapc15 G T 7: 101,901,039 (GRCm38) E153D unknown Het
Angptl6 C A 9: 20,878,411 (GRCm38) G62C probably damaging Het
Ank2 T C 3: 126,944,357 (GRCm38) Q2626R unknown Het
Ankk1 G T 9: 49,416,487 (GRCm38) A464E probably damaging Het
Ankk1 C A 9: 49,415,944 (GRCm38) G645V probably damaging Het
Ankra2 G T 13: 98,272,277 (GRCm38) V263L possibly damaging Het
Ankrd11 C A 8: 122,900,142 (GRCm38) Q100H probably damaging Het
Ankrd17 C T 5: 90,289,325 (GRCm38) A554T possibly damaging Het
Ankrd17 C A 5: 90,283,505 (GRCm38) A807S possibly damaging Het
Ankrd2 G T 19: 42,044,999 (GRCm38) A327S Het
Ankrd2 A G 19: 42,040,159 (GRCm38) I85V Het
Ankrd22 CT CTT 19: 34,123,491 (GRCm38) probably null Het
Ankrd26 C A 6: 118,523,532 (GRCm38) A993S possibly damaging Het
Ankrd26 C T 6: 118,523,595 (GRCm38) E972K probably damaging Het
Ankrd27 G T 7: 35,603,878 (GRCm38) V228L possibly damaging Het
Ankrd33b C A 15: 31,305,133 (GRCm38) probably null Het
Ankrd35 G T 3: 96,683,770 (GRCm38) Q457H probably damaging Het
Ankrd36 G T 11: 5,571,117 (GRCm38) W88C probably damaging Het
Ankrd36 G A 11: 5,629,345 (GRCm38) S203N probably benign Het
Ankrd36 C A 11: 5,643,738 (GRCm38) P448T probably damaging Het
Ankrd45 G T 1: 161,160,752 (GRCm38) K193N possibly damaging Het
Ankrd45 G T 1: 161,160,738 (GRCm38) G189W probably damaging Het
Ankrd50 C G 3: 38,455,792 (GRCm38) A809P probably damaging Het
Ankrd53 C G 6: 83,765,783 (GRCm38) L253V possibly damaging Het
Ankrd7 G A 6: 18,866,564 (GRCm38) A28T possibly damaging Het
Ano2 G T 6: 126,013,207 (GRCm38) A764S probably damaging Het
Ano2 G A 6: 126,015,647 (GRCm38) G861E probably damaging Het
Ano7 C A 1: 93,401,527 (GRCm38) A681E probably damaging Het
Antxrl TC T 14: 34,067,930 (GRCm38) probably null Het
Anxa11 G T 14: 25,870,176 (GRCm38) G55C unknown Het
Aox2 C A 1: 58,354,397 (GRCm38) P1239T possibly damaging Het
Ap1s1 C A 5: 137,045,233 (GRCm38) probably benign Het
Ap2b1 G T 11: 83,365,753 (GRCm38) G713V probably damaging Het
Ap3m2 C T 8: 22,791,321 (GRCm38) S312N probably benign Het
Ap5b1 G T 19: 5,570,928 (GRCm38) G792V probably damaging Het
Apba2 G T 7: 64,750,235 (GRCm38) V725L probably benign Het
Apbb1ip G T 2: 22,875,103 (GRCm38) A599S unknown Het
Apc G T 18: 34,314,463 (GRCm38) V1471L probably benign Het
Apc2 C A 10: 80,312,036 (GRCm38) R975S probably damaging Het
Apcdd1 G T 18: 62,922,691 (GRCm38) G10* probably null Het
Aplp1 C A 7: 30,438,189 (GRCm38) R482L probably benign Het
Aplp1 T A 7: 30,438,279 (GRCm38) probably null Het
Apoa5 G A 9: 46,269,119 (GRCm38) A8T possibly damaging Het
Apob GCC GC 12: 8,015,249 (GRCm38) probably null Het
Apob C A 12: 7,988,765 (GRCm38) L406I probably benign Het
Apobec4 G T 1: 152,756,726 (GRCm38) W168C probably damaging Het
Apod C T 16: 31,297,520 (GRCm38) V131M probably damaging Het
Apol11b A C 15: 77,638,007 (GRCm38) I30R probably benign Het
Aqp4 C G 18: 15,399,881 (GRCm38) G52R possibly damaging Het
Arcn1 C G 9: 44,757,253 (GRCm38) G229R probably damaging Het
Arf6 G T 12: 69,372,407 (GRCm38) probably benign Het
Arfgap2 C T 2: 91,275,104 (GRCm38) S468L probably benign Het
Arfgap3 C A 15: 83,332,688 (GRCm38) E159* probably null Het
Arfgef3 C A 10: 18,627,628 (GRCm38) V1010L probably damaging Het
Arfgef3 A C 10: 18,607,776 (GRCm38) I1400S probably damaging Het
Arhgap20 C A 9: 51,824,924 (GRCm38) L179I probably damaging Het
Arhgap30 A C 1: 171,407,908 (GRCm38) K617Q probably benign Het
Arhgap32 G T 9: 32,260,680 (GRCm38) Q1585H probably damaging Het
Arhgap33 C G 7: 30,522,817 (GRCm38) R1230P probably damaging Het
Arhgef10l C A 4: 140,516,772 (GRCm38) R852L probably benign Het
Arhgef16 G T 4: 154,281,453 (GRCm38) S501Y probably damaging Het
Arhgef26 C A 3: 62,339,930 (GRCm38) T145N probably benign Het
Arhgef28 C A 13: 97,899,756 (GRCm38) G1665V probably benign Het
Arhgef33 G T 17: 80,384,230 (GRCm38) G50V unknown Het
Arhgef38 C A 3: 133,206,961 (GRCm38) E106* probably null Het
Arhgef4 C G 1: 34,724,259 (GRCm38) S865R probably benign Het
Arhgef4 C G 1: 34,722,921 (GRCm38) S419R unknown Het
Arhgef4 A G 1: 34,723,366 (GRCm38) S568G unknown Het
Arhgef6 C A X: 57,304,624 (GRCm38) probably benign Het
Arid1a C A 4: 133,680,916 (GRCm38) W1708C unknown Het
Arid1b G T 17: 4,996,328 (GRCm38) A464S possibly damaging Het
Arid2 A C 15: 96,390,986 (GRCm38) Q1672P probably damaging Het
Arid3a A C 10: 79,949,430 (GRCm38) Q344P probably damaging Het
Arid3c C A 4: 41,730,177 (GRCm38) R6M possibly damaging Het
Arid4a G A 12: 71,075,637 (GRCm38) E931K possibly damaging Het
Arid5b C T 10: 68,097,228 (GRCm38) R948Q probably damaging Het
Arl11 CA CAA 14: 61,310,868 (GRCm38) probably null Het
Armc1 G T 3: 19,149,574 (GRCm38) L63I probably benign Het
Armc3 C A 2: 19,285,991 (GRCm38) T427K probably benign Het
Armc5 G T 7: 128,244,663 (GRCm38) R876L probably damaging Het
Armc5 C A 7: 128,240,830 (GRCm38) T440N probably damaging Het
Armc5 G T 7: 128,240,625 (GRCm38) G372C probably damaging Het
Armc8 C T 9: 99,497,386 (GRCm38) A496T probably damaging Het
Armc9 G C 1: 86,196,355 (GRCm38) R417P probably benign Het
Armc9 G C 1: 86,176,825 (GRCm38) E265D probably damaging Het
Armcx4 C A X: 134,693,042 (GRCm38) A1233D not run Het
Armcx6 C A X: 134,749,992 (GRCm38) G30V probably damaging Het
Arnt2 G A 7: 84,263,207 (GRCm38) T575I possibly damaging Het
Arsj G T 3: 126,438,909 (GRCm38) G435C probably damaging Het
Art3 C G 5: 92,412,206 (GRCm38) L75V unknown Het
Art4 G T 6: 136,849,583 (GRCm38) P299T probably damaging Het
Arvcf T A 16: 18,389,299 (GRCm38) L41Q probably damaging Het
Asb14 T C 14: 26,912,299 (GRCm38) V487A probably benign Het
Asb3 C G 11: 31,058,965 (GRCm38) P250A possibly damaging Het
Ascc3 A T 10: 50,718,421 (GRCm38) H1204L probably benign Het
Asic2 G A 11: 81,152,240 (GRCm38) R76C possibly damaging Het
Asic2 G T 11: 81,152,090 (GRCm38) R126S probably benign Het
Asic2 G C 11: 80,894,011 (GRCm38) I367M possibly damaging Het
Asic4 A T 1: 75,469,220 (GRCm38) Q231L probably benign Het
Aspdh G T 7: 44,465,530 (GRCm38) R20L probably damaging Het
Aspg G A 12: 112,121,021 (GRCm38) V304M probably damaging Het
Asprv1 C A 6: 86,628,344 (GRCm38) S57R probably damaging Het
Asxl2 A C 12: 3,474,589 (GRCm38) S206R probably damaging Het
Asxl3 C G 18: 22,523,591 (GRCm38) R1553G probably damaging Het
Asxl3 G T 18: 22,516,339 (GRCm38) V462L probably benign Het
Atf7ip2 A T 16: 10,241,640 (GRCm38) Q348L possibly damaging Het
Atg2b C A 12: 105,635,764 (GRCm38) R1651L probably damaging Het
Atg9b C T 5: 24,391,787 (GRCm38) G44R probably benign Het
Atl3 G T 19: 7,530,553 (GRCm38) A357S probably benign Het
Atn1 C A 6: 124,745,035 (GRCm38) G952C unknown Het
Atoh8 C A 6: 72,235,126 (GRCm38) K13N probably damaging Het
Atp10b G C 11: 43,153,349 (GRCm38) G134A probably benign Het
Atp11b G T 3: 35,806,854 (GRCm38) M363I probably benign Het
Atp12a C A 14: 56,373,215 (GRCm38) T272K probably damaging Het
Atp13a5 C A 16: 29,280,969 (GRCm38) W761C probably damaging Het
Atp1a2 G T 1: 172,287,336 (GRCm38) T294K probably damaging Het
Atp1a3 C A 7: 24,980,119 (GRCm38) V904L probably benign Het
Atp1b3 C A 9: 96,333,560 (GRCm38) L267F probably damaging Het
Atp2a3 C G 11: 72,980,327 (GRCm38) S582R possibly damaging Het
Atp2b1 G T 10: 99,018,848 (GRCm38) R1101L probably damaging Het
Atp2c2 C A 8: 119,734,385 (GRCm38) T239N probably benign Het
Atp4a G T 7: 30,717,840 (GRCm38) Q549H possibly damaging Het
Atp4b GGTTCCAACAGTAGT GGT 8: 13,396,684 (GRCm38) probably benign Het
Atp4b C A 8: 13,389,794 (GRCm38) A143S probably benign Het
Atp5s G A 12: 69,740,962 (GRCm38) probably benign Het
Atp7b C A 8: 21,994,877 (GRCm38) R1388L probably benign Het
Atp8a2 C A 14: 60,006,330 (GRCm38) R642L possibly damaging Het
Atp8b3 A T 10: 80,531,077 (GRCm38) V229E probably benign Het
Atp8b4 A T 2: 126,433,943 (GRCm38) L123Q probably damaging Het
Atp8b4 T A 2: 126,322,824 (GRCm38) T1191S probably benign Het
Atp8b5 T A 4: 43,370,669 (GRCm38) L982I probably benign Het
Atr A T 9: 95,888,100 (GRCm38) R1194S probably benign Het
Atrn G T 2: 130,946,042 (GRCm38) G255C probably damaging Het
Atxn7l3b C G 10: 112,928,479 (GRCm38) G82R probably damaging Het
Atxn7l3b T A 10: 112,928,454 (GRCm38) Q90L possibly damaging Het
AU040320 G C 4: 126,842,633 (GRCm38) Q836H probably benign Het
Aup1 A G 6: 83,057,524 (GRCm38) E437G unknown Het
Axin2 G T 11: 108,923,474 (GRCm38) G63W probably damaging Het
Axl C A 7: 25,761,526 (GRCm38) G686V probably damaging Het
B020004C17Rik C T 14: 57,015,260 (GRCm38) Q2* probably null Het
B230359F08Rik G A 14: 53,795,507 (GRCm38) probably benign Het
B3galt1 G T 2: 68,117,990 (GRCm38) W16C probably damaging Het
B3galt4 C A 17: 33,951,136 (GRCm38) A43S unknown Het
B3galt5 G C 16: 96,316,032 (GRCm38) Q288H probably benign Het
B3galt5 C A 16: 96,315,379 (GRCm38) R71S probably damaging Het
B3gntl1 C T 11: 121,639,814 (GRCm38) D144N probably benign Het
B4galt2 C A 4: 117,881,069 (GRCm38) M113I probably benign Het
Babam1 G T 8: 71,399,563 (GRCm38) V132F probably benign Het
Bag6 A C 17: 35,142,924 (GRCm38) Q510P unknown Het
Bahcc1 G A 11: 120,272,921 (GRCm38) V682M possibly damaging Het
Baz2b C G 2: 59,977,520 (GRCm38) A132P probably benign Het
Bbox1 C A 2: 110,270,188 (GRCm38) K221N probably benign Het
Bbs5 G A 2: 69,665,071 (GRCm38) V288M probably benign Het
Bbs7 C T 3: 36,602,920 (GRCm38) G253E probably damaging Het
BC016579 C A 16: 45,648,896 (GRCm38) V70F possibly damaging Het
BC027072 C A 17: 71,750,403 (GRCm38) G760W probably damaging Het
BC049762 G C 11: 51,253,968 (GRCm38) A106G probably benign Het
BC051019 G T 7: 109,720,640 (GRCm38) P72Q probably benign Het
BC055324 T A 1: 163,964,517 (GRCm38) R611W probably damaging Het
Bcam C A 7: 19,760,107 (GRCm38) A420S probably null Het
Bcar3 G C 3: 122,505,018 (GRCm38) R144P probably damaging Het
Bcl11b C A 12: 107,989,740 (GRCm38) G50V probably damaging Het
Bcl2a1a G T 9: 88,957,466 (GRCm38) G139V probably damaging Het
Bcl2a1c A C 9: 114,330,468 (GRCm38) T105P probably benign Het
Bcl2l11 G T 2: 128,147,193 (GRCm38) R164M probably damaging Het
Bcl2l11 C G 2: 128,128,995 (GRCm38) N121K probably damaging Het
Bdh1 A G 16: 31,455,177 (GRCm38) K187E possibly damaging Het
Bdh1 C T 16: 31,455,175 (GRCm38) A186V possibly damaging Het
Bdp1 T A 13: 100,061,396 (GRCm38) K827M probably damaging Het
Best1 G C 19: 9,993,239 (GRCm38) S79C probably damaging Het
Bfar G T 16: 13,688,810 (GRCm38) V175L probably benign Het
Bid C T 6: 120,900,258 (GRCm38) E41K probably damaging Het
Birc6 G T 17: 74,647,280 (GRCm38) A3376S probably benign Het
Bmp2k G T 5: 97,053,156 (GRCm38) A312S probably damaging Het
Bmpr2 G A 1: 59,847,167 (GRCm38) R321Q not run Het
Bnc1 C A 7: 81,968,470 (GRCm38) R949L probably damaging Het
Bpifa3 C G 2: 154,136,292 (GRCm38) T138R possibly damaging Het
Bpifb3 C T 2: 153,925,789 (GRCm38) P261S probably benign Het
Bpnt1 G A 1: 185,352,269 (GRCm38) G188R probably damaging Het
Brd2 C A 17: 34,116,908 (GRCm38) probably benign Het
Brd2 C A 17: 34,116,907 (GRCm38) probably null Het
Brinp2 C A 1: 158,246,782 (GRCm38) V590L possibly damaging Het
Brpf3 G T 17: 28,821,478 (GRCm38) D958Y probably benign Het
Brsk1 G C 7: 4,704,222 (GRCm38) C258S probably damaging Het
Bsn C T 9: 108,105,499 (GRCm38) R913H Het
Bsn G C 9: 108,139,195 (GRCm38) L206V probably damaging Het
Bst1 C A 5: 43,819,032 (GRCm38) P36T probably damaging Het
Btbd10 C G 7: 113,332,689 (GRCm38) V169L probably benign Het
Btbd18 G T 2: 84,661,568 (GRCm38) G31V probably damaging Het
Btbd7 C T 12: 102,811,120 (GRCm38) E483K probably damaging Het
Btla C A 16: 45,239,272 (GRCm38) P113Q possibly damaging Het
Btnl2 G T 17: 34,363,519 (GRCm38) R353L probably benign Het
Btnl4 C A 17: 34,470,060 (GRCm38) probably null Het
Bud13 G C 9: 46,291,740 (GRCm38) R487P probably damaging Het
C1qb C A 4: 136,882,281 (GRCm38) W9C probably benign Het
C1qtnf1 G C 11: 118,443,754 (GRCm38) W20S probably benign Het
C1qtnf12 G T 4: 155,965,649 (GRCm38) R202L probably damaging Het
C1qtnf4 G T 2: 90,889,505 (GRCm38) G41C probably damaging Het
C1s2 G T 6: 124,625,734 (GRCm38) A506D possibly damaging Het
C2cd4b C G 9: 67,759,799 (GRCm38) P26A probably damaging Het
C2cd5 C A 6: 143,029,206 (GRCm38) E820D probably null Het
C3 G T 17: 57,226,171 (GRCm38) S144Y probably damaging Het
C3 G A 17: 57,217,144 (GRCm38) A964V probably benign Het
C7 C T 15: 5,015,375 (GRCm38) D394N probably benign Het
C9 C A 15: 6,491,519 (GRCm38) P482T probably damaging Het
Cabin1 C T 10: 75,648,123 (GRCm38) A2043T probably benign Het
Cables1 G T 18: 11,941,317 (GRCm38) G525V probably damaging Het
Cabp4 G T 19: 4,136,222 (GRCm38) L227M probably damaging Het
Cacna1a C A 8: 84,579,491 (GRCm38) D1289E probably damaging Het
Cacna1b T G 2: 24,638,677 (GRCm38) M1609L probably damaging Het
Cacna1b G T 2: 24,678,988 (GRCm38) H975N probably damaging Het
Cacna1b G T 2: 24,661,790 (GRCm38) P1115H probably damaging Het
Cacna1c G T 6: 118,757,661 (GRCm38) probably benign Het
Cacna1e G T 1: 154,442,292 (GRCm38) A1448E probably damaging Het
Cacna1g C A 11: 94,459,596 (GRCm38) Q474H probably benign Het
Cacna1g C A 11: 94,473,590 (GRCm38) A10S probably benign Het
Cacna1h C A 17: 25,393,584 (GRCm38) W380L probably benign Het
Cacna1h T A 17: 25,391,378 (GRCm38) E718V probably damaging Het
Cacna1h C A 17: 25,375,892 (GRCm38) E2097D probably damaging Het
Cacna1i G T 15: 80,389,383 (GRCm38) G1757C possibly damaging Het
Cacna1i G T 15: 80,381,179 (GRCm38) R1544L possibly damaging Het
Cacna1s G C 1: 136,117,686 (GRCm38) A1691P probably benign Het
Cacna2d3 A C 14: 29,347,163 (GRCm38) D232E possibly damaging Het
Cad G T 5: 31,075,128 (GRCm38) D1846Y probably benign Het
Cad G T 5: 31,068,421 (GRCm38) G1017V probably damaging Het
Cadps C G 14: 12,465,880 (GRCm38) R1010P probably damaging Het
Cadps2 C G 6: 23,626,695 (GRCm38) S198T probably damaging Het
Cadps2 A T 6: 23,385,478 (GRCm38) L782I possibly damaging Het
Cadps2 G T 6: 23,838,818 (GRCm38) P107H probably damaging Het
Calcb G T 7: 114,722,162 (GRCm38) probably null Het
Calm4 G C 13: 3,838,199 (GRCm38) V102L possibly damaging Het
Calml3 C A 13: 3,804,011 (GRCm38) D18Y probably damaging Het
Caln1 C A 5: 130,839,314 (GRCm38) C230* probably null Het
Calr4 G T 4: 109,235,733 (GRCm38) W3C probably benign Het
Calu G T 6: 29,372,515 (GRCm38) V230L probably damaging Het
Camta1 A T 4: 151,077,925 (GRCm38) L454Q probably damaging Het
Camta2 C A 11: 70,675,221 (GRCm38) G746* probably null Het
Capg G A 6: 72,556,230 (GRCm38) C166Y probably damaging Het
Capn12 T A 7: 28,887,828 (GRCm38) W380R probably damaging Het
Capn15 T A 17: 25,973,220 (GRCm38) H16L probably benign Het
Capn8 G T 1: 182,613,346 (GRCm38) E448D probably benign Het
Caprin1 C G 2: 103,775,934 (GRCm38) E320D probably null Het
Car12 C A 9: 66,751,954 (GRCm38) P39Q probably benign Het
Car3 G T 3: 14,871,636 (GRCm38) R253M Het
Car4 C G 11: 84,963,419 (GRCm38) P64R possibly damaging Het
Car5a C T 8: 121,916,373 (GRCm38) M297I probably benign Het
Car8 G C 4: 8,221,594 (GRCm38) R126G probably damaging Het
Card10 G T 15: 78,795,328 (GRCm38) P307T probably benign Het
Card11 T A 5: 140,898,241 (GRCm38) I428F probably benign Het
Card14 C A 11: 119,341,061 (GRCm38) H818Q probably damaging Het
Card9 G C 2: 26,357,551 (GRCm38) R241G probably damaging Het
Carf A C 1: 60,136,262 (GRCm38) probably null Het
Casd1 G T 6: 4,631,531 (GRCm38) W549L possibly damaging Het
Caskin1 T A 17: 24,496,687 (GRCm38) C142S probably damaging Het
Caskin2 C T 11: 115,806,781 (GRCm38) A110T possibly damaging Het
Cass4 C T 2: 172,427,575 (GRCm38) Q526* probably null Het
Cast C A 13: 74,725,463 (GRCm38) K402N probably damaging Het
Casz1 C A 4: 148,933,306 (GRCm38) P351T probably damaging Het
Casz1 T C 4: 148,944,359 (GRCm38) L1087P probably benign Het
Catsper1 A T 19: 5,343,883 (GRCm38) Q641L probably damaging Het
Catsperb G C 12: 101,446,048 (GRCm38) W131C probably damaging Het
Catspere2 G T 1: 178,156,802 (GRCm38) probably benign Het
Catsperg2 A T 7: 29,697,782 (GRCm38) W1099R possibly damaging Het
Cbarp G C 10: 80,131,872 (GRCm38) R512G probably damaging Het
Cbarp G T 10: 80,133,060 (GRCm38) P367T probably damaging Het
Cbfa2t3 G A 8: 122,630,757 (GRCm38) P605S probably benign Het
Cblc T G 7: 19,785,278 (GRCm38) D419A probably benign Het
Cbr2 G C 11: 120,730,279 (GRCm38) A164G possibly damaging Het
Cbs C G 17: 31,625,882 (GRCm38) probably null Het
Cbx4 C T 11: 119,085,766 (GRCm38) W35* probably null Het
Cbx7 G T 15: 79,933,884 (GRCm38) L6M unknown Het
Cc2d2a C T 5: 43,703,204 (GRCm38) P541S probably benign Het
Ccdc121 G A 1: 181,510,739 (GRCm38) T216M probably damaging Het
Ccdc129 G T 6: 55,968,234 (GRCm38) G647C probably damaging Het
Ccdc14 G C 16: 34,723,670 (GRCm38) K847N probably damaging Het
Ccdc141 G T 2: 77,015,149 (GRCm38) S1191R probably benign Het
Ccdc157 G A 11: 4,146,547 (GRCm38) Q503* probably null Het
Ccdc162 G T 10: 41,683,195 (GRCm38) A136D probably benign Het
Ccdc170 A C 10: 4,509,884 (GRCm38) T5P probably benign Het
Ccdc177 G T 12: 80,757,736 (GRCm38) A588E unknown Het
Ccdc178 G T 18: 22,109,731 (GRCm38) R276S possibly damaging Het
Ccdc185 G T 1: 182,748,514 (GRCm38) N203K possibly damaging Het
Ccdc191 G C 16: 43,939,122 (GRCm38) E429Q possibly damaging Het
Ccdc25 A T 14: 65,865,128 (GRCm38) probably null Het
Ccdc27 C A 4: 154,036,471 (GRCm38) M289I unknown Het
Ccdc33 G T 9: 58,118,585 (GRCm38) Q54K possibly damaging Het
Ccdc38 C A 10: 93,562,876 (GRCm38) S172Y probably damaging Het
Ccdc40 C T 11: 119,254,398 (GRCm38) S973L probably benign Het
Ccdc40 C G 11: 119,238,107 (GRCm38) R390G probably damaging Het
Ccdc60 C A 5: 116,288,709 (GRCm38) probably benign Het
Ccdc68 G T 18: 69,947,050 (GRCm38) probably null Het
Ccdc71l G C 12: 32,379,615 (GRCm38) R211P possibly damaging Het
Ccdc73 C A 2: 104,992,239 (GRCm38) C16* probably null Het
Ccdc7a C A 8: 128,807,924 (GRCm38) R1357L possibly damaging Het
Ccdc81 T A 7: 89,881,657 (GRCm38) Q359L probably damaging Het
Ccdc85a C A 11: 28,583,491 (GRCm38) A18S probably benign Het
Ccdc88c G T 12: 100,945,155 (GRCm38) H807N probably benign Het
Ccdc90b G A 7: 92,568,557 (GRCm38) M102I possibly damaging Het
Cchcr1 G T 17: 35,528,663 (GRCm38) Q532H probably damaging Het
Ccin G T 4: 43,984,902 (GRCm38) K436N probably benign Het
Ccl17 G T 8: 94,811,189 (GRCm38) R35L possibly damaging Het
Ccna2 C A 3: 36,571,701 (GRCm38) Q41H probably benign Het
Ccnt2 G T 1: 127,803,058 (GRCm38) K557N probably damaging Het
Ccny T G 18: 9,353,494 (GRCm38) Q93P probably benign Het
Ccr4 C G 9: 114,492,839 (GRCm38) G53R probably damaging Het
Ccr8 C G 9: 120,094,499 (GRCm38) L227V probably benign Het
Cct7 G T 6: 85,466,669 (GRCm38) D340Y possibly damaging Het
Cd101 G T 3: 101,017,140 (GRCm38) Q328K probably benign Het
Cd101 A C 3: 101,011,916 (GRCm38) D627E probably benign Het
Cd109 G T 9: 78,691,313 (GRCm38) Q944H probably damaging Het
Cd163 G A 6: 124,317,385 (GRCm38) V501I probably benign Het
Cd177 C A 7: 24,760,256 (GRCm38) G11W probably damaging Het
Cd180 C A 13: 102,706,032 (GRCm38) H529N possibly damaging Het
Cd2 G C 3: 101,276,106 (GRCm38) R296G probably damaging Het
Cd200 C A 16: 45,394,688 (GRCm38) R200L possibly damaging Het
Cd209e T A 8: 3,851,181 (GRCm38) S158C probably null Het
Cd244 T A 1: 171,574,350 (GRCm38) C215S probably damaging Het
Cd248 G C 19: 5,069,165 (GRCm38) G347A probably damaging Het
Cd6 G C 19: 10,791,445 (GRCm38) R503G probably damaging Het
Cd8a G T 6: 71,374,593 (GRCm38) R179L possibly damaging Het
Cdc42bpg G A 19: 6,314,523 (GRCm38) G594S probably damaging Het
Cdc42bpg A T 19: 6,309,746 (GRCm38) E119V probably damaging Het
Cdc42bpg C A 19: 6,314,522 (GRCm38) N593K possibly damaging Het
Cdc42ep2 C A 19: 5,918,108 (GRCm38) D190Y probably damaging Het
Cdc42ep2 G A 19: 5,918,645 (GRCm38) R11C probably damaging Het
Cdc42ep3 C A 17: 79,334,898 (GRCm38) D198Y probably damaging Het
Cdc42ep3 C A 17: 79,334,878 (GRCm38) M204I probably benign Het
Cdca2 C A 14: 67,680,244 (GRCm38) K568N probably damaging Het
Cdh1 G A 8: 106,656,839 (GRCm38) V237M probably damaging Het
Cdh16 T G 8: 104,623,440 (GRCm38) probably null Het
Cdh22 C A 2: 165,146,680 (GRCm38) G252C probably damaging Het
Cdh23 T A 10: 60,434,614 (GRCm38) probably null Het
Cdh23 C A 10: 60,323,555 (GRCm38) R2149L possibly damaging Het
Cdh4 C A 2: 179,780,326 (GRCm38) A81E probably benign Het
Cdh9 C T 15: 16,850,364 (GRCm38) P528S probably benign Het
Cdhr2 A T 13: 54,726,408 (GRCm38) R764S probably benign Het
Cdhr2 C A 13: 54,715,671 (GRCm38) P122T probably damaging Het
Cdhr2 G T 13: 54,718,564 (GRCm38) C361F probably damaging Het
Cdipt A T 7: 126,976,944 (GRCm38) I24F probably benign Het
Cdk14 C A 5: 4,888,894 (GRCm38) G461W possibly damaging Het
Cdk5rap3 C G 11: 96,912,216 (GRCm38) probably null Het
Cdk8 A T 5: 146,299,796 (GRCm38) R340S probably damaging Het
Cdk8 G A 5: 146,299,795 (GRCm38) R340K probably damaging Het
Cdk8 G T 5: 146,301,637 (GRCm38) S379I probably benign Het
Cdkl4 G T 17: 80,550,858 (GRCm38) L111I probably damaging Het
Cdkl5 C A X: 160,824,045 (GRCm38) V736F probably benign Het
Cdkn1c C A 7: 143,460,316 (GRCm38) G131V probably damaging Het
Cdnf G A 2: 3,521,083 (GRCm38) S104N possibly damaging Het
Cdon G T 9: 35,491,900 (GRCm38) C1102F probably damaging Het
Cdyl G C 13: 35,816,070 (GRCm38) R111S probably benign Het
Ceacam12 G C 7: 18,067,515 (GRCm38) V140L probably damaging Het
Ceacam19 G T 7: 19,886,449 (GRCm38) P86T probably damaging Het
Ceacam19 G T 7: 19,882,844 (GRCm38) A175D probably damaging Het
Ceacam20 G A 7: 19,970,164 (GRCm38) probably null Het
Cebpe C A 14: 54,710,580 (GRCm38) E269* probably null Het
Cecr2 C A 6: 120,720,962 (GRCm38) T74K probably damaging Het
Cela3b G T 4: 137,428,484 (GRCm38) H37Q probably damaging Het
Celf1 G T 2: 91,004,705 (GRCm38) C177F possibly damaging Het
Celsr1 A C 15: 85,978,851 (GRCm38) C1327G probably damaging Het
Celsr2 C T 3: 108,412,220 (GRCm38) R1092Q probably damaging Het
Celsr2 C T 3: 108,413,571 (GRCm38) V642I probably benign Het
Celsr3 C A 9: 108,826,477 (GRCm38) A53E probably benign Het
Cemip C A 7: 83,947,296 (GRCm38) G1087C probably damaging Het
Cenpe G C 3: 135,216,385 (GRCm38) V68L possibly damaging Het
Cenpj C G 14: 56,552,879 (GRCm38) R571P possibly damaging Het
Cep128 C A 12: 91,364,371 (GRCm38) A75S probably damaging Het
Cep128 C A 12: 91,289,603 (GRCm38) M364I probably benign Het
Cep131 C A 11: 120,065,715 (GRCm38) G936W probably damaging Het
Cep135 A T 5: 76,591,826 (GRCm38) Q23L probably damaging Het
Cep152 C T 2: 125,619,704 (GRCm38) V151M probably damaging Het
Cep152 C A 2: 125,614,324 (GRCm38) V256F probably benign Het
Cep162 C A 9: 87,199,980 (GRCm38) probably null Het
Cep250 A T 2: 155,976,467 (GRCm38) Q854L probably benign Het
Cep290 G T 10: 100,538,997 (GRCm38) K1368N possibly damaging Het
Cep290 G A 10: 100,497,944 (GRCm38) R286Q probably benign Het
Cep295 C A 9: 15,330,817 (GRCm38) D46Y Het
Cep89 G T 7: 35,397,081 (GRCm38) probably benign Het
Ces1b T A 8: 93,076,154 (GRCm38) T103S probably benign Het
Ces1h T A 8: 93,366,840 (GRCm38) probably null Het
Ces2b AGG AG 8: 104,832,595 (GRCm38) probably null Het
Ces2f G T 8: 104,948,235 (GRCm38) G90W probably damaging Het
Ces2g C A 8: 104,963,961 (GRCm38) L125M probably damaging Het
Ces3b G T 8: 105,085,083 (GRCm38) R77L probably damaging Het
Cfap157 A C 2: 32,778,207 (GRCm38) L407R probably damaging Het
Cfap221 C G 1: 119,984,743 (GRCm38) R138P probably damaging Het
Cfap44 G T 16: 44,432,044 (GRCm38) V839L probably benign Het
Cfap46 G T 7: 139,630,626 (GRCm38) P1768Q unknown Het
Cfap46 T A 7: 139,601,267 (GRCm38) Q2606L unknown Het
Cfap53 A T 18: 74,305,552 (GRCm38) K267* probably null Het
Cfap54 G T 10: 92,979,026 (GRCm38) P1315H probably damaging Het
Cfap57 C T 4: 118,598,956 (GRCm38) probably null Het
Cfap61 G C 2: 146,153,800 (GRCm38) C1095S probably damaging Het
Cfap61 G A 2: 146,012,162 (GRCm38) V365M possibly damaging Het
Cfap69 C T 5: 5,586,384 (GRCm38) C747Y possibly damaging Het
Cfap74 G T 4: 155,454,913 (GRCm38) probably benign Het
Cfh G T 1: 140,144,059 (GRCm38) P297H probably damaging Het
Chd1 G T 17: 15,747,801 (GRCm38) G866C probably damaging Het
Chd2 C G 7: 73,468,586 (GRCm38) A1095P possibly damaging Het
Cherp C A 8: 72,475,135 (GRCm38) probably benign Het
Cherp T G 8: 72,462,916 (GRCm38) K687Q Het
Chil5 G T 3: 106,028,818 (GRCm38) H53N probably damaging Het
Chl1 C A 6: 103,693,096 (GRCm38) Y482* probably null Het
Chl1 A T 6: 103,697,949 (GRCm38) probably benign Het
Chmp1a C G 8: 123,206,331 (GRCm38) V128L probably benign Het
Chmp3 C A 6: 71,543,804 (GRCm38) probably benign Het
Chodl C A 16: 78,941,463 (GRCm38) S106R possibly damaging Het
Chpf2 CGGG CGGGG 5: 24,591,519 (GRCm38) probably null Het
Chrm2 G C 6: 36,524,607 (GRCm38) R466S probably damaging Het
Chrna10 C A 7: 102,113,264 (GRCm38) V240L probably benign Het
Chrna10 C A 7: 102,114,987 (GRCm38) L63F possibly damaging Het
Chrna2 T A 14: 66,151,027 (GRCm38) L497Q probably null Het
Chrna4 G C 2: 181,028,285 (GRCm38) H559Q possibly damaging Het
Chrna4 C A 2: 181,024,813 (GRCm38) V611F probably damaging Het
Chrna5 G A 9: 55,004,956 (GRCm38) A347T possibly damaging Het
Chrna6 C G 8: 27,413,689 (GRCm38) R5P probably benign Het
Chrna7 C T 7: 63,107,551 (GRCm38) probably null Het
Chrna9 T A 5: 65,971,220 (GRCm38) L257Q probably damaging Het
Chrnb1 G T 11: 69,794,189 (GRCm38) A105D possibly damaging Het
Chrng C A 1: 87,208,263 (GRCm38) Q245K probably benign Het
Chrng C A 1: 87,206,298 (GRCm38) N87K probably benign Het
Chrng C T 1: 87,208,303 (GRCm38) T201I probably damaging Het
Chrng C G 1: 87,205,995 (GRCm38) S14R unknown Het
Chst2 C A 9: 95,404,841 (GRCm38) R484L probably damaging Het
Chst3 C A 10: 60,186,260 (GRCm38) G255V probably benign Het
Ciart G C 3: 95,879,023 (GRCm38) P247A probably damaging Het
Cidec G C 6: 113,434,496 (GRCm38) L8V probably damaging Het
Cilp TGGG TGG 9: 65,280,130 (GRCm38) probably null Het
Cilp2 C A 8: 69,882,808 (GRCm38) E513D probably damaging Het
Cilp2 A C 8: 69,884,542 (GRCm38) C206G probably damaging Het
Cilp2 G T 8: 69,884,546 (GRCm38) C204* probably null Het
Cirbp G T 10: 80,170,235 (GRCm38) A82S probably damaging Het
Ckap5 T G 2: 91,585,798 (GRCm38) L1023R probably damaging Het
Ckmt1 C A 2: 121,359,575 (GRCm38) P81H probably damaging Het
Clasp2 G T 9: 113,770,221 (GRCm38) G135C probably damaging Het
Clasp2 T A 9: 113,908,795 (GRCm38) L1079Q probably damaging Het
Clca2 C A 3: 145,086,451 (GRCm38) G350C probably damaging Het
Clcn4 C A 7: 7,294,756 (GRCm38) A165S probably damaging Het
Clcn4 C A 7: 7,293,040 (GRCm38) E268* probably null Het
Clcn6 C A 4: 148,023,370 (GRCm38) G193* probably null Het
Clcn7 G T 17: 25,153,015 (GRCm38) probably null Het
Clcnkb G T 4: 141,407,951 (GRCm38) T492K probably damaging Het
Cldn1 G T 16: 26,360,864 (GRCm38) P151H probably damaging Het
Cldn16 G T 16: 26,481,250 (GRCm38) R146L probably damaging Het
Cldn9 G C 17: 23,683,201 (GRCm38) P150R probably damaging Het
Cldnd1 G T 16: 58,729,681 (GRCm38) G76W probably damaging Het
Clec1a G A 6: 129,429,907 (GRCm38) P215L probably benign Het
Clec4a1 G T 6: 122,933,892 (GRCm38) R235S possibly damaging Het
Clec4d G T 6: 123,268,074 (GRCm38) W104C probably damaging Het
Clec4f C A 6: 83,645,221 (GRCm38) R546I possibly damaging Het
Clgn T A 8: 83,397,681 (GRCm38) M84K probably benign Het
Clic6 C T 16: 92,499,139 (GRCm38) S229F probably benign Het
Clip1 C A 5: 123,617,350 (GRCm38) A956S probably damaging Het
Clip2 C G 5: 134,516,835 (GRCm38) R334P probably damaging Het
Clip2 C A 5: 134,522,999 (GRCm38) G90C probably damaging Het
Clip4 G T 17: 71,799,097 (GRCm38) probably null Het
Clmn C A 12: 104,781,376 (GRCm38) K637N probably benign Het
Clp1 C A 2: 84,725,963 (GRCm38) D58Y probably benign Het
Clptm1 C T 7: 19,637,468 (GRCm38) probably null Het
Clpx C A 9: 65,299,997 (GRCm38) S59* probably null Het
Clspn G A 4: 126,566,177 (GRCm38) R399Q probably benign Het
Clstn2 C A 9: 97,461,356 (GRCm38) M679I probably benign Het
Clstn3 C A 6: 124,449,781 (GRCm38) G564V probably damaging Het
Clu A T 14: 65,975,921 (GRCm38) Q252L probably damaging Het
Cluh G C 11: 74,667,754 (GRCm38) K1217N possibly damaging Het
Cmah C A 13: 24,435,684 (GRCm38) Y277* probably null Het
Cmbl G T 15: 31,581,965 (GRCm38) R36L probably benign Het
Cmtr2 CGGG CGG 8: 110,221,499 (GRCm38) probably null Het
Cmya5 C G 13: 93,063,579 (GRCm38) A3414P probably benign Het
Cnga1 C A 5: 72,605,530 (GRCm38) probably null Het
Cngb1 A T 8: 95,252,136 (GRCm38) L1022Q probably damaging Het
Cnksr1 T C 4: 134,232,150 (GRCm38) D391G probably damaging Het
Cnnm3 G A 1: 36,513,033 (GRCm38) A375T possibly damaging Het
Cnot11 G T 1: 39,535,848 (GRCm38) G4C probably damaging Het
Cnot3 G T 7: 3,651,495 (GRCm38) R57L probably damaging Het
Cnpy1 C A 5: 28,207,209 (GRCm38) V109L possibly damaging Het
Cntn1 C A 15: 92,309,970 (GRCm38) P814H probably damaging Het
Cntn3 C A 6: 102,337,331 (GRCm38) V141L probably benign Het
Cntn4 C A 6: 106,662,618 (GRCm38) H570N probably damaging Het
Cntn4 G T 6: 106,550,425 (GRCm38) G423C probably damaging Het
Cntn5 C A 9: 9,673,962 (GRCm38) E712* probably null Het
Cntn5 C A 9: 10,090,236 (GRCm38) G198C probably damaging Het
Cntn6 C A 6: 104,832,584 (GRCm38) P527T probably damaging Het
Cntnap2 C T 6: 46,015,299 (GRCm38) P387S possibly damaging Het
Cntnap3 G C 13: 64,781,892 (GRCm38) P498A probably damaging Het
Cntnap5a A T 1: 116,412,168 (GRCm38) Q719L probably benign Het
Cntnap5b C T 1: 100,050,706 (GRCm38) A149V probably damaging Het
Cntrob C A 11: 69,311,449 (GRCm38) R439L possibly damaging Het
Cog4 A T 8: 110,879,015 (GRCm38) T570S probably benign Het
Cog5 G T 12: 31,801,985 (GRCm38) G280C probably damaging Het
Cog6 T C 3: 53,013,864 (GRCm38) D107G probably damaging Het
Col11a1 G C 3: 114,165,235 (GRCm38) probably null Het
Col11a1 G T 3: 114,138,921 (GRCm38) G902C unknown Het
Col11a2 G T 17: 34,051,666 (GRCm38) R537M probably benign Het
Col12a1 C CA 9: 79,639,696 (GRCm38) probably null Het
Col12a1 C A 9: 79,599,986 (GRCm38) G263V possibly damaging Het
Col13a1 C A 10: 61,905,262 (GRCm38) G150C probably damaging Het
Col14a1 A C 15: 55,372,570 (GRCm38) probably null Het
Col15a1 G T 4: 47,245,807 (GRCm38) R186L probably benign Het
Col17a1 G A 19: 47,650,304 (GRCm38) P1141L possibly damaging Het
Col18a1 T A 10: 77,112,838 (GRCm38) Q280L unknown Het
Col1a1 G A 11: 94,943,804 (GRCm38) M569I probably benign Het
Col22a1 G T 15: 71,915,120 (GRCm38) P752T unknown Het
Col24a1 G T 3: 145,342,499 (GRCm38) G619V probably damaging Het
Col25a1 G T 3: 130,522,461 (GRCm38) G297V probably damaging Het
Col27a1 G T 4: 63,281,289 (GRCm38) G928W probably damaging Het
Col28a1 T A 6: 8,175,630 (GRCm38) S73C unknown Het
Col28a1 C A 6: 8,127,352 (GRCm38) G366C probably damaging Het
Col28a1 G T 6: 8,062,283 (GRCm38) P669Q possibly damaging Het
Col2a1 G T 15: 97,998,345 (GRCm38) P162H unknown Het
Col2a1 C A 15: 97,983,973 (GRCm38) K781N probably damaging Het
Col3a1 C T 1: 45,311,800 (GRCm38) P18L unknown Het
Col4a1 C T 8: 11,235,218 (GRCm38) G388S unknown Het
Col4a1 C G 8: 11,239,024 (GRCm38) G311R unknown Het
Col4a3 G T 1: 82,690,039 (GRCm38) G1010C unknown Het
Col5a2 C A 1: 45,403,473 (GRCm38) G604V probably damaging Het
Col5a2 C G 1: 45,402,113 (GRCm38) G664A probably damaging Het
Col5a3 C A 9: 20,775,334 (GRCm38) A1332S unknown Het
Col6a2 C A 10: 76,596,350 (GRCm38) A990S possibly damaging Het
Col6a3 A T 1: 90,811,728 (GRCm38) D866E possibly damaging Het
Col6a5 C A 9: 105,930,785 (GRCm38) E1021D unknown Het
Col6a6 C A 9: 105,788,895 (GRCm38) G21C probably null Het
Col6a6 C A 9: 105,728,255 (GRCm38) G1644C probably damaging Het
Col7a1 C A 9: 108,984,077 (GRCm38) H2897N unknown Het
Col7a1 C G 9: 108,976,051 (GRCm38) D2322E unknown Het
Col7a1 G T 9: 108,974,923 (GRCm38) G2198W unknown Het
Col8a1 C A 16: 57,628,238 (GRCm38) G303V unknown Het
Col8a1 C A 16: 57,632,450 (GRCm38) L63F probably damaging Het
Col8a2 C A 4: 126,311,543 (GRCm38) P449T unknown Het
Colgalt1 G T 8: 71,623,208 (GRCm38) G500C probably damaging Het
Commd4 C A 9: 57,157,131 (GRCm38) R4L probably damaging Het
Comp G T 8: 70,377,221 (GRCm38) R365L probably benign Het
Copa AG A 1: 172,106,123 (GRCm38) probably null Het
Copg2 C T 6: 30,809,585 (GRCm38) R708Q probably benign Het
Coq7 C A 7: 118,510,149 (GRCm38) K225N unknown Het
Corin C A 5: 72,454,493 (GRCm38) R141S probably benign Het
Coro6 C A 11: 77,469,109 (GRCm38) A372D probably damaging Het
Cox10 C A 11: 63,976,470 (GRCm38) L233F possibly damaging Het
Cox4i1 G T 8: 120,668,280 (GRCm38) probably benign Het
Cpa4 G T 6: 30,574,403 (GRCm38) V64L possibly damaging Het
Cpa6 T A 1: 10,329,559 (GRCm38) probably null Het
Cpn1 C A 19: 43,973,976 (GRCm38) G178V probably damaging Het
Cpne5 C G 17: 29,159,182 (GRCm38) R541P probably damaging Het
Cpsf7 G T 19: 10,535,518 (GRCm38) S322I probably null Het
Cpt1a G T 19: 3,370,727 (GRCm38) R395L probably damaging Het
Cpt1a A T 19: 3,366,370 (GRCm38) Q307L probably damaging Het
Cpxm2 C G 7: 132,055,001 (GRCm38) A511P probably benign Het
Cpz G T 5: 35,511,761 (GRCm38) S342* probably null Het
Cracr2a A T 6: 127,669,063 (GRCm38) D706V probably damaging Het
Cracr2a G T 6: 127,607,244 (GRCm38) A89S probably benign Het
Crb1 T A 1: 139,248,901 (GRCm38) Q448L possibly damaging Het
Crb1 A T 1: 139,337,028 (GRCm38) probably null Het
Crb1 CG C 1: 139,237,086 (GRCm38) probably null Het
Crb2 G C 2: 37,790,824 (GRCm38) R588P possibly damaging Het
Crb2 G A 2: 37,787,365 (GRCm38) G290R probably damaging Het
Crebl2 G A 6: 134,830,433 (GRCm38) D2N probably damaging Het
Crispld1 TCC TC 1: 17,764,092 (GRCm38) probably null Het
Crmp1 G T 5: 37,278,124 (GRCm38) V308L probably benign Het
Crnn T G 3: 93,149,296 (GRCm38) V463G probably damaging Het
Crocc2 A T 1: 93,213,595 (GRCm38) R1157W probably damaging Het
Crocc2 A T 1: 93,226,692 (GRCm38) Q1603L probably benign Het
Crybb2 C A 5: 113,058,435 (GRCm38) G178V probably damaging Het
Crybb2 C A 5: 113,058,436 (GRCm38) G178W probably damaging Het
Crybg3 C T 16: 59,556,478 (GRCm38) S1471N probably benign Het
Crybg3 C A 16: 59,555,393 (GRCm38) E119* probably null Het
Csf1 C A 3: 107,749,080 (GRCm38) A212S possibly damaging Het
Csf2ra C T 19: 61,225,153 (GRCm38) D373N probably benign Het
Csmd1 G T 8: 15,984,708 (GRCm38) P2488T probably damaging Het
Csmd1 C A 8: 16,200,019 (GRCm38) D982Y probably damaging Het
Csmd2 C T 4: 128,530,797 (GRCm38) L2872F Het
Csmd3 C G 15: 47,675,734 (GRCm38) G1536R Het
Csmd3 A T 15: 47,733,417 (GRCm38) S1097R Het
Csnk1g1 A T 9: 66,012,750 (GRCm38) T335S probably benign Het
Cspp1 GAA GA 1: 10,095,878 (GRCm38) probably null Het
Cstf2 G C X: 134,062,488 (GRCm38) probably null Het
Ctag2 C A X: 65,047,929 (GRCm38) P82H probably damaging Het
Ctcfl A C 2: 173,102,036 (GRCm38) M507R probably benign Het
Ctdsp2 G T 10: 126,996,072 (GRCm38) R183L probably damaging Het
Ctla2a C A 13: 60,936,000 (GRCm38) E39D probably damaging Het
Ctnna2 G C 6: 77,641,417 (GRCm38) N187K probably benign Het
Ctnna2 G C 6: 76,973,781 (GRCm38) A569G possibly damaging Het
Ctnna2 G T 6: 76,980,740 (GRCm38) L509I probably damaging Het
Ctnna2 G A 6: 77,758,554 (GRCm38) S60F probably benign Het
Ctnnd1 C A 2: 84,615,172 (GRCm38) G507V probably damaging Het
Ctrb1 A T 8: 111,686,674 (GRCm38) S235R probably damaging Het
Cts3 A T 13: 61,568,747 (GRCm38) L25* probably null Het
Cts7 T A 13: 61,355,632 (GRCm38) T173S probably benign Het
Ctse G A 1: 131,672,444 (GRCm38) probably null Het
Ctsq C T 13: 61,037,096 (GRCm38) G259R probably damaging Het
Cul7 AGGGG AGGG 17: 46,652,805 (GRCm38) probably null Het
Cul7 A T 17: 46,658,738 (GRCm38) Q977L probably damaging Het
Cul7 G T 17: 46,659,569 (GRCm38) R1071L probably damaging Het
Cul9 C A 17: 46,537,797 (GRCm38) R671L probably benign Het
Cux2 G T 5: 121,877,129 (GRCm38) P234T probably benign Het
Cux2 C T 5: 121,873,680 (GRCm38) R564H probably damaging Het
Cwf19l2 G T 9: 3,428,782 (GRCm38) G256V probably damaging Het
Cwh43 C G 5: 73,430,470 (GRCm38) N477K probably damaging Het
Cxxc4 G T 3: 134,240,050 (GRCm38) A131S unknown Het
Cyfip1 G T 7: 55,898,320 (GRCm38) G586V possibly damaging Het
Cyfip2 G A 11: 46,222,615 (GRCm38) S968F not run Het
Cylc1 C G X: 111,122,279 (GRCm38) P110A probably benign Het
Cyp17a1 G A 19: 46,672,659 (GRCm38) P62L possibly damaging Het
Cyp1a1 G A 9: 57,700,514 (GRCm38) A142T probably damaging Het
Cyp20a1 G T 1: 60,353,010 (GRCm38) R75M probably damaging Het
Cyp26b1 C G 6: 84,577,119 (GRCm38) W172S probably damaging Het
Cyp27a1 C T 1: 74,737,335 (GRCm38) R477W probably damaging Het
Cyp2ab1 C A 16: 20,313,881 (GRCm38) W222C possibly damaging Het
Cyp2b9 A T 7: 26,201,163 (GRCm38) N409Y probably benign Het
Cyp2c54 G A 19: 40,073,757 (GRCm38) L19F probably benign Het
Cyp2c66 T A 19: 39,186,626 (GRCm38) I490N probably damaging Het
Cyp2c67 C T 19: 39,643,679 (GRCm38) A82T possibly damaging Het
Cyp2d11 G T 15: 82,392,499 (GRCm38) P80T probably damaging Het
Cyp2f2 C A 7: 27,121,907 (GRCm38) Q82K possibly damaging Het
Cyp2j5 C A 4: 96,659,480 (GRCm38) probably null Het
Cyp2r1 T A 7: 114,553,339 (GRCm38) R128* probably null Het
Cyp2t4 T A 7: 27,158,240 (GRCm38) L426Q probably damaging Het
Cyp3a57 C A 5: 145,365,633 (GRCm38) P80T probably damaging Het
Cyp4a14 C T 4: 115,491,453 (GRCm38) D305N possibly damaging Het
Cyp4a32 G T 4: 115,611,345 (GRCm38) E341D probably benign Het
Cyp4f18 G T 8: 71,998,283 (GRCm38) R180S probably benign Het
Cyp4f40 G C 17: 32,676,449 (GRCm38) R515P probably damaging Het
Cyp4f40 G T 17: 32,671,159 (GRCm38) D268Y probably benign Het
Cyp4x1 C T 4: 115,127,525 (GRCm38) A79T probably damaging Het
Cyp4x1 G T 4: 115,110,103 (GRCm38) D425E probably damaging Het
Cyp8b1 A T 9: 121,915,531 (GRCm38) L245Q probably benign Het
Cyp8b1 G A 9: 121,916,146 (GRCm38) P40L probably damaging Het
Cypt14 G A X: 39,863,558 (GRCm38) P9L probably damaging Het
Cypt15 C A X: 39,346,330 (GRCm38) A15E probably damaging Het
Cyr61 C A 3: 145,648,655 (GRCm38) S167I probably benign Het
Cyth4 G T 15: 78,619,919 (GRCm38) R363L probably damaging Het
D130043K22Rik G T 13: 24,880,847 (GRCm38) G749C probably damaging Het
D130043K22Rik G C 13: 24,856,834 (GRCm38) V80L probably benign Het
D130043K22Rik C A 13: 24,856,709 (GRCm38) P38H probably damaging Het
D130043K22Rik C A 13: 24,872,248 (GRCm38) T521N possibly damaging Het
D430041D05Rik C T 2: 104,241,191 (GRCm38) A571T possibly damaging Het
D8Ertd738e C A 8: 84,249,646 (GRCm38) A20S probably benign Het
D930020B18Rik C A 10: 121,689,912 (GRCm38) A573D probably damaging Het
Daam2 C G 17: 49,464,620 (GRCm38) A833P probably damaging Het
Daam2 G A 17: 49,489,016 (GRCm38) R268W probably damaging Het
Dab1 G T 4: 104,727,740 (GRCm38) G359V probably benign Het
Dact1 G C 12: 71,310,051 (GRCm38) R23P possibly damaging Het
Daglb G C 5: 143,473,118 (GRCm38) S140T probably null Het
Dand5 C A 8: 84,816,523 (GRCm38) R108M probably damaging Het
Dand5 C T 8: 84,816,337 (GRCm38) R170K probably benign Het
Dapk3 GC GCC 10: 81,191,769 (GRCm38) probably null Het
Daw1 G T 1: 83,210,214 (GRCm38) R318S unknown Het
Dbt G C 3: 116,546,091 (GRCm38) R376P probably damaging Het
Dcaf12l1 G T X: 44,788,824 (GRCm38) H366N probably damaging Het
Dcaf7 G T 11: 106,053,795 (GRCm38) C268F probably benign Het
Dchs1 G C 7: 105,758,551 (GRCm38) Q2025E probably benign Het
Dchs1 T A 7: 105,757,693 (GRCm38) S2202C probably damaging Het
Dchs2 T A 3: 83,271,140 (GRCm38) S1167T possibly damaging Het
Dclk1 G T 3: 55,256,013 (GRCm38) E175D probably benign Het
Dcstamp G T 15: 39,759,596 (GRCm38) G438W probably benign Het
Ddb1 G C 19: 10,608,396 (GRCm38) R158P probably damaging Het
Ddc G T 11: 11,880,552 (GRCm38) P31T probably damaging Het
Ddhd1 C A 14: 45,657,594 (GRCm38) A140S possibly damaging Het
Ddhd2 G T 8: 25,754,385 (GRCm38) T71N unknown Het
Ddhd2 C A 8: 25,754,374 (GRCm38) A75S probably benign Het
Ddr2 C A 1: 169,990,622 (GRCm38) D439Y possibly damaging Het
Ddx1 C A 12: 13,229,259 (GRCm38) G460W probably damaging Het
Ddx10 C A 9: 53,204,511 (GRCm38) A508S probably damaging Het
Ddx17 T A 15: 79,530,172 (GRCm38) Q600L probably benign Het
Ddx21 C A 10: 62,587,538 (GRCm38) probably null Het
Ddx27 G C 2: 167,033,841 (GRCm38) E697D probably benign Het
Ddx56 C G 11: 6,267,445 (GRCm38) M65I probably benign Het
Ddx60 G C 8: 62,000,588 (GRCm38) R1247P possibly damaging Het
Defa17 G T 8: 21,656,594 (GRCm38) G79W probably damaging Het
Defb11 A T 8: 21,906,346 (GRCm38) C12S probably null Het
Defb37 G T 8: 18,986,383 (GRCm38) N40K unknown Het
Degs2 G T 12: 108,692,597 (GRCm38) P41H probably benign Het
Dek C A 13: 47,105,626 (GRCm38) E35* probably null Het
Dennd1a C A 2: 37,800,257 (GRCm38) G944W probably damaging Het
Dennd1c G T 17: 57,074,330 (GRCm38) Q131K probably benign Het
Dennd2a C A 6: 39,523,474 (GRCm38) Q52H probably benign Het
Dennd5a C G 7: 109,934,024 (GRCm38) G180R probably benign Het
Deptor G T 15: 55,133,459 (GRCm38) probably benign Het
Deup1 G A 9: 15,607,832 (GRCm38) S126F probably benign Het
Deup1 C A 9: 15,600,903 (GRCm38) Q181H probably null Het
Dgcr14 C G 16: 17,909,922 (GRCm38) G131A probably benign Het
Dgka C T 10: 128,731,165 (GRCm38) R275Q possibly damaging Het
Dgka C G 10: 128,720,468 (GRCm38) M716I probably benign Het
Dgkd G A 1: 87,916,886 (GRCm38) S258N probably damaging Het
Dgkg G T 16: 22,558,084 (GRCm38) H508Q probably benign Het
Dgki G T 6: 36,975,225 (GRCm38) L740M probably damaging Het
Dgkz C T 2: 91,942,334 (GRCm38) V370I probably damaging Het
Dhtkd1 C G 2: 5,942,628 (GRCm38) R15P unknown Het
Dhx29 G A 13: 112,955,517 (GRCm38) R896Q probably null Het
Dhx37 C A 5: 125,425,472 (GRCm38) S449I probably benign Het
Dhx37 C T 5: 125,424,980 (GRCm38) R484Q possibly damaging Het
Dhx38 C T 8: 109,556,085 (GRCm38) V650I probably benign Het
Dhx8 C A 11: 101,757,660 (GRCm38) T928K probably damaging Het
Dhx9 C T 1: 153,456,575 (GRCm38) G1216R unknown Het
Diaph3 C A 14: 87,002,814 (GRCm38) G278V probably damaging Het
Diexf C A 1: 193,114,675 (GRCm38) V583L probably damaging Het
Dio2 C A 12: 90,729,912 (GRCm38) E101* probably null Het
Dip2a C A 10: 76,296,400 (GRCm38) V545L probably damaging Het
Dip2a C A 10: 76,266,322 (GRCm38) S1446I possibly damaging Het
Diras1 C A 10: 81,022,282 (GRCm38) R45L possibly damaging Het
Disp2 C A 2: 118,790,827 (GRCm38) P680H probably damaging Het
Disp2 G T 2: 118,789,702 (GRCm38) R305L probably damaging Het
Disp3 C A 4: 148,270,567 (GRCm38) E331* probably null Het
Disp3 G C 4: 148,249,847 (GRCm38) S996R probably benign Het
Disp3 G C 4: 148,250,714 (GRCm38) P958A probably damaging Het
Disp3 G T 4: 148,249,746 (GRCm38) P1030Q probably damaging Het
Dlec1 C A 9: 119,134,473 (GRCm38) L952I probably benign Het
Dlec1 T A 9: 119,147,409 (GRCm38) S1677R probably damaging Het
Dlgap1 G T 17: 70,662,743 (GRCm38) V515L probably benign Het
Dlgap2 G T 8: 14,727,659 (GRCm38) W301C probably damaging Het
Dlgap3 G T 4: 127,235,498 (GRCm38) K895N probably damaging Het
Dlgap3 C G 4: 127,194,984 (GRCm38) D124E probably damaging Het
Dlgap5 T A 14: 47,388,063 (GRCm38) R794* probably null Het
Dll3 G T 7: 28,301,383 (GRCm38) S82R probably damaging Het
Dlst C T 12: 85,110,893 (GRCm38) probably benign Het
Dlx1 G T 2: 71,530,015 (GRCm38) E8* probably null Het
Dlx3 C G 11: 95,120,392 (GRCm38) A24G probably benign Het
Dmbt1 A T 7: 131,082,485 (GRCm38) probably null Het
Dmd C A X: 83,627,271 (GRCm38) T220N probably damaging Het
Dmgdh G T 13: 93,709,288 (GRCm38) W483C probably damaging Het
Dmgdh G T 13: 93,677,183 (GRCm38) A79S probably damaging Het
Dmp1 C A 5: 104,211,652 (GRCm38) H65N probably benign Het
Dmrta1 G A 4: 89,688,498 (GRCm38) A64T probably benign Het
Dmrta1 G T 4: 89,688,408 (GRCm38) V34L probably damaging Het
Dmrta1 G A 4: 89,688,454 (GRCm38) G49D probably benign Het
Dmxl2 GC G 9: 54,382,034 (GRCm38) probably null Het
Dna2 G C 10: 62,962,424 (GRCm38) M635I probably benign Het
Dnaaf5 G A 5: 139,185,542 (GRCm38) D820N probably benign Het
Dnaaf5 G T 5: 139,185,585 (GRCm38) R834L probably damaging Het
Dnaaf5 G C 5: 139,177,975 (GRCm38) W662C probably damaging Het
Dnah10 G C 5: 124,741,955 (GRCm38) R435P probably damaging Het
Dnah10 G T 5: 124,817,988 (GRCm38) probably null Het
Dnah10 C T 5: 124,747,619 (GRCm38) A613V possibly damaging Het
Dnah12 G T 14: 26,875,215 (GRCm38) W3510C probably damaging Het
Dnah14 T C 1: 181,763,334 (GRCm38) L3264P probably damaging Het
Dnah14 G T 1: 181,766,304 (GRCm38) R3404L probably damaging Het
Dnah14 G A 1: 181,690,320 (GRCm38) G2073E probably benign Het
Dnah17 C A 11: 118,127,142 (GRCm38) E176* probably null Het
Dnah17 G T 11: 118,078,563 (GRCm38) P2257T possibly damaging Het
Dnah17 C A 11: 118,086,960 (GRCm38) G1849C probably damaging Het
Dnah2 G T 11: 69,463,453 (GRCm38) R2290S possibly damaging Het
Dnah2 C T 11: 69,544,557 (GRCm38) probably null Het
Dnah3 C A 7: 120,007,862 (GRCm38) R1840L probably benign Het
Dnah3 G C 7: 119,967,901 (GRCm38) S2367R probably damaging Het
Dnah5 C T 15: 28,295,311 (GRCm38) P1397S probably damaging Het
Dnah5 T A 15: 28,387,763 (GRCm38) S3123T possibly damaging Het
Dnah5 G T 15: 28,270,403 (GRCm38) E950D probably benign Het
Dnah5 T G 15: 28,270,354 (GRCm38) L934R probably benign Het
Dnah6 C A 6: 73,021,237 (GRCm38) L4067F probably benign Het
Dnah6 G T 6: 73,041,138 (GRCm38) P3566H probably damaging Het
Dnah6 G T 6: 73,032,526 (GRCm38) Q3813K probably damaging Het
Dnah6 C A 6: 73,155,272 (GRCm38) R1149L possibly damaging Het
Dnah7a C A 1: 53,559,102 (GRCm38) A1425S probably benign Het
Dnah7a A C 1: 53,643,457 (GRCm38) W285G possibly damaging Het
Dnah7a C G 1: 53,411,656 (GRCm38) V3872L probably benign Het
Dnah7c C A 1: 46,654,103 (GRCm38) L1961I possibly damaging Het
Dnah8 C A 17: 30,694,033 (GRCm38) T1067N probably benign Het
Dnah8 A T 17: 30,713,095 (GRCm38) Q1479L probably null Het
Dnah9 C A 11: 66,126,650 (GRCm38) D379Y probably damaging Het
Dnaic1 C T 4: 41,569,809 (GRCm38) probably benign Het
Dnaja2 C A 8: 85,540,071 (GRCm38) W342C probably benign Het
Dnajb11 G A 16: 22,865,496 (GRCm38) G90S probably damaging Het
Dnajb11 G A 16: 22,866,961 (GRCm38) R122H probably benign Het
Dnajc10 G C 2: 80,319,233 (GRCm38) R93P probably damaging Het
Dnajc12 A T 10: 63,397,260 (GRCm38) Q60L probably damaging Het
Dnajc6 G T 4: 101,639,428 (GRCm38) V931L possibly damaging Het
Dner C T 1: 84,405,989 (GRCm38) C558Y probably damaging Het
Dner C G 1: 84,445,430 (GRCm38) S484T probably damaging Het
Dner C A 1: 84,445,433 (GRCm38) R483L probably damaging Het
Dnhd1 C A 7: 105,682,841 (GRCm38) R102S possibly damaging Het
Dntt A T 19: 41,055,815 (GRCm38) D473V probably damaging Het
Doc2g C A 19: 4,004,105 (GRCm38) P112T probably damaging Het
Dock1 G T 7: 134,782,400 (GRCm38) E667* probably null Het
Dock10 C G 1: 80,559,200 (GRCm38) M989I probably benign Het
Dock2 T G 11: 34,312,553 (GRCm38) H934P possibly damaging Het
Dock4 G C 12: 40,817,641 (GRCm38) Q1405H possibly damaging Het
Dock5 C A 14: 67,813,933 (GRCm38) A696S possibly damaging Het
Dock8 C T 19: 25,155,972 (GRCm38) T1161I probably benign Het
Dock8 G T 19: 25,132,123 (GRCm38) A890S probably benign Het
Donson G A 16: 91,688,472 (GRCm38) R81W probably benign Het
Dopey2 G T 16: 93,763,895 (GRCm38) V874L probably damaging Het
Dpp6 C A 5: 27,712,642 (GRCm38) F610L probably damaging Het
Dpp8 G T 9: 65,066,485 (GRCm38) G664C probably damaging Het
Dpp8 CTGTGTGT CTGTGT 9: 65,063,866 (GRCm38) probably null Het
Dpy19l2 C A 9: 24,646,359 (GRCm38) M373I probably benign Het
Dpys A T 15: 39,842,099 (GRCm38) M206K probably benign Het
Dpysl2 C A 14: 66,862,490 (GRCm38) G99V probably damaging Het
Drc1 A T 5: 30,345,507 (GRCm38) N125Y possibly damaging Het
Drc1 C A 5: 30,348,697 (GRCm38) S238Y probably benign Het
Drd1 G T 13: 54,052,857 (GRCm38) T446N possibly damaging Het
Drd5 C T 5: 38,320,386 (GRCm38) R241C possibly damaging Het
Drosha G T 15: 12,842,092 (GRCm38) G327V probably benign Het
Drp2 A G X: 134,437,042 (GRCm38) E359G probably damaging Het
Dsc3 C T 18: 19,966,315 (GRCm38) V715I probably benign Het
Dscam C G 16: 96,608,189 (GRCm38) E1845Q probably damaging Het
Dscaml1 C A 9: 45,672,791 (GRCm38) T518N probably damaging Het
Dsel C A 1: 111,861,716 (GRCm38) R363L probably damaging Het
Dsg1c C A 18: 20,264,949 (GRCm38) P69T probably damaging Het
Dsg2 G T 18: 20,602,249 (GRCm38) E1095* probably null Het
Dsp CAAA CAAAA 13: 38,192,854 (GRCm38) probably null Het
Dsp G C 13: 38,151,689 (GRCm38) G34A probably benign Het
Dst A C 1: 34,194,518 (GRCm38) K3436Q probably damaging Het
Dst G T 1: 34,181,232 (GRCm38) G2039V probably benign Het
Dtx1 C A 5: 120,681,351 (GRCm38) G594V probably damaging Het
Duox2 G T 2: 122,293,452 (GRCm38) P417Q probably damaging Het
Dusp1 CT C 17: 26,507,195 (GRCm38) probably null Het
Dusp10 G C 1: 184,068,992 (GRCm38) E319Q probably damaging Het
Dusp4 G T 8: 34,808,090 (GRCm38) S121I probably benign Het
Dvl1 G T 4: 155,847,637 (GRCm38) probably benign Het
Dvl3 G T 16: 20,517,088 (GRCm38) probably benign Het
Dynap C A 18: 70,241,030 (GRCm38) V142L unknown Het
Dync1h1 G T 12: 110,658,517 (GRCm38) E3793* probably null Het
Dync1h1 G A 12: 110,637,554 (GRCm38) D2304N probably damaging Het
Dync1h1 G GT 12: 110,641,177 (GRCm38) probably null Het
Dync1i1 G A 6: 5,767,057 (GRCm38) V46I probably benign Het
Dync2h1 C A 9: 7,102,427 (GRCm38) G2658C probably damaging Het
Dyrk1a G T 16: 94,691,580 (GRCm38) probably null Het
Dysf G T 6: 84,087,817 (GRCm38) V478L probably benign Het
Dysf G A 6: 84,064,523 (GRCm38) M171I probably benign Het
Dytn G A 1: 63,633,454 (GRCm38) R597* probably null Het
Dyx1c1 G T 9: 72,961,964 (GRCm38) R152L possibly damaging Het
Dzip1 T A 14: 118,911,376 (GRCm38) K297I probably damaging Het
Dzip1l G T 9: 99,665,854 (GRCm38) Q720H probably null Het
E130308A19Rik T A 4: 59,720,223 (GRCm38) I585K probably benign Het
E2f8 A T 7: 48,875,546 (GRCm38) I226K probably benign Het
Eaf2 A T 16: 36,824,662 (GRCm38) I66K probably damaging Het
Ear6 C G 14: 51,854,255 (GRCm38) C86W probably damaging Het
Ear6 A AT 14: 51,854,403 (GRCm38) probably null Het
Ecd C T 14: 20,337,019 (GRCm38) G216S possibly damaging Het
Ecm1 T C 3: 95,734,876 (GRCm38) I466V probably benign Het
Ect2l C A 10: 18,172,672 (GRCm38) R267L probably null Het
Eddm3b G A 14: 51,116,722 (GRCm38) V56I probably damaging Het
Eddm3b C A 14: 51,116,989 (GRCm38) L145I probably benign Het
Edil3 G T 13: 88,822,012 (GRCm38) V11F probably benign Het
Edn1 C A 13: 42,303,631 (GRCm38) P47T possibly damaging Het
Eed C A 7: 89,980,515 (GRCm38) R4M probably benign Het
Eed C A 7: 89,980,514 (GRCm38) R4S probably benign Het
Eef1d C A 15: 75,902,878 (GRCm38) A311S possibly damaging Het
Eef2k G A 7: 120,858,453 (GRCm38) G12S probably damaging Het
Efcab14 G T 4: 115,738,702 (GRCm38) G15V probably damaging Het
Efcab8 G T 2: 153,798,680 (GRCm38) D354Y probably null Het
Efemp1 A T 11: 28,867,909 (GRCm38) E129D probably benign Het
Efhb C A 17: 53,437,126 (GRCm38) R479L possibly damaging Het
Efhb G C 17: 53,437,183 (GRCm38) A460G probably benign Het
Efhd2 C A 4: 141,874,683 (GRCm38) R62L probably damaging Het
Efnb1 G T X: 99,147,504 (GRCm38) A339S probably damaging Het
Efnb2 C A 8: 8,623,147 (GRCm38) probably null Het
Egfem1 C A 3: 29,148,453 (GRCm38) P66T probably benign Het
Egfr A T 11: 16,862,954 (GRCm38) I145F probably benign Het
Egfr G T 11: 16,869,319 (GRCm38) G283V probably damaging Het
Egln2 C T 7: 27,164,990 (GRCm38) S170N probably benign Het
Egr1 G C 18: 34,863,230 (GRCm38) R355P probably damaging Het
Ehbp1l1 C T 19: 5,719,102 (GRCm38) M724I probably benign Het
Ehbp1l1 C G 19: 5,719,434 (GRCm38) A614P probably benign Het
Ehbp1l1 C A 19: 5,719,101 (GRCm38) A725S probably benign Het
Ehbp1l1 C A 19: 5,718,762 (GRCm38) G838W probably damaging Het
Ehd2 T A 7: 15,957,905 (GRCm38) probably null Het
Ehd3 G T 17: 73,830,105 (GRCm38) G423V probably benign Het
Ehhadh C A 16: 21,762,288 (GRCm38) W651C probably damaging Het
Eif2a G T 3: 58,531,120 (GRCm38) G21V probably damaging Het
Eif2b2 G C 12: 85,219,564 (GRCm38) M1I probably null Het
Eif2b2 G C 12: 85,223,415 (GRCm38) G243A probably damaging Het
Eif3b G T 5: 140,430,128 (GRCm38) G401C probably damaging Het
Eif3h C A 15: 51,865,438 (GRCm38) G7V probably damaging Het
Eif3m C T 2: 105,001,274 (GRCm38) D314N probably damaging Het
Eif4g1 GT GTT 16: 20,686,366 (GRCm38) probably null Het
Eif4g1 G A 16: 20,683,905 (GRCm38) D988N probably benign Het
Elfn1 G T 5: 139,972,308 (GRCm38) V356L probably benign Het
Elmod2 T A 8: 83,317,777 (GRCm38) S186C possibly damaging Het
Elmod2 C A 8: 83,321,501 (GRCm38) D111Y probably damaging Het
Elmod3 T A 6: 72,566,689 (GRCm38) H373L probably benign Het
Elmsan1 G C 12: 84,152,991 (GRCm38) A985G probably benign Het
Elmsan1 C A 12: 84,162,358 (GRCm38) E657* probably null Het
Eln C T 5: 134,718,026 (GRCm38) G420E unknown Het
Elovl2 C A 13: 41,189,978 (GRCm38) W158L probably damaging Het
Elovl6 G T 3: 129,605,112 (GRCm38) R54L probably damaging Het
Emilin3 T A 2: 160,907,801 (GRCm38) Q676L probably damaging Het
Eml3 A T 19: 8,937,561 (GRCm38) probably null Het
En1 G T 1: 120,603,453 (GRCm38) A141S probably benign Het
En1 G T 1: 120,607,005 (GRCm38) R341L unknown Het
En1 G T 1: 120,603,663 (GRCm38) A211S unknown Het
Engase G T 11: 118,485,757 (GRCm38) R473S possibly damaging Het
Enox1 C T 14: 77,668,747 (GRCm38) T522I probably benign Het
Enpep C A 3: 129,276,680 (GRCm38) W859C probably damaging Het
Enpp1 C A 10: 24,661,942 (GRCm38) V382F probably damaging Het
Entpd7 G T 19: 43,725,497 (GRCm38) G432C probably damaging Het
Ep300 ACCC ACCCC 15: 81,630,097 (GRCm38) probably null Het
Ep400 C A 5: 110,683,364 (GRCm38) K2181N unknown Het
Ep400 C A 5: 110,733,743 (GRCm38) R793S unknown Het
Epb41 G T 4: 132,006,083 (GRCm38) T172N probably benign Het
Epb41l1 G T 2: 156,508,827 (GRCm38) E347D probably benign Het
Epb41l2 G T 10: 25,479,741 (GRCm38) C481F probably damaging Het
Epb41l4b A T 4: 57,063,191 (GRCm38) F500I probably benign Het
Epb41l5 C A 1: 119,609,211 (GRCm38) V317L probably damaging Het
Epb42 T A 2: 121,027,725 (GRCm38) I251F probably damaging Het
Epha10 G T 4: 124,881,960 (GRCm38) R29L probably damaging Het
Epha2 A G 4: 141,318,998 (GRCm38) T503A probably benign Het
Ephb4 G T 5: 137,361,359 (GRCm38) R397L probably benign Het
Ephx1 C A 1: 180,999,769 (GRCm38) Q106H possibly damaging Het
Ephx2 G T 14: 66,085,325 (GRCm38) P500T probably damaging Het
Epn2 C G 11: 61,546,424 (GRCm38) K107N probably damaging Het
Epo C G 5: 137,485,732 (GRCm38) probably null Het
Eps15l1 G T 8: 72,381,437 (GRCm38) Q414K probably benign Het
Eps15l1 T A 8: 72,373,078 (GRCm38) probably null Het
Eps8 C A 6: 137,499,581 (GRCm38) probably null Het
Eps8l2 G C 7: 141,342,095 (GRCm38) A29P probably benign Het
Eps8l3 G T 3: 107,881,666 (GRCm38) probably null Het
Epx C T 11: 87,872,767 (GRCm38) R209H probably benign Het
Epx C G 11: 87,869,261 (GRCm38) R509P probably damaging Het
Epx C A 11: 87,869,894 (GRCm38) R404M possibly damaging Het
Eqtn C A 4: 94,907,551 (GRCm38) E304D probably benign Het
Erbb4 CTGT CT 1: 68,259,183 (GRCm38) probably null Het
Erbb4 C A 1: 68,309,643 (GRCm38) R525L probably benign Het
Erbb4 C A 1: 68,290,476 (GRCm38) G627C probably damaging Het
Ercc3 G T 18: 32,254,161 (GRCm38) D476Y probably damaging Het
Ergic1 G A 17: 26,654,887 (GRCm38) V94I Het
Ermap G T 4: 119,185,561 (GRCm38) T255K probably benign Het
Erp27 C A 6: 136,911,646 (GRCm38) probably null Het
Esco2 C G 14: 65,824,936 (GRCm38) probably null Het
Espnl T A 1: 91,323,555 (GRCm38) L124H probably damaging Het
Esrrg G C 1: 188,043,555 (GRCm38) G93A probably benign Het
Etfbkmt G C 6: 149,144,337 (GRCm38) R63P probably damaging Het
Evi5 C A 5: 107,748,379 (GRCm38) G733* probably null Het
Evx1 C A 6: 52,316,687 (GRCm38) P280H probably benign Het
Exoc3l2 G T 7: 19,480,028 (GRCm38) V460L unknown Het
Exoc8 C A 8: 124,897,186 (GRCm38) E147D possibly damaging Het
Exog G T 9: 119,445,080 (GRCm38) G44W unknown Het
Exog G T 9: 119,448,498 (GRCm38) M165I probably damaging Het
Exosc10 G T 4: 148,565,386 (GRCm38) W424C probably damaging Het
Exph5 G T 9: 53,377,419 (GRCm38) E1933D probably benign Het
Exph5 A T 9: 53,374,213 (GRCm38) S865C probably benign Het
Ext2 ACC AC 2: 93,703,275 (GRCm38) probably benign Het
Eya1 G T 1: 14,253,090 (GRCm38) T185N possibly damaging Het
Eya1 C A 1: 14,184,429 (GRCm38) G422V probably damaging Het
Eya2 C A 2: 165,685,593 (GRCm38) A61E probably damaging Het
F10 G A 8: 13,037,845 (GRCm38) S15N probably benign Het
Fabp1 G T 6: 71,201,736 (GRCm38) G66W probably damaging Het
Fam114a2 T G 11: 57,513,258 (GRCm38) E126D probably benign Het
Fam117a G T 11: 95,375,025 (GRCm38) R169L probably damaging Het
Fam122a T G 19: 24,476,803 (GRCm38) Q185P probably damaging Het
Fam124b C G 1: 80,200,088 (GRCm38) R398P probably benign Het
Fam131b C T 6: 42,318,920 (GRCm38) V181I possibly damaging Het
Fam135b C T 15: 71,622,076 (GRCm38) M1I probably null Het
Fam160b2 G T 14: 70,586,204 (GRCm38) S575R not run Het
Fam168b C A 1: 34,819,882 (GRCm38) E64* probably null Het
Fam171a1 G T 2: 3,224,934 (GRCm38) R368L possibly damaging Het
Fam174b G A 7: 73,740,581 (GRCm38) A27T unknown Het
Fam184a C A 10: 53,699,086 (GRCm38) M142I probably damaging Het
Fam196b C A 11: 34,402,725 (GRCm38) P256T probably benign Het
Fam196b G A 11: 34,403,188 (GRCm38) C410Y probably damaging Het
Fam208a C T 14: 27,448,250 (GRCm38) P379S probably damaging Het
Fam208b C A 13: 3,574,234 (GRCm38) R1905S probably damaging Het
Fam221b G T 4: 43,666,039 (GRCm38) P191T probably benign Het
Fam234b A T 6: 135,198,008 (GRCm38) probably benign Het
Fam26e C A 10: 34,096,329 (GRCm38) V37L probably damaging Het
Fam35a T G 14: 34,268,598 (GRCm38) Q117P probably damaging Het
Fam35a C A 14: 34,241,471 (GRCm38) A713S probably benign Het
Fam3b C T 16: 97,512,487 (GRCm38) R8Q probably benign Het
Fam53a C A 5: 33,607,817 (GRCm38) A182S probably benign Het
Fam53c G T 18: 34,770,850 (GRCm38) E392* probably null Het
Fam71e2 G T 7: 4,757,728 (GRCm38) L662I Het
Fam83d A T 2: 158,785,188 (GRCm38) S266C probably damaging Het
Fam83h G A 15: 76,002,962 (GRCm38) P842L probably benign Het
Fam83h G T 15: 76,006,541 (GRCm38) R3S probably damaging Het
Fam90a1b C A X: 94,357,042 (GRCm38) A61S possibly damaging Het
Fam91a1 C A 15: 58,432,548 (GRCm38) S371Y possibly damaging Het
Fanca C T 8: 123,312,629 (GRCm38) R181H probably benign Het
Fancb G T X: 164,982,555 (GRCm38) C11F probably damaging Het
Fancd2 A T 6: 113,545,025 (GRCm38) M194L probably benign Het
Fap G T 2: 62,502,446 (GRCm38) A726E probably damaging Het
Fars2 C A 13: 36,204,731 (GRCm38) Q68K probably benign Het
Fasn C A 11: 120,815,471 (GRCm38) probably null Het
Fastkd2 T C 1: 63,734,837 (GRCm38) probably null Het
Fastkd2 G T 1: 63,734,836 (GRCm38) probably null Het
Fat2 G T 11: 55,278,966 (GRCm38) S2989* probably null Het
Fat3 G T 9: 15,965,991 (GRCm38) T3442K possibly damaging Het
Fat3 C A 9: 15,923,026 (GRCm38) C4090F possibly damaging Het
Fat3 C A 9: 15,969,835 (GRCm38) G3247V probably damaging Het
Fat3 C A 9: 15,947,538 (GRCm38) C3794F probably damaging Het
Fat4 C A 3: 38,981,838 (GRCm38) T3213N probably damaging Het
Fat4 G T 3: 38,890,347 (GRCm38) G1130W probably damaging Het
Fat4 G T 3: 38,888,584 (GRCm38) R542L probably damaging Het
Fbl G A 7: 28,174,832 (GRCm38) G81R unknown Het
Fbn1 C A 2: 125,389,231 (GRCm38) G472C probably damaging Het
Fbn2 G C 18: 58,055,482 (GRCm38) T1620S probably benign Het
Fbn2 G T 18: 58,010,379 (GRCm38) T2868N probably benign Het
Fbn2 C A 18: 58,069,190 (GRCm38) G1297V probably damaging Het
Fbxl2 C G 9: 113,989,345 (GRCm38) G183R probably benign Het
Fbxo15 C A 18: 84,958,308 (GRCm38) Y57* probably null Het
Fbxo16 C A 14: 65,299,358 (GRCm38) T227N probably damaging Het
Fbxo2 G T 4: 148,165,062 (GRCm38) A190S possibly damaging Het
Fbxo21 G T 5: 117,989,171 (GRCm38) D263Y probably damaging Het
Fbxo24 G C 5: 137,621,299 (GRCm38) R222G probably damaging Het
Fbxo38 C T 18: 62,515,464 (GRCm38) E668K probably damaging Het
Fbxo40 C A 16: 36,970,262 (GRCm38) G162V possibly damaging Het
Fbxw11 G T 11: 32,738,480 (GRCm38) R447L probably null Het
Fbxw14 G T 9: 109,276,246 (GRCm38) P284T probably benign Het
Fbxw20 AC A 9: 109,225,887 (GRCm38) probably null Het
Fbxw21 T C 9: 109,145,537 (GRCm38) H305R probably benign Het
Fbxw27 C A 9: 109,772,178 (GRCm38) W291C probably damaging Het
Fcrl1 A T 3: 87,389,363 (GRCm38) Q284L probably damaging Het
Fer1l4 C G 2: 156,048,429 (GRCm38) Q228H probably null Het
Fer1l5 G T 1: 36,409,194 (GRCm38) W1046L probably benign Het
Fermt3 C A 19: 7,014,679 (GRCm38) R111L probably benign Het
Fes T A 7: 80,378,030 (GRCm38) R791W probably damaging Het
Fez1 G T 9: 36,867,759 (GRCm38) R244L probably benign Het
Fezf2 G C 14: 12,344,765 (GRCm38) L141V probably benign Het
Fgb G T 3: 83,045,056 (GRCm38) Q169K probably benign Het
Fgd2 C A 17: 29,378,326 (GRCm38) A540E probably benign Het
Fgfr1 G T 8: 25,570,768 (GRCm38) Q485H possibly damaging Het
Fgfr1 G T 8: 25,563,398 (GRCm38) A230S probably benign Het
Fgfr2 C T 7: 130,198,457 (GRCm38) G368E probably damaging Het
Fgfr4 A C 13: 55,165,929 (GRCm38) E517A probably damaging Het
Fgfr4 G T 13: 55,161,707 (GRCm38) D492Y probably damaging Het
Fhit G C 14: 9,870,128 (GRCm38) H51D probably benign Het
Fhod3 C A 18: 25,020,706 (GRCm38) P415H probably damaging Het
Fign C T 2: 63,979,690 (GRCm38) G412E probably damaging Het
Fign C G 2: 63,979,385 (GRCm38) G514R probably damaging Het
Fitm1 G A 14: 55,576,649 (GRCm38) A201T probably benign Het
Fjx1 C A 2: 102,450,997 (GRCm38) A198S probably benign Het
Fkbp4 T A 6: 128,433,111 (GRCm38) N343Y probably damaging Het
Flg2 G T 3: 93,202,738 (GRCm38) G691V unknown Het
Flg2 G T 3: 93,202,420 (GRCm38) G585V unknown Het
Flnc G T 6: 29,457,130 (GRCm38) G2344C probably damaging Het
Flnc G C 6: 29,447,545 (GRCm38) G1116R probably damaging Het
Flt3 G T 5: 147,383,401 (GRCm38) P51Q probably benign Het
Fmo4 G T 1: 162,803,720 (GRCm38) P226H probably benign Het
Fn3k C G 11: 121,440,274 (GRCm38) Q197E unknown Het
Fnbp1 C A 2: 31,083,059 (GRCm38) R143L probably damaging Het
Folh1 A T 7: 86,744,447 (GRCm38) F385L probably damaging Het
Folh1 A T 7: 86,761,822 (GRCm38) F237L probably benign Het
Fosl2 G C 5: 32,152,933 (GRCm38) R242P probably damaging Het
Foxa1 G T 12: 57,542,417 (GRCm38) T339K probably benign Het
Foxc1 G T 13: 31,807,308 (GRCm38) G34V probably benign Het
Foxd2 C A 4: 114,907,887 (GRCm38) G312V unknown Het
Foxf1 G T 8: 121,084,435 (GRCm38) G13W probably damaging Het
Foxh1 G C 15: 76,669,021 (GRCm38) N164K probably benign Het
Foxi1 G T 11: 34,207,710 (GRCm38) P105H probably damaging Het
Foxi2 G A 7: 135,410,415 (GRCm38) A11T probably benign Het
Foxi2 C A 7: 135,411,958 (GRCm38) P306T probably benign Het
Foxj1 A T 11: 116,332,267 (GRCm38) W237R probably benign Het
Foxn3 T A 12: 99,388,597 (GRCm38) M103L probably benign Het
Foxp1 C A 6: 98,978,161 (GRCm38) V312F unknown Het
Fras1 C A 5: 96,740,983 (GRCm38) A2796D possibly damaging Het
Fras1 G T 5: 96,691,457 (GRCm38) G1612C probably damaging Het
Fras1 T C 5: 96,758,142 (GRCm38) L3135P probably benign Het
Fras1 G T 5: 96,700,251 (GRCm38) E1773D possibly damaging Het
Fras1 C A 5: 96,740,811 (GRCm38) R2739S probably benign Het
Frat2 C G 19: 41,847,287 (GRCm38) A209P probably damaging Het
Frem1 C T 4: 82,940,315 (GRCm38) probably null Het
Frem1 C T 4: 83,016,464 (GRCm38) D87N probably damaging Het
Frem1 C A 4: 83,000,269 (GRCm38) V479L probably benign Het
Frem2 C A 3: 53,655,607 (GRCm38) S493I probably benign Het
Frem2 T A 3: 53,535,166 (GRCm38) Q2650L probably null Het
Frem3 G T 8: 80,616,129 (GRCm38) G1684C possibly damaging Het
Frk T C 10: 34,584,005 (GRCm38) Y199H probably benign Het
Frmpd1 C A 4: 45,275,272 (GRCm38) S475Y probably damaging Het
Frmpd2 G T 14: 33,530,451 (GRCm38) A657S possibly damaging Het
Frmpd2 A T 14: 33,530,505 (GRCm38) K675* probably null Het
Frmpd2 G T 14: 33,530,504 (GRCm38) Q674H probably damaging Het
Frmpd2 A C 14: 33,543,026 (GRCm38) M921L probably benign Het
Frmpd3 C A X: 140,362,232 (GRCm38) D27E possibly damaging Het
Frrs1 G A 3: 116,881,818 (GRCm38) A132T probably damaging Het
Frs2 C A 10: 117,074,379 (GRCm38) W359C probably damaging Het
Fry C G 5: 150,310,437 (GRCm38) R30G possibly damaging Het
Fryl T C 5: 73,041,595 (GRCm38) probably null Het
Fscb G A 12: 64,472,628 (GRCm38) A688V unknown Het
Fsd1 A C 17: 55,996,083 (GRCm38) I351L probably benign Het
Fsd2 C T 7: 81,559,752 (GRCm38) R114Q probably damaging Het
Fsip2 C A 2: 82,987,203 (GRCm38) L4427I possibly damaging Het
Fsip2 G C 2: 82,946,960 (GRCm38) K110N probably damaging Het
Fsip2 G T 2: 82,984,524 (GRCm38) D3534Y probably damaging Het
Fstl3 G T 10: 79,780,108 (GRCm38) E143* probably null Het
Fut1 C A 7: 45,619,229 (GRCm38) S202R probably benign Het
Fyco1 C A 9: 123,828,323 (GRCm38) E929D probably benign Het
Fyttd1 G T 16: 32,877,784 (GRCm38) probably benign Het
Fzd4 CTT CT 7: 89,407,250 (GRCm38) probably null Het
Fzd6 G A 15: 39,031,341 (GRCm38) V301M probably damaging Het
Fzd6 G T 15: 39,007,561 (GRCm38) G59W possibly damaging Het
Gabarapl1 G T 6: 129,541,221 (GRCm38) R42L unknown Het
Gabbr1 G C 17: 37,048,424 (GRCm38) R97P possibly damaging Het
Gabra2 C T 5: 71,007,992 (GRCm38) G212S probably benign Het
Gad1 C A 2: 70,579,130 (GRCm38) N188K probably damaging Het
Gad2 T G 2: 22,635,014 (GRCm38) V270G probably benign Het
Gak AG A 5: 108,585,352 (GRCm38) probably null Het
Galns C A 8: 122,605,206 (GRCm38) D57Y probably damaging Het
Galns C T 8: 122,598,523 (GRCm38) E297K probably benign Het
Galnt10 G C 11: 57,737,000 (GRCm38) E142Q probably benign Het
Galnt15 G T 14: 32,052,365 (GRCm38) W486L probably damaging Het
Galnt16 G T 12: 80,601,810 (GRCm38) W552L probably damaging Het
Galnt16 G A 12: 80,572,347 (GRCm38) A76T probably benign Het
Galnt18 G T 7: 111,485,151 (GRCm38) P536T probably damaging Het
Galnt2 G A 8: 124,343,318 (GRCm38) E525K probably benign Het
Galr1 C A 18: 82,405,772 (GRCm38) A127S probably benign Het
Ganc G T 2: 120,433,794 (GRCm38) W409C probably damaging Het
Gapvd1 T A 2: 34,699,864 (GRCm38) K980I possibly damaging Het
Gata4 A C 14: 63,241,265 (GRCm38) probably benign Het
Gata4 G T 14: 63,200,382 (GRCm38) T441N probably damaging Het
Gatb G T 3: 85,636,973 (GRCm38) R416M probably damaging Het
Gbf1 G T 19: 46,259,142 (GRCm38) K226N probably damaging Het
Gbgt1 C A 2: 28,505,188 (GRCm38) C279* probably null Het
Gbp2b C A 3: 142,604,316 (GRCm38) P289Q possibly damaging Het
Gbp4 T A 5: 105,119,449 (GRCm38) R535* probably null Het
Gbp4 C A 5: 105,125,135 (GRCm38) G215C probably null Het
Gchfr A T 2: 119,169,745 (GRCm38) K36* probably null Het
Gck G T 11: 5,910,958 (GRCm38) Q38K possibly damaging Het
Gclc G T 9: 77,786,739 (GRCm38) S325I probably benign Het
Gcn1l1 A T 5: 115,614,149 (GRCm38) H2108L probably damaging Het
Gcnt4 G A 13: 96,946,453 (GRCm38) G86S probably damaging Het
Gcnt7 G T 2: 172,454,886 (GRCm38) T6N possibly damaging Het
Gdf2 G T 14: 33,945,317 (GRCm38) R332M probably damaging Het
Gdf5 C T 2: 155,942,072 (GRCm38) G320D possibly damaging Het
Gdpd2 T A X: 100,733,982 (GRCm38) C214S probably damaging Het
Gfer TCCC TCC 17: 24,695,887 (GRCm38) probably null Het
Gfm2 C A 13: 97,162,992 (GRCm38) T407K possibly damaging Het
Gfm2 G T 13: 97,162,993 (GRCm38) probably null Het
Gfra2 A T 14: 70,978,492 (GRCm38) Q464L not run Het
Gfral G C 9: 76,205,389 (GRCm38) L87V probably benign Het
Gfy CGGG CGG 7: 45,176,464 (GRCm38) probably null Het
Ggcx G C 6: 72,426,519 (GRCm38) G350R probably benign Het
Ggt6 C A 11: 72,436,599 (GRCm38) R103S probably benign Het
Gimap5 G T 6: 48,752,885 (GRCm38) V130L possibly damaging Het
Gimap7 AG A 6: 48,724,321 (GRCm38) probably null Het
Gimd1 G T 3: 132,635,070 (GRCm38) V116L probably benign Het
Gipr G T 7: 19,157,565 (GRCm38) Q396K probably benign Het
Gja8 G C 3: 96,920,236 (GRCm38) L37V probably damaging Het
Gjb4 T A 4: 127,352,127 (GRCm38) Q7L possibly damaging Het
Gjc2 A T 11: 59,177,617 (GRCm38) L13Q probably damaging Het
Gjc3 C A 5: 137,957,561 (GRCm38) G154V probably damaging Het
Glb1 G C 9: 114,420,422 (GRCm38) E106D probably damaging Het
Glb1l3 A T 9: 26,818,245 (GRCm38) L642Q probably damaging Het
Gldc A T 19: 30,145,748 (GRCm38) V249D possibly damaging Het
Gldc C A 19: 30,110,778 (GRCm38) G827C probably damaging Het
Gldc C A 19: 30,110,779 (GRCm38) M826I probably damaging Het
Gldn C G 9: 54,286,660 (GRCm38) A46G probably benign Het
Gli1 G C 10: 127,335,998 (GRCm38) R296G probably damaging Het
Gli1 T A 10: 127,334,257 (GRCm38) K343M probably damaging Het
Gli1 G T 10: 127,336,691 (GRCm38) P194Q probably benign Het
Glipr1l1 C A 10: 112,078,390 (GRCm38) H219N probably benign Het
Glra4 C A X: 136,757,817 (GRCm38) R417L possibly damaging Het
Glrp1 C T 1: 88,509,802 (GRCm38) G29R not run Het
Glud1 C T 14: 34,310,869 (GRCm38) probably benign Het
Glyr1 C A 16: 5,031,973 (GRCm38) D179Y probably null Het
Gm10324 A G 13: 66,122,394 (GRCm38) K458R probably damaging Het
Gm10378 G T 14: 42,657,124 (GRCm38) M76I Het
Gm10382 C A 5: 125,389,424 (GRCm38) P35T unknown Het
Gm10696 G T 3: 94,176,102 (GRCm38) P134Q probably benign Het
Gm11397 C A 13: 33,404,510 (GRCm38) F359L possibly damaging Het
Gm11492 C G 11: 87,567,922 (GRCm38) T374R probably benign Het
Gm11559 CTGTGTGT CTGTGT 11: 99,864,763 (GRCm38) probably null Het
Gm11639 C A 11: 104,820,518 (GRCm38) T1860K probably benign Het
Gm11639 C A 11: 104,924,019 (GRCm38) A3243D unknown Het
Gm11639 C A 11: 104,739,338 (GRCm38) S965* probably null Het
Gm11808 G C 4: 3,973,193 (GRCm38) P123R probably benign Het
Gm12185 C T 11: 48,916,302 (GRCm38) V21M probably benign Het
Gm12394 G C 4: 42,793,428 (GRCm38) P235A probably damaging Het
Gm12394 C T 4: 42,793,520 (GRCm38) R204H probably damaging Het
Gm12666 A T 4: 92,191,703 (GRCm38) F16Y probably damaging Het
Gm12666 C A 4: 92,191,236 (GRCm38) S116I possibly damaging Het
Gm12695 C A 4: 96,749,223 (GRCm38) K352N probably damaging Het
Gm12794 A T 4: 101,941,125 (GRCm38) K98* probably null Het
Gm12886 A T 4: 121,416,719 (GRCm38) L100* probably null Het
Gm13023 C A 4: 143,794,981 (GRCm38) A389D probably damaging Het
Gm13083 C T 4: 143,616,160 (GRCm38) T279I probably benign Het
Gm13084 C A 4: 143,812,018 (GRCm38) V128F probably benign Het
Gm13101 C A 4: 143,965,591 (GRCm38) G280V probably benign Het
Gm13101 T A 4: 143,965,775 (GRCm38) T219S probably benign Het
Gm13102 G C 4: 144,109,302 (GRCm38) M513I unknown Het
Gm13119 A G 4: 144,362,973 (GRCm38) H287R possibly damaging Het
Gm13128 C A 4: 144,331,193 (GRCm38) D123E probably benign Het
Gm13178 G C 4: 144,703,646 (GRCm38) L258V possibly damaging Het
Gm13889 C G 2: 93,956,825 (GRCm38) E101D unknown Het
Gm13941 T A 2: 111,094,778 (GRCm38) D160V unknown Het
Gm14124 C G 2: 150,268,317 (GRCm38) A309G possibly damaging Het
Gm14124 G T 2: 150,268,324 (GRCm38) K311N possibly damaging Het
Gm14569 G T X: 36,433,871 (GRCm38) P395Q probably benign Het
Gm15557 G T 2: 155,942,468 (GRCm38) A226S probably benign Het
Gm15737 G T 6: 92,879,891 (GRCm38) W100C unknown Het
Gm16486 C G 8: 70,717,103 (GRCm38) R1281G possibly damaging Het
Gm17019 A C 5: 15,032,931 (GRCm38) L3W probably damaging Het
Gm17067 A C 7: 42,708,298 (GRCm38) V260G probably benign Het
Gm17455 G T 10: 60,403,015 (GRCm38) A20S probably benign Het
Gm18596 C T 10: 77,742,621 (GRCm38) M6I unknown Het
Gm19410 A T 8: 35,808,965 (GRCm38) Q1592L possibly damaging Het
Gm20379 C G 13: 92,306,159 (GRCm38) P60R unknown Het
Gm21083 T G 5: 15,577,458 (GRCm38) V41G probably benign Het
Gm21149 G C 5: 15,476,412 (GRCm38) R18G not run Het
Gm21149 G T 5: 15,472,148 (GRCm38) A236D probably damaging Het
Gm21188 C T 13: 120,034,952 (GRCm38) C127Y possibly damaging Het
Gm21190 A C 5: 15,524,974 (GRCm38) D215E not run Het
Gm21190 G T 5: 15,525,807 (GRCm38) Q184K probably benign Het
Gm21190 G A 5: 15,524,894 (GRCm38) P242L probably benign Het
Gm21680 A T 5: 25,972,495 (GRCm38) S32T probably benign Het
Gm21731 C A 13: 120,241,172 (GRCm38) P168Q unknown Het
Gm281 G T 14: 13,845,421 (GRCm38) P497Q Het
Gm281 G T 14: 13,823,754 (GRCm38) T807N Het
Gm28710 G T 5: 16,856,724 (GRCm38) D823Y probably damaging Het
Gm28710 C A 5: 16,835,979 (GRCm38) H591Q possibly damaging Het
Gm28729 C A 9: 96,497,007 (GRCm38) probably null Het
Gm29776 C G 14: 54,696,508 (GRCm38) D205H probably damaging Het
Gm30302 G T 13: 49,787,175 (GRCm38) P353H probably benign Het
Gm32742 T A 9: 51,149,306 (GRCm38) H899L probably benign Het
Gm32742 C T 9: 51,158,276 (GRCm38) probably null Het
Gm3327 G T 14: 44,124,800 (GRCm38) G52V Het
Gm3404 C A 5: 146,526,216 (GRCm38) Y69* probably null Het
Gm35339 G A 15: 76,354,930 (GRCm38) R69H Het
Gm35339 G T 15: 76,363,130 (GRCm38) E1530D Het
Gm38394 C A 1: 133,659,116 (GRCm38) G161V probably damaging Het
Gm40460 C T 7: 142,240,906 (GRCm38) S58N unknown Het
Gm40460 A T 7: 142,240,772 (GRCm38) C103S unknown Het
Gm4131 T A 14: 62,481,022 (GRCm38) H45L possibly damaging Het
Gm42669 C A 5: 107,578,590 (GRCm38) Q558K unknown Het
Gm43302 T A 5: 105,276,796 (GRCm38) Q326L probably damaging Het
Gm44511 T A 6: 128,820,338 (GRCm38) probably null Het
Gm4559 C A 7: 142,274,034 (GRCm38) Q110H unknown Het
Gm45837 G A 7: 101,451,465 (GRCm38) A51T probably benign Het
Gm45861 G T 8: 27,569,951 (GRCm38) G1147C unknown Het
Gm45861 G C 8: 27,535,369 (GRCm38) E772Q unknown Het
Gm4756 C A 12: 72,628,738 (GRCm38) G39V probably damaging Het
Gm4847 G C 1: 166,634,773 (GRCm38) L383V probably damaging Het
Gm4869 G C 5: 140,446,422 (GRCm38) Q39H probably damaging Het
Gm4869 A T 5: 140,460,860 (GRCm38) probably null Het
Gm4869 G C 5: 140,478,985 (GRCm38) R619P probably damaging Het
Gm4884 G T 7: 41,032,737 (GRCm38) probably benign Het
Gm4894 C T 9: 49,278,779 (GRCm38) A118V unknown Het
Gm49358 G T 10: 86,811,582 (GRCm38) G88V Het
Gm49368 G T 7: 128,113,067 (GRCm38) G825V probably damaging Het
Gm4951 C G 18: 60,246,296 (GRCm38) T301S probably benign Het
Gm5114 G T 7: 39,409,326 (GRCm38) Q290K probably benign Het
Gm5145 G T 17: 20,571,052 (GRCm38) G231C probably damaging Het
Gm5148 G A 3: 37,715,005 (GRCm38) A22V probably benign Het
Gm5157 C T 7: 21,185,316 (GRCm38) E101K probably benign Het
Gm5294 G T 5: 138,821,495 (GRCm38) S176I probably damaging Het
Gm5346 C A 8: 43,626,546 (GRCm38) V214L probably damaging Het
Gm5460 C G 14: 34,045,834 (GRCm38) C191W probably benign Het
Gm5678 C A 16: 93,629,932 (GRCm38) S140R probably damaging Het
Gm5737 G T 7: 120,814,534 (GRCm38) D97Y probably damaging Het
Gm5797 G A 14: 7,329,383 (GRCm38) Q202* probably null Het
Gm5868 G T 5: 72,586,346 (GRCm38) H10N probably benign Het
Gm5936 G A X: 74,842,553 (GRCm38) A520T possibly damaging Het
Gm6358 T A 16: 89,141,087 (GRCm38) C71* probably null Het
Gm6583 G C 5: 112,354,918 (GRCm38) H307D probably damaging Het
Gm6588 C A 5: 112,450,006 (GRCm38) L140M probably damaging Het
Gm6588 TACACA TACA 5: 112,450,961 (GRCm38) probably null Het
Gm6592 C A X: 8,846,184 (GRCm38) S120R probably benign Het
Gm6614 A T 6: 141,994,202 (GRCm38) S192T probably damaging Het
Gm6970 G A 19: 47,171,131 (GRCm38) P2S probably benign Het
Gm7102 CGGGG CGGG 19: 61,175,750 (GRCm38) probably null Het
Gm7168 A T 17: 13,949,757 (GRCm38) K462M probably benign Het
Gm7168 G A 17: 13,949,670 (GRCm38) C433Y probably damaging Het
Gm7168 G C 17: 13,949,082 (GRCm38) G237A probably damaging Het
Gm7361 C G 5: 26,261,188 (GRCm38) H183D probably benign Het
Gm765 G C 6: 98,238,240 (GRCm38) H141D probably benign Het
Gm8297 G T 14: 4,986,822 (GRCm38) R150L probably benign Het
Gm8332 G C 12: 88,249,802 (GRCm38) A100G possibly damaging Het
Gm8765 C A 13: 50,702,144 (GRCm38) P606H probably damaging Het
Gm8909 C A 17: 36,165,712 (GRCm38) G262V probably damaging Het
Gm8947 C A 1: 151,192,584 (GRCm38) S56Y possibly damaging Het
Gm9195 C A 14: 72,443,002 (GRCm38) L2207F possibly damaging Het
Gm9195 AGGGGG AGGGGGGG 14: 72,453,434 (GRCm38) probably null Het
Gm9573 G T 17: 35,620,925 (GRCm38) P790T unknown Het
Gm9573 G T 17: 35,621,059 (GRCm38) P745H unknown Het
Gm973 C T 1: 59,541,330 (GRCm38) A124V probably damaging Het
Gm9758 C T 5: 14,910,585 (GRCm38) A212T Het
Gm9758 T A 5: 14,911,458 (GRCm38) Q169L possibly damaging Het
Gm9758 C G 5: 14,913,539 (GRCm38) V92L probably benign Het
Gm9805 A G 17: 22,689,871 (GRCm38) Y34C probably benign Het
Gm9958 G T 5: 90,367,998 (GRCm38) R52M unknown Het
Gna13 G T 11: 109,396,202 (GRCm38) V284F probably damaging Het
Gnai1 C A 5: 18,308,552 (GRCm38) probably null Het
Gnas G T 2: 174,284,887 (GRCm38) A72S unknown Het
Gnat2 T A 3: 108,100,044 (GRCm38) F259L Het
Gnat3 C A 5: 18,015,313 (GRCm38) C224* probably null Het
Gnaz G T 10: 75,014,960 (GRCm38) K272N Het
Gnpat G A 8: 124,863,296 (GRCm38) S20N probably benign Het
Gnptab G T 10: 88,440,270 (GRCm38) A1140S probably damaging Het
Golga5 A T 12: 102,472,005 (GRCm38) probably benign Het
Gon4l C T 3: 88,859,036 (GRCm38) P461S probably damaging Het
Gopc C T 10: 52,350,663 (GRCm38) G277S probably damaging Het
Gp1ba C G 11: 70,639,407 (GRCm38) probably benign Het
Gpatch2 G T 1: 187,225,691 (GRCm38) W81L probably damaging Het
Gpc1 G T 1: 92,857,486 (GRCm38) K382N probably damaging Het
Gpha2 C G 19: 6,227,023 (GRCm38) H51Q probably damaging Het
Gpi1 C A 7: 34,205,645 (GRCm38) probably null Het
Gpkow C T X: 7,697,292 (GRCm38) R23C probably damaging Het
Gpr1 G T 1: 63,183,639 (GRCm38) H146N probably benign Het
Gpr108 C A 17: 57,237,316 (GRCm38) G365C probably damaging Het
Gpr139 C A 7: 119,144,513 (GRCm38) R283L possibly damaging Het
Gpr141 C A 13: 19,752,444 (GRCm38) A54S possibly damaging Het
Gpr149 CA C 3: 62,603,959 (GRCm38) probably null Het
Gpr150 G T 13: 76,056,150 (GRCm38) Y225* probably null Het
Gpr156 G T 16: 38,004,863 (GRCm38) A481S probably benign Het
Gpr158 A T 2: 21,827,272 (GRCm38) D1061V possibly damaging Het
Gpr17 C A 18: 31,947,664 (GRCm38) M115I possibly damaging Het
Gpr174 T A X: 107,293,193 (GRCm38) C204S possibly damaging Het
Gpr179 G T 11: 97,351,239 (GRCm38) L260I probably damaging Het
Gpr180 G T 14: 118,148,201 (GRCm38) G142W probably damaging Het
Gpr35 G T 1: 92,983,016 (GRCm38) W150L probably benign Het
Gpr62 A T 9: 106,465,489 (GRCm38) V80E possibly damaging Het
Gpr87 C A 3: 59,180,070 (GRCm38) V6L probably benign Het
Gprc6a C A 10: 51,615,209 (GRCm38) V815L probably damaging Het
Gprin2 G A 14: 34,195,123 (GRCm38) P230L probably damaging Het
Greb1 C A 12: 16,702,491 (GRCm38) G950V probably damaging Het
Grem1 C G 2: 113,749,649 (GRCm38) R169T possibly damaging Het
Grhl2 G T 15: 37,333,287 (GRCm38) G429W unknown Het
Grhl3 G C 4: 135,552,686 (GRCm38) I352M possibly damaging Het
Grid2 T A 6: 64,345,856 (GRCm38) Y613* probably null Het
Grid2 G T 6: 64,345,857 (GRCm38) G614W probably damaging Het
Grik1 C T 16: 87,946,684 (GRCm38) G537S Het
Grik3 C A 4: 125,650,506 (GRCm38) A340E possibly damaging Het
Grik5 T A 7: 25,015,825 (GRCm38) T674S probably damaging Het
Grin2a C A 16: 9,663,577 (GRCm38) K453N possibly damaging Het
Grin2d C A 7: 45,833,177 (GRCm38) G1192V unknown Het
Grip1 G T 10: 119,986,444 (GRCm38) M437I probably benign Het
Grm2 C A 9: 106,645,065 (GRCm38) V580F possibly damaging Het
Grm4 C A 17: 27,450,194 (GRCm38) E367* probably null Het
Grm4 G T 17: 27,450,221 (GRCm38) R358S probably benign Het
Grm6 C T 11: 50,851,500 (GRCm38) A120V probably benign Het
Grm6 G C 11: 50,851,262 (GRCm38) V41L probably benign Het
Grm6 A T 11: 50,859,867 (GRCm38) Y619F probably damaging Het
Grpel2 C T 18: 61,719,772 (GRCm38) G53E possibly damaging Het
Grrp1 G T 4: 134,251,570 (GRCm38) T199K probably benign Het
Gsap G T 5: 21,251,032 (GRCm38) R409I probably damaging Het
Gse1 A C 8: 120,229,852 (GRCm38) T361P unknown Het
Gsg1l C A 7: 126,082,242 (GRCm38) probably benign Het
Gsk3a C A 7: 25,237,528 (GRCm38) G45C unknown Het
Gsta1 G T 9: 78,232,242 (GRCm38) M1I probably null Het
Gstp2 C T 19: 4,041,583 (GRCm38) probably null Het
Gstp3 C G 19: 4,058,154 (GRCm38) V90L probably benign Het
Gtf3c1 C T 7: 125,667,122 (GRCm38) S1014N probably benign Het
Gtf3c4 T A 2: 28,835,073 (GRCm38) S216C probably damaging Het
Gtpbp3 A T 8: 71,489,069 (GRCm38) probably null Het
Gtse1 G T 15: 85,875,737 (GRCm38) A710S probably damaging Het
Guca1a T C 17: 47,400,410 (GRCm38) I4V probably benign Het
Gucy1a2 C T 9: 3,797,245 (GRCm38) T565I probably damaging Het
Gucy1b1 G T 3: 82,061,112 (GRCm38) A29E probably damaging Het
Gucy1b2 C A 14: 62,453,453 (GRCm38) G42C unknown Het
Gucy2c G T 6: 136,767,196 (GRCm38) T135K probably benign Het
Gucy2c C A 6: 136,719,687 (GRCm38) R704L probably damaging Het
Gucy2g C T 19: 55,210,377 (GRCm38) R778H probably benign Het
Gusb C T 5: 130,002,736 (GRCm38) M27I probably benign Het
Gykl1 G T 18: 52,695,132 (GRCm38) V471L possibly damaging Het
Gypa C A 8: 80,500,998 (GRCm38) H92N unknown Het
Gzmm TGG T 10: 79,695,006 (GRCm38) probably null Het
H1fnt G T 15: 98,257,247 (GRCm38) P7H probably damaging Het
H2afy2 T G 10: 61,739,350 (GRCm38) S356R probably damaging Het
H2-M10.3 C A 17: 36,367,544 (GRCm38) G130W probably damaging Het
H2-M10.3 G T 17: 36,366,579 (GRCm38) A269D probably damaging Het
H2-Q2 C G 17: 35,342,342 (GRCm38) R4G unknown Het
H2-Q5 G T 17: 35,394,504 (GRCm38) R71L Het
H2-Q7 G T 17: 35,442,500 (GRCm38) V282L probably damaging Het
H2-Q7 G T 17: 35,439,162 (GRCm38) probably benign Het
H3f3b C G 11: 116,023,907 (GRCm38) G35R probably benign Het
Habp2 G GT 19: 56,319,553 (GRCm38) probably null Het
Habp4 T G 13: 64,174,068 (GRCm38) V173G probably benign Het
Habp4 G C 13: 64,174,070 (GRCm38) D174H probably damaging Het
Hal G T 10: 93,489,335 (GRCm38) E69* probably null Het
Hand2 G A 8: 57,322,013 (GRCm38) S36N probably benign Het
Hao2 G T 3: 98,882,041 (GRCm38) S110R probably damaging Het
Hao2 C A 3: 98,881,942 (GRCm38) Q143H probably benign Het
Hars2 A T 18: 36,789,575 (GRCm38) E387V probably damaging Het
Hars2 G T 18: 36,790,598 (GRCm38) V481L possibly damaging Het
Has2 C A 15: 56,681,583 (GRCm38) V208L probably benign Het
Has3 C G 8: 106,874,018 (GRCm38) H37Q probably benign Het
Haus4 C A 14: 54,549,960 (GRCm38) L44F probably damaging Het
Havcr1 C T 11: 46,775,498 (GRCm38) L263F probably benign Het
Hbb-bt G C 7: 103,813,589 (GRCm38) I55M possibly damaging Het
Hc T A 2: 35,013,610 (GRCm38) S1011C probably damaging Het
Hcar2 G T 5: 123,865,206 (GRCm38) P78Q probably damaging Het
Hcrtr1 C A 4: 130,133,873 (GRCm38) E263* probably null Het
Hdac11 G T 6: 91,167,834 (GRCm38) R148L possibly damaging Het
Hdac3 C A 18: 37,945,751 (GRCm38) E102D probably benign Het
Hdac4 A T 1: 91,987,611 (GRCm38) N303K probably damaging Het
Hdac4 C A 1: 91,956,047 (GRCm38) D870Y probably damaging Het
Hdac6 C A X: 7,937,985 (GRCm38) E450* probably null Het
Hdgfl2 G T 17: 56,099,343 (GRCm38) G576V unknown Het
Heatr4 C G 12: 83,980,478 (GRCm38) A2P probably benign Het
Heatr6 G T 11: 83,781,382 (GRCm38) R1072L probably damaging Het
Heatr6 G T 11: 83,766,081 (GRCm38) A390S probably benign Het
Hectd3 G T 4: 116,998,760 (GRCm38) D419Y probably damaging Het
Hectd4 T A 5: 121,358,320 (GRCm38) M3925K probably benign Het
Hecw2 T A 1: 53,923,943 (GRCm38) Q803L possibly damaging Het
Heg1 G T 16: 33,720,687 (GRCm38) G405C probably damaging Het
Helb T G 10: 120,092,690 (GRCm38) probably null Het
Helz2 C A 2: 181,235,961 (GRCm38) G1015C probably damaging Het
Hemgn G A 4: 46,400,693 (GRCm38) L56F possibly damaging Het
Hepacam2 G T 6: 3,483,352 (GRCm38) T219N probably benign Het
Hephl1 A C 9: 15,090,054 (GRCm38) D258E probably damaging Het
Herc1 G A 9: 66,458,425 (GRCm38) S354N probably null Het
Herc1 G A 9: 66,471,911 (GRCm38) S3493N probably damaging Het
Herc2 G A 7: 56,131,292 (GRCm38) G1235D probably benign Het
Herc2 G T 7: 56,121,589 (GRCm38) R1033L possibly damaging Het
Herpud2 C G 9: 25,130,622 (GRCm38) V85L not run Het
Hes5 G T 4: 154,961,442 (GRCm38) G91C probably damaging Het
Hfe C A 13: 23,706,037 (GRCm38) W251L probably damaging Het
Hfe2 G A 3: 96,527,197 (GRCm38) R84Q possibly damaging Het
Hfe2 G T 3: 96,528,087 (GRCm38) M220I probably benign Het
Hfm1 C G 5: 106,871,820 (GRCm38) D1116H probably benign Het
Hgd T G 16: 37,589,719 (GRCm38) L39R probably damaging Het
Hgs A T 11: 120,478,565 (GRCm38) Q360L probably benign Het
Hhat C A 1: 192,661,492 (GRCm38) probably null Het
Hhip GCCCC GCCCCC 8: 80,057,251 (GRCm38) probably null Het
Hhla1 G A 15: 65,941,775 (GRCm38) T236I probably damaging Het
Hibadh C A 6: 52,619,995 (GRCm38) D155Y probably damaging Het
Hid1 G T 11: 115,352,725 (GRCm38) S499Y probably damaging Het
Hip1 C A 5: 135,428,606 (GRCm38) R722I probably benign Het
Hira G T 16: 18,912,149 (GRCm38) K199N probably damaging Het
Hist1h1c G T 13: 23,739,219 (GRCm38) G124V unknown Het
Hist1h2ag C A 13: 22,042,804 (GRCm38) E42* probably null Het
Hist1h2ah C G 13: 22,035,350 (GRCm38) G68A probably damaging Het
Hist1h3a C T 13: 23,762,022 (GRCm38) C111Y probably damaging Het
Hist1h3a C A 13: 23,762,250 (GRCm38) G35V possibly damaging Het
Hist1h3f G T 13: 23,544,556 (GRCm38) K24N probably damaging Het
Hist1h3i C T 13: 21,783,103 (GRCm38) V90I probably benign Het
Hist2h3c2 G T 3: 96,238,548 (GRCm38) R132S probably damaging Het
Hivep1 G T 13: 42,159,981 (GRCm38) R1899M possibly damaging Het
Hivep2 G T 10: 14,143,307 (GRCm38) V1941F probably damaging Het
Hivep2 G A 10: 14,131,786 (GRCm38) G1376E probably damaging Het
Hivep3 G T 4: 120,095,946 (GRCm38) R486S possibly damaging Het
Hivep3 G T 4: 120,131,778 (GRCm38) E1809* probably null Het
Hk3 C A 13: 55,010,708 (GRCm38) G615C probably damaging Het
Hk3 A G 13: 55,010,710 (GRCm38) L614P probably damaging Het
Hmces G T 6: 87,936,130 (GRCm38) W289L possibly damaging Het
Hmcn2 C A 2: 31,426,824 (GRCm38) S3805Y probably damaging Het
Hmcn2 G T 2: 31,344,506 (GRCm38) G311V probably damaging Het
Hmox2 G T 16: 4,757,128 (GRCm38) probably benign Het
Hmx2 GC G 7: 131,555,534 (GRCm38) probably null Het
Hmx3 G T 7: 131,543,120 (GRCm38) R53L probably benign Het
Hnrnpa2b1 C A 6: 51,464,529 (GRCm38) S247I unknown Het
Hnrnpc C A 14: 52,077,429 (GRCm38) R180M possibly damaging Het
Hnrnpll C A 17: 80,048,610 (GRCm38) R316L probably benign Het
Hnrnpm C A 17: 33,658,401 (GRCm38) M368I probably benign Het
Hnrnpm C A 17: 33,646,745 (GRCm38) G637V probably damaging Het
Hoxa11 C A 6: 52,245,110 (GRCm38) E204* probably null Het
Hoxa4 G A 6: 52,191,636 (GRCm38) P18L unknown Het
Hoxb2 C A 11: 96,351,989 (GRCm38) A60D probably damaging Het
Hoxd11 G T 2: 74,682,415 (GRCm38) G8V probably damaging Het
Hoxd9 C A 2: 74,698,525 (GRCm38) P157Q probably benign Het
Hp1bp3 C T 4: 138,221,673 (GRCm38) L16F not run Het
Hpf1 A G 8: 60,895,635 (GRCm38) H128R probably damaging Het
Hps1 C A 19: 42,759,831 (GRCm38) G552C probably damaging Het
Hps1 C A 19: 42,755,696 (GRCm38) V693L probably benign Het
Hps1 T G 19: 42,766,218 (GRCm38) probably null Het
Hps3 C A 3: 20,008,901 (GRCm38) G833C probably damaging Het
Hps4 G T 5: 112,370,377 (GRCm38) G412V probably damaging Het
Hrc C T 7: 45,336,970 (GRCm38) P515L probably benign Het
Hrg G T 16: 22,953,712 (GRCm38) W90C probably damaging Het
Hsd17b1 G T 11: 101,079,745 (GRCm38) D209Y probably damaging Het
Hsd17b4 G A 18: 50,181,980 (GRCm38) V605M probably benign Het
Hsf5 G T 11: 87,638,133 (GRCm38) G565* probably null Het
Hsp90aa1 G A 12: 110,693,466 (GRCm38) P396L probably damaging Het
Hspa1l C T 17: 34,978,016 (GRCm38) R344C probably benign Het
Hspa8 G A 9: 40,802,805 (GRCm38) D160N probably damaging Het
Hspa8 A C 9: 40,802,802 (GRCm38) K159Q probably damaging Het
Hspa9 C A 18: 34,943,145 (GRCm38) Q371H possibly damaging Het
Hspd1 T G 1: 55,080,266 (GRCm38) T351P probably damaging Het
Hspg2 G T 4: 137,568,373 (GRCm38) Q4239H possibly damaging Het
Hspg2 C A 4: 137,564,518 (GRCm38) L3975I probably damaging Het
Hspg2 G T 4: 137,550,467 (GRCm38) G2959V probably damaging Het
Htatsf1 A G X: 57,065,713 (GRCm38) E378G probably damaging Het
Htr1a T G 13: 105,444,876 (GRCm38) L208R probably damaging Het
Htr4 C G 18: 62,437,608 (GRCm38) Q245E probably benign Het
Htr5b C T 1: 121,527,739 (GRCm38) D151N probably damaging Het
Htra2 C T 6: 83,053,756 (GRCm38) D190N probably damaging Het
Htt G T 5: 34,852,231 (GRCm38) A1519S probably null Het
Hunk G T 16: 90,481,321 (GRCm38) K415N possibly damaging Het
Hus1b C A 13: 30,946,992 (GRCm38) R228L probably benign Het
Hydin C A 8: 110,450,232 (GRCm38) H973Q possibly damaging Het
Hydin T A 8: 110,609,989 (GRCm38) C5133S probably benign Het
Hydin CG C 8: 110,587,142 (GRCm38) probably null Het
Hydin C A 8: 110,380,610 (GRCm38) P473Q probably damaging Het
Hykk G T 9: 54,946,429 (GRCm38) W345L possibly damaging Het
Iars2 T A 1: 185,315,895 (GRCm38) R547* probably null Het
Icam5 G T 9: 21,035,548 (GRCm38) L457F possibly damaging Het
Idh3a G T 9: 54,596,149 (GRCm38) R164L probably damaging Het
Idi1 G T 13: 8,888,019 (GRCm38) R167L probably damaging Het
Idua AGG AG 5: 108,680,623 (GRCm38) probably null Het
Idua G C 5: 108,679,584 (GRCm38) G128R probably null Het
Ifi207 C A 1: 173,729,579 (GRCm38) G531V probably damaging Het
Ifi27l2b C A 12: 103,455,860 (GRCm38) V82F probably damaging Het
Ifi44 G T 3: 151,749,438 (GRCm38) T50N probably damaging Het
Ifi47 G T 11: 49,096,275 (GRCm38) E290* probably null Het
Ifna13 C A 4: 88,644,378 (GRCm38) R3M probably benign Het
Igf2bp3 G T 6: 49,214,428 (GRCm38) P15H possibly damaging Het
Igf2r G T 17: 12,697,399 (GRCm38) L1691M probably damaging Het
Igfn1 C A 1: 135,955,809 (GRCm38) G2653V probably damaging Het
Igfn1 C T 1: 135,982,426 (GRCm38) C140Y possibly damaging Het
Igfn1 C A 1: 135,969,567 (GRCm38) W1087L probably benign Het
Ighg2c C A 12: 113,287,680 (GRCm38) L238F Het
Ighmbp2 C A 19: 3,271,665 (GRCm38) E365* probably null Het
Ighmbp2 C A 19: 3,267,242 (GRCm38) Q543H probably null Het
Ighmbp2 C A 19: 3,265,635 (GRCm38) R595L probably damaging Het
Ighv1-23 A C 12: 114,764,685 (GRCm38) L39R probably damaging Het
Ighv1-4 G T 12: 114,487,404 (GRCm38) A28D possibly damaging Het
Ighv1-58 C T 12: 115,312,324 (GRCm38) E65K possibly damaging Het
Ighv16-1 T C 12: 114,069,125 (GRCm38) E19G possibly damaging Het
Ighv1-64 G A 12: 115,507,666 (GRCm38) T77I probably benign Het
Ighv1-69 A C 12: 115,623,253 (GRCm38) S87A probably benign Het
Ighv1-72 C T 12: 115,758,201 (GRCm38) G45D probably damaging Het
Ighv1-9 C A 12: 114,583,699 (GRCm38) S74I probably benign Het
Ighv2-3 G C 12: 113,611,591 (GRCm38) C9W possibly damaging Het
Ighv7-3 C G 12: 114,153,288 (GRCm38) V85L probably benign Het
Igkv1-117 C A 6: 68,121,594 (GRCm38) C42* probably null Het
Igkv13-84 AGG AG 6: 68,939,860 (GRCm38) probably null Het
Igkv3-2 G T 6: 70,699,015 (GRCm38) E103* probably null Het
Igkv3-2 A T 6: 70,699,046 (GRCm38) Q113L probably benign Het
Igkv3-5 C A 6: 70,663,670 (GRCm38) A45D probably damaging Het
Igkv4-79 C T 6: 69,043,059 (GRCm38) G91R probably damaging Het
Igkv8-19 C T 6: 70,340,922 (GRCm38) E107K possibly damaging Het
Igkv8-19 T A 6: 70,340,921 (GRCm38) E107V probably damaging Het
Iglv3 G A 16: 19,241,452 (GRCm38) T42I probably damaging Het
Igsf10 C A 3: 59,329,605 (GRCm38) E1052* probably null Het
Igsf5 C A 16: 96,378,333 (GRCm38) Q209K probably benign Het
Igsf9 C A 1: 172,494,872 (GRCm38) P545T probably damaging Het
Igsf9b C A 9: 27,334,292 (GRCm38) P1185H probably damaging Het
Ikzf4 C A 10: 128,642,640 (GRCm38) R92L possibly damaging Het
Il10 G C 1: 131,021,395 (GRCm38) A98P probably damaging Het
Il17rd A C 14: 27,100,261 (GRCm38) H648P probably damaging Het
Il17re G T 6: 113,464,792 (GRCm38) R216L possibly damaging Het
Il1b C A 2: 129,369,745 (GRCm38) E18D probably benign Het
Il1rapl1 C A X: 86,748,464 (GRCm38) D417Y probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 (GRCm38) probably benign Het
Il20 C T 1: 130,911,387 (GRCm38) probably benign Het
Il22ra1 C A 4: 135,737,406 (GRCm38) P141H probably damaging Het
Il25 G T 14: 54,935,207 (GRCm38) G120C probably damaging Het
Il27ra TCCC TCC 8: 84,040,975 (GRCm38) probably null Het
Il31 C A 5: 123,480,579 (GRCm38) W111L probably benign Het
Il31 G T 5: 123,480,705 (GRCm38) S69* probably null Het
Il5ra C A 6: 106,741,134 (GRCm38) G120* probably null Het
Il7r G T 15: 9,510,229 (GRCm38) T246N probably benign Het
Il7r C T 15: 9,508,057 (GRCm38) G393D probably benign Het
Ildr2 G T 1: 166,309,049 (GRCm38) G486C probably damaging Het
Ilvbl A T 10: 78,581,124 (GRCm38) N374Y probably damaging Het
Impa1 C A 3: 10,316,074 (GRCm38) Q249H probably benign Het
Impa2 G T 18: 67,309,052 (GRCm38) R114S probably benign Het
Impact G T 18: 12,988,366 (GRCm38) R246L probably damaging Het
Ina G T 19: 47,014,911 (GRCm38) A53S Het
Inafm1 C G 7: 16,273,217 (GRCm38) G25A unknown Het
Incenp C A 19: 9,899,364 (GRCm38) probably benign Het
Inpp5a T G 7: 139,525,775 (GRCm38) L214R probably damaging Het
Inpp5j G T 11: 3,502,191 (GRCm38) P353Q probably damaging Het
Insm2 C T 12: 55,600,356 (GRCm38) P295L probably benign Het
Insrr C G 3: 87,800,827 (GRCm38) S192W possibly damaging Het
Ints1 C A 5: 139,771,638 (GRCm38) V375L possibly damaging Het
Ints3 C T 3: 90,406,356 (GRCm38) G322S probably damaging Het
Ints5 G T 19: 8,894,973 (GRCm38) G99C probably damaging Het
Ints5 G T 19: 8,894,935 (GRCm38) R86L probably benign Het
Ints7 G T 1: 191,610,458 (GRCm38) S522I probably benign Het
Intu A T 3: 40,697,516 (GRCm38) H801L possibly damaging Het
Ipo8 T G 6: 148,796,712 (GRCm38) K604Q probably damaging Het
Iqcf1 AC A 9: 106,502,114 (GRCm38) probably null Het
Iqcg G A 16: 33,029,020 (GRCm38) Q299* probably null Het
Iqgap3 G T 3: 88,088,971 (GRCm38) probably null Het
Irf4 G C 13: 30,750,663 (GRCm38) L28F probably damaging Het
Irf4 T G 13: 30,750,661 (GRCm38) L28V probably damaging Het
Irgc1 C A 7: 24,432,955 (GRCm38) V146L probably benign Het
Irs1 C A 1: 82,290,394 (GRCm38) A34S probably benign Het
Irs1 C G 1: 82,288,996 (GRCm38) A500P possibly damaging Het
Irx2 C T 13: 72,629,089 (GRCm38) Q10* probably null Het
Ism2 A T 12: 87,280,035 (GRCm38) W377R probably damaging Het
Isx GCCCC GCCC 8: 74,891,859 (GRCm38) probably null Het
Itch A T 2: 155,209,059 (GRCm38) R555S probably damaging Het
Itga1 C T 13: 114,985,071 (GRCm38) probably null Het
Itga2 C G 13: 114,853,701 (GRCm38) probably null Het
Itga2b C A 11: 102,467,076 (GRCm38) G200V probably damaging Het
Itga3 C T 11: 95,056,774 (GRCm38) G668E probably damaging Het
Itga7 G T 10: 128,943,214 (GRCm38) W369C probably damaging Het
Itga8 C A 2: 12,300,933 (GRCm38) S82I possibly damaging Het
Itgad C T 7: 128,189,501 (GRCm38) P467S probably damaging Het
Itgax G T 7: 128,148,062 (GRCm38) W982C probably benign Het
Itgb2l G T 16: 96,437,356 (GRCm38) P81H probably damaging Het
Itgb4 C G 11: 115,998,058 (GRCm38) R1076G probably benign Het
Itgb4 T A 11: 115,986,811 (GRCm38) L552Q probably damaging Het
Itih1 C G 14: 30,929,572 (GRCm38) D892H possibly damaging Het
Itm2a C A X: 107,399,128 (GRCm38) D137Y probably damaging Het
Itpka C A 2: 119,749,421 (GRCm38) H214N probably benign Het
Itpka C T 2: 119,750,775 (GRCm38) R430W probably damaging Het
Itpkc TC T 7: 27,227,781 (GRCm38) probably null Het
Itpr3 G C 17: 27,114,929 (GRCm38) R2020P probably damaging Het
Itpr3 G A 17: 27,119,987 (GRCm38) D2581N probably damaging Het
Jade2 C T 11: 51,816,990 (GRCm38) D799N probably damaging Het
Jade2 C A 11: 51,848,994 (GRCm38) G20C probably null Het
Jag1 C A 2: 137,085,019 (GRCm38) S940I probably benign Het
Jakmip1 C T 5: 37,091,583 (GRCm38) R196C probably damaging Het
Jakmip1 AG A 5: 37,175,307 (GRCm38) probably null Het
Jmjd1c T C 10: 67,238,174 (GRCm38) L1896P probably benign Het
Jmjd1c A G 10: 67,246,125 (GRCm38) I2161M probably damaging Het
Jmjd4 G T 11: 59,450,274 (GRCm38) E10D probably benign Het
Jph2 T A 2: 163,376,377 (GRCm38) probably null Het
Jph4 C A 14: 55,114,926 (GRCm38) G117C probably damaging Het
Kalrn C A 16: 34,035,506 (GRCm38) G1920V probably damaging Het
Kank2 T A 9: 21,795,249 (GRCm38) T158S probably damaging Het
Kat6a G T 8: 22,940,166 (GRCm38) G1846W unknown Het
Kazn G T 4: 142,154,504 (GRCm38) H142N Het
Kbtbd11 G C 8: 15,027,694 (GRCm38) E98Q probably benign Het
Kbtbd12 C A 6: 88,618,668 (GRCm38) C60F probably damaging Het
Kcna5 G T 6: 126,533,990 (GRCm38) R392S probably damaging Het
Kcna7 G C 7: 45,409,183 (GRCm38) R298P probably damaging Het
Kcnab1 C A 3: 65,266,510 (GRCm38) L81I probably damaging Het
Kcnab1 C A 3: 65,357,133 (GRCm38) H268N probably benign Het
Kcnb2 G T 1: 15,710,958 (GRCm38) G685C possibly damaging Het
Kcnc1 C G 7: 46,397,852 (GRCm38) R59G probably damaging Het
Kcnc2 G T 10: 112,272,306 (GRCm38) G201W probably damaging Het
Kcnc3 G T 7: 44,596,106 (GRCm38) G607W probably damaging Het
Kcnd2 G T 6: 21,216,416 (GRCm38) D40Y probably damaging Het
Kcnd3 ACC A 3: 105,459,570 (GRCm38) probably null Het
Kcnh5 G C 12: 75,114,522 (GRCm38) P204R probably damaging Het
Kcnh5 G T 12: 75,007,797 (GRCm38) L458I possibly damaging Het
Kcnh8 C G 17: 52,978,093 (GRCm38) C1030W possibly damaging Het
Kcnh8 G C 17: 52,803,471 (GRCm38) V237L probably damaging Het
Kcnip3 C A 2: 127,510,881 (GRCm38) A73S probably benign Het
Kcnj1 C T 9: 32,397,359 (GRCm38) L360F probably damaging Het
Kcnj10 C A 1: 172,369,135 (GRCm38) S72Y possibly damaging Het
Kcnj10 C A 1: 172,369,221 (GRCm38) P101T probably benign Het
Kcnj14 G T 7: 45,819,909 (GRCm38) C57* probably null Het
Kcnj16 G T 11: 111,024,553 (GRCm38) D14Y possibly damaging Het
Kcnj16 G A 11: 111,025,770 (GRCm38) M419I probably benign Het
Kcnj4 C G 15: 79,485,169 (GRCm38) W203C probably damaging Het
Kcnj5 G T 9: 32,317,698 (GRCm38) P381H possibly damaging Het
Kcnj9 G T 1: 172,323,183 (GRCm38) Q288K possibly damaging Het
Kcnk1 A C 8: 126,029,653 (GRCm38) T305P probably benign Het
Kcnk12 G A 17: 87,746,043 (GRCm38) P397L probably benign Het
Kcnk13 A T 12: 100,061,529 (GRCm38) N288Y possibly damaging Het
Kcnk18 C CA 19: 59,225,479 (GRCm38) probably null Het
Kcnk3 G C 5: 30,622,493 (GRCm38) A296P probably benign Het
Kcnk3 G T 5: 30,622,704 (GRCm38) G366V possibly damaging Het
Kcnk3 G T 5: 30,588,274 (GRCm38) probably benign Het
Kcnk5 C A 14: 20,181,374 (GRCm38) E27* probably null Het
Kcnk5 G C 14: 20,145,050 (GRCm38) P124R probably damaging Het
Kcnn3 G T 3: 89,661,136 (GRCm38) A574S possibly damaging Het
Kcnn3 G A 3: 89,520,923 (GRCm38) G152E probably damaging Het
Kcnq1 G T 7: 143,108,464 (GRCm38) probably benign Het
Kcnq3 G C 15: 65,995,452 (GRCm38) R781G possibly damaging Het
Kcnt1 G T 2: 25,901,228 (GRCm38) E528* probably null Het
Kcnt1 C T 2: 25,909,265 (GRCm38) R949* probably null Het
Kcnt2 C A 1: 140,609,648 (GRCm38) P1115H possibly damaging Het
Kcnu1 G T 8: 25,849,764 (GRCm38) G37W probably damaging Het
Kcnv1 C A 15: 45,114,435 (GRCm38) G69V probably damaging Het
Kcnv2 C A 19: 27,323,241 (GRCm38) A164E probably benign Het
Kcp C A 6: 29,485,525 (GRCm38) V1157L probably benign Het
Kctd12 C G 14: 102,981,918 (GRCm38) G175R not run Het
Kctd19 G T 8: 105,388,517 (GRCm38) H471N probably damaging Het
Kdelr1 G T 7: 45,872,948 (GRCm38) probably benign Het
Kdm2b C A 5: 122,880,797 (GRCm38) R860L probably damaging Het
Kdm4a C T 4: 118,147,169 (GRCm38) D691N probably benign Het
Kdm5b AGG AG 1: 134,595,798 (GRCm38) probably null Het
Kdm6b T A 11: 69,403,866 (GRCm38) Q1162L unknown Het
Kdr C A 5: 75,968,475 (GRCm38) K170N probably benign Het
Kel T A 6: 41,689,559 (GRCm38) Q446L probably benign Het
Khdrbs2 C G 1: 32,243,967 (GRCm38) I53M probably benign Het
Khdrbs3 G T 15: 68,928,831 (GRCm38) R29L probably benign Het
Kif11 G T 19: 37,413,287 (GRCm38) G904V possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 (GRCm38) probably benign Het
Kif14 G T 1: 136,478,365 (GRCm38) A556S probably benign Het
Kif15 G T 9: 122,951,051 (GRCm38) probably benign Het
Kif16b C G 2: 142,711,824 (GRCm38) R1018P probably damaging Het
Kif17 G T 4: 138,287,930 (GRCm38) E463D probably benign Het
Kif18a G T 2: 109,294,957 (GRCm38) D240Y probably damaging Het
Kif19a C G 11: 114,784,904 (GRCm38) R401G probably benign Het
Kif19a C A 11: 114,781,315 (GRCm38) Q243K probably benign Het
Kif1c G T 11: 70,702,893 (GRCm38) G32C probably damaging Het
Kif20b G T 19: 34,950,466 (GRCm38) E1043* probably null Het
Kif21b C G 1: 136,148,312 (GRCm38) R280G probably damaging Het
Kif23 C G 9: 61,924,163 (GRCm38) Q708H possibly damaging Het
Kif26a G T 12: 112,177,611 (GRCm38) R1433L probably damaging Het
Kif26b G T 1: 178,821,550 (GRCm38) E412* probably null Het
Kif26b C G 1: 178,821,548 (GRCm38) A411G probably benign Het
Kif26b C A 1: 178,915,405 (GRCm38) S1022* probably null Het
Kif28 C T 1: 179,728,219 (GRCm38) R333Q not run Het
Kif3c G T 12: 3,367,245 (GRCm38) G422V probably damaging Het
Kif5a G T 10: 127,229,823 (GRCm38) D1013E probably benign Het
Kif5a T A 10: 127,236,967 (GRCm38) K685* probably null Het
Kif6 G A 17: 49,715,100 (GRCm38) A343T probably damaging Het
Kifap3 G T 1: 163,862,062 (GRCm38) W538C probably damaging Het
Kifc2 G T 15: 76,661,288 (GRCm38) E78D possibly damaging Het
Kirrel C A 3: 87,083,875 (GRCm38) E629* probably null Het
Kirrel2 C A 7: 30,452,746 (GRCm38) G479V probably benign Het
Kiz C A 2: 146,935,827 (GRCm38) H468Q possibly damaging Het
Klb G T 5: 65,348,741 (GRCm38) W110C probably damaging Het
Klc4 C T 17: 46,635,409 (GRCm38) probably null Het
Klf6 G T 13: 5,864,882 (GRCm38) E107* probably null Het
Klhdc3 C A 17: 46,676,751 (GRCm38) R292L probably damaging Het
Klhdc7a G C 4: 139,967,000 (GRCm38) T212R probably benign Het
Klhdc7a G T 4: 139,965,662 (GRCm38) T658N probably benign Het
Klhl11 T A 11: 100,463,966 (GRCm38) Q343L probably benign Het
Klhl14 G C 18: 21,652,104 (GRCm38) Q89E probably benign Het
Klhl15 A T X: 94,252,872 (GRCm38) R151W probably damaging Het
Klhl25 G C 7: 75,866,122 (GRCm38) D259H possibly damaging Het
Klhl29 C A 12: 5,081,152 (GRCm38) *876L probably null Het
Klhl3 C A 13: 58,009,409 (GRCm38) V588L probably benign Het
Klhl38 T A 15: 58,314,936 (GRCm38) Y546F possibly damaging Het
Klhl4 C A X: 114,551,602 (GRCm38) S560R probably damaging Het
Klhl40 G T 9: 121,780,693 (GRCm38) A515S probably benign Het
Klhl6 C A 16: 19,982,961 (GRCm38) E15* probably null Het
Klhl8 C A 5: 103,886,039 (GRCm38) R37S probably benign Het
Klk11 C A 7: 43,778,335 (GRCm38) L183M possibly damaging Het
Klkb1 G A 8: 45,275,472 (GRCm38) H417Y probably damaging Het
Klra3 C A 6: 130,330,121 (GRCm38) probably null Het
Klrb1c G T 6: 128,788,447 (GRCm38) P60Q probably damaging Het
Klrb1f G C 6: 129,052,503 (GRCm38) G44R possibly damaging Het
Klrc2 A T 6: 129,660,417 (GRCm38) L47Q probably benign Het
Klrg2 G A 6: 38,636,916 (GRCm38) R51C probably damaging Het
Kmo C A 1: 175,649,186 (GRCm38) L162I probably damaging Het
Kmt2a G T 9: 44,819,121 (GRCm38) P3300T unknown Het
Kmt2b C A 7: 30,586,416 (GRCm38) R350S unknown Het
Kmt2b C A 7: 30,575,024 (GRCm38) G2085V probably benign Het
Kmt2b G A 7: 30,584,163 (GRCm38) P924L probably damaging Het
Kmt2c C G 5: 25,295,397 (GRCm38) probably null Het
Kmt2c C A 5: 25,366,197 (GRCm38) probably null Het
Kmt2c C A 5: 25,300,003 (GRCm38) A3436S probably benign Het
Kmt2e G T 5: 23,481,208 (GRCm38) probably null Het
Kmt5c G T 7: 4,746,700 (GRCm38) V406L probably damaging Het
Kndc1 G T 7: 139,921,912 (GRCm38) S955I possibly damaging Het
Kng1 T G 16: 23,073,389 (GRCm38) M234R probably benign Het
Kras C A 6: 145,246,772 (GRCm38) G12C probably damaging Het
Krba1 G T 6: 48,413,256 (GRCm38) W686C probably damaging Het
Krba1 G T 6: 48,415,894 (GRCm38) R914L probably damaging Het
Krt1 T A 15: 101,850,535 (GRCm38) S65C unknown Het
Krt1 C A 15: 101,846,016 (GRCm38) G600C unknown Het
Krt10 G T 11: 99,386,232 (GRCm38) H460N unknown Het
Krt12 C A 11: 99,422,104 (GRCm38) G38V unknown Het
Krt17 A G 11: 100,259,196 (GRCm38) Y217H probably damaging Het
Krt17 C T 11: 100,259,711 (GRCm38) D167N possibly damaging Het
Krt2 C A 15: 101,811,550 (GRCm38) G562* probably null Het
Krt32 G T 11: 100,084,069 (GRCm38) R351S possibly damaging Het
Krt35 G T 11: 100,096,057 (GRCm38) R44S probably benign Het
Krt42 C A 11: 100,267,068 (GRCm38) R190L probably damaging Het
Krt6b C G 15: 101,678,332 (GRCm38) E283Q probably damaging Het
Krt7 G T 15: 101,423,467 (GRCm38) K388N probably damaging Het
Krt72 A T 15: 101,778,308 (GRCm38) L401Q probably damaging Het
Krt73 C A 15: 101,793,811 (GRCm38) R539I probably damaging Het
Krt75 G T 15: 101,571,054 (GRCm38) D280E probably benign Het
Krt78 C T 15: 101,947,660 (GRCm38) G572E probably benign Het
Krt8 T A 15: 101,999,435 (GRCm38) E235V probably damaging Het
Krt84 TG T 15: 101,525,982 (GRCm38) probably null Het
Krt86 G C 15: 101,476,897 (GRCm38) R316P probably damaging Het
Krtap1-5 G C 11: 99,580,857 (GRCm38) P37A unknown Het
Krtap28-10 C A 1: 83,042,159 (GRCm38) G87C unknown Het
Krtap5-1 C G 7: 142,296,960 (GRCm38) G37A unknown Het
Krtap5-2 C A 7: 142,175,781 (GRCm38) G54V unknown Het
Krtap5-3 G T 7: 142,202,053 (GRCm38) C209F unknown Het
Ksr2 G C 5: 117,708,200 (GRCm38) E711Q probably damaging Het
Ksr2 C A 5: 117,747,408 (GRCm38) Q766K probably damaging Het
Ktn1 G T 14: 47,692,438 (GRCm38) probably null Het
L3mbtl3 C A 10: 26,280,402 (GRCm38) E636* probably null Het
L3mbtl3 C A 10: 26,302,663 (GRCm38) G551C unknown Het
Lama1 G A 17: 67,752,883 (GRCm38) D656N probably benign Het
Lama3 A T 18: 12,429,879 (GRCm38) probably null Het
Lama4 G T 10: 39,005,424 (GRCm38) G70* probably null Het
Lama4 G T 10: 39,005,425 (GRCm38) G70V probably damaging Het
Lama5 C A 2: 180,189,419 (GRCm38) V1816L probably damaging Het
Lama5 C A 2: 180,190,714 (GRCm38) A1681S possibly damaging Het
Lama5 G C 2: 180,183,630 (GRCm38) D2450E probably benign Het
Lama5 C T 2: 180,198,810 (GRCm38) G599R probably damaging Het
Lao1 C A 4: 118,968,371 (GRCm38) P463T probably damaging Het
Larp1 G T 11: 58,049,787 (GRCm38) E580* probably null Het
Lars2 G T 9: 123,454,782 (GRCm38) R705M probably damaging Het
Lbp C T 2: 158,320,306 (GRCm38) P263S probably benign Het
Lce1b A T 3: 92,656,035 (GRCm38) C64S unknown Het
Lce1f C T 3: 92,719,198 (GRCm38) G51S unknown Het
Lcn12 C A 2: 25,492,241 (GRCm38) G151C probably benign Het
Ldb3 G A 14: 34,544,103 (GRCm38) R512W probably damaging Het
Ldlr G A 9: 21,739,830 (GRCm38) A515T probably benign Het
Ldlrad2 G T 4: 137,574,533 (GRCm38) R13S probably benign Het
Lef1 C A 3: 131,193,181 (GRCm38) P257T probably damaging Het
Lefty2 C A 1: 180,894,778 (GRCm38) P227Q possibly damaging Het
Lep T A 6: 29,071,096 (GRCm38) Y140N probably damaging Het
Lep A C 6: 29,071,097 (GRCm38) Y140S probably damaging Het
Lepr G T 4: 101,735,595 (GRCm38) D136Y probably damaging Het
Lgals12 T A 19: 7,598,080 (GRCm38) Q297L probably benign Het
Lgals4 G C 7: 28,841,497 (GRCm38) R282P probably damaging Het
Lgr5 C G 10: 115,456,669 (GRCm38) A511P probably benign Het
Lhcgr C A 17: 88,753,905 (GRCm38) Q239H probably benign Het
Lhcgr C A 17: 88,764,981 (GRCm38) probably null Het
Lhfpl1 T G X: 145,291,165 (GRCm38) D215A probably benign Het
Lhx9 G T 1: 138,831,498 (GRCm38) P355T probably damaging Het
Lilr4b G T 10: 51,481,349 (GRCm38) G94C probably damaging Het
Lilra6 G T 7: 3,912,581 (GRCm38) T385K possibly damaging Het
Limch1 G T 5: 67,028,799 (GRCm38) W647C probably damaging Het
Limd1 G C 9: 123,480,021 (GRCm38) A262P probably damaging Het
Lims1 T A 10: 58,409,656 (GRCm38) I169K probably benign Het
Lin28b C A 10: 45,420,606 (GRCm38) G99C probably damaging Het
Lin9 G C 1: 180,650,802 (GRCm38) W58S probably benign Het
Lingo1 C T 9: 56,620,942 (GRCm38) R127H possibly damaging Het
Lingo2 C A 4: 35,709,656 (GRCm38) R108L probably benign Het
Lingo4 C A 3: 94,402,994 (GRCm38) P413H probably damaging Het
Lipg T A 18: 74,941,340 (GRCm38) probably null Het
Lipi G T 16: 75,550,287 (GRCm38) R415S probably benign Het
Lmcd1 C A 6: 112,310,674 (GRCm38) T107N possibly damaging Het
Lmcd1 G C 6: 112,310,676 (GRCm38) G108R probably benign Het
Lmna G C 3: 88,486,236 (GRCm38) L302V probably benign Het
Lmo3 C A 6: 138,416,496 (GRCm38) C42F probably damaging Het
Lmo3 C A 6: 138,416,500 (GRCm38) A41S probably benign Het
Lmo7 G A 14: 101,898,557 (GRCm38) D689N probably damaging Het
Lmo7 G T 14: 101,896,518 (GRCm38) Q666H possibly damaging Het
Lnpk C T 2: 74,573,562 (GRCm38) M1I probably null Het
Lnx1 G T 5: 74,627,441 (GRCm38) L73I possibly damaging Het
Loxl3 A T 6: 83,048,160 (GRCm38) T290S probably benign Het
Loxl3 G T 6: 83,038,578 (GRCm38) G222* probably null Het
Lpar5 T G 6: 125,082,018 (GRCm38) L234R probably damaging Het
Lpin1 C A 12: 16,579,947 (GRCm38) D75Y Het
Lpp G T 16: 24,661,712 (GRCm38) D77Y probably damaging Het
Lrat G T 3: 82,903,490 (GRCm38) P75T probably damaging Het
Lrba G C 3: 86,540,049 (GRCm38) G2067R probably null Het
Lrfn2 G C 17: 49,070,095 (GRCm38) G68A probably benign Het
Lrfn2 C A 17: 49,096,715 (GRCm38) S622Y probably damaging Het
Lrfn2 CAA CAAA 17: 49,070,012 (GRCm38) probably null Het
Lrfn3 C A 7: 30,360,659 (GRCm38) G47V possibly damaging Het
Lrfn5 G T 12: 61,839,817 (GRCm38) L130F probably damaging Het
Lrmp C A 6: 145,148,074 (GRCm38) Q121K probably benign Het
Lrp10 A T 14: 54,467,561 (GRCm38) Q107L possibly damaging Het
Lrp1b C T 2: 41,188,848 (GRCm38) G1864E Het
Lrp1b C G 2: 40,637,749 (GRCm38) G4367R Het
Lrp2 C A 2: 69,496,468 (GRCm38) R1753I probably damaging Het
Lrp2 G T 2: 69,472,453 (GRCm38) D2977E probably benign Het
Lrp2 C A 2: 69,501,641 (GRCm38) R1590L probably damaging Het
Lrp2 C T 2: 69,451,280 (GRCm38) D3916N probably damaging Het
Lrp2 G C 2: 69,509,289 (GRCm38) L1093V probably benign Het
Lrp3 C A 7: 35,203,012 (GRCm38) E568* probably null Het
Lrp5 C T 19: 3,628,345 (GRCm38) W503* probably null Het
Lrp6 C A 6: 134,462,541 (GRCm38) C1243F probably damaging Het
Lrp8 G C 4: 107,843,332 (GRCm38) G156R probably benign Het
Lrrc18 T A 14: 33,008,888 (GRCm38) L128Q probably damaging Het
Lrrc37a G T 11: 103,503,027 (GRCm38) P524H probably benign Het
Lrrc37a A T 11: 103,500,520 (GRCm38) S1360T probably benign Het
Lrrc37a A T 11: 103,499,967 (GRCm38) L1544Q possibly damaging Het
Lrrc37a G T 11: 103,500,598 (GRCm38) P1334T probably benign Het
Lrrc3c T G 11: 98,599,314 (GRCm38) C166G probably damaging Het
Lrrc45 A C 11: 120,718,665 (GRCm38) E418A possibly damaging Het
Lrrc45 G T 11: 120,718,653 (GRCm38) R414L probably benign Het
Lrrc49 C T 9: 60,598,093 (GRCm38) D632N possibly damaging Het
Lrrc4b G T 7: 44,462,617 (GRCm38) G638* probably null Het
Lrrc4b G T 7: 44,444,980 (GRCm38) G24V unknown Het
Lrrc4b C A 7: 44,461,911 (GRCm38) N402K probably damaging Het
Lrrc4b G T 7: 44,444,979 (GRCm38) G24W unknown Het
Lrrc4c G T 2: 97,630,483 (GRCm38) E485* probably null Het
Lrrc6 T A 15: 66,469,899 (GRCm38) K116M probably damaging Het
Lrrc71 G T 3: 87,742,821 (GRCm38) H291N probably benign Het
Lrrc72 T A 12: 36,247,693 (GRCm38) probably null Het
Lrrc74b C A 16: 17,558,168 (GRCm38) probably null Het
Lrrc74b C T 16: 17,558,172 (GRCm38) A205T probably damaging Het
Lrrc8a G T 2: 30,256,313 (GRCm38) D380Y probably damaging Het
Lrrfip1 G T 1: 91,122,494 (GRCm38) G516C possibly damaging Het
Lrriq4 C G 3: 30,649,996 (GRCm38) Q58E probably benign Het
Lrrn2 T A 1: 132,938,978 (GRCm38) W594R probably benign Het
Lrrn2 G T 1: 132,937,898 (GRCm38) E234* probably null Het
Lrrtm4 C G 6: 80,022,717 (GRCm38) R371G probably benign Het
Lrwd1 T A 5: 136,131,541 (GRCm38) Q313L possibly damaging Het
Lsg1 C A 16: 30,573,289 (GRCm38) Q221H probably damaging Het
Ltbp2 C T 12: 84,829,316 (GRCm38) V506M possibly damaging Het
Ltbp3 A G 19: 5,747,730 (GRCm38) T466A probably damaging Het
Ltf C G 9: 111,024,393 (GRCm38) P237R probably damaging Het
Ltf G T 9: 111,021,005 (GRCm38) V68L probably benign Het
Ltn1 C T 16: 87,402,037 (GRCm38) C1158Y probably benign Het
Luc7l G T 17: 26,281,661 (GRCm38) W337C unknown Het
Luc7l3 GC G 11: 94,321,775 (GRCm38) probably null Het
Ly6g6f C T 17: 35,083,032 (GRCm38) V149M possibly damaging Het
Ly75 C A 2: 60,352,133 (GRCm38) R566L possibly damaging Het
Ly75 C A 2: 60,350,004 (GRCm38) E610* probably null Het
Lypd5 A C 7: 24,352,613 (GRCm38) N118H probably damaging Het
Lypd6 TC T 2: 50,190,807 (GRCm38) probably null Het
Lypd6b C A 2: 49,942,596 (GRCm38) P58T probably damaging Het
Lyst G T 13: 13,680,134 (GRCm38) R2363L possibly damaging Het
Macf1 C A 4: 123,471,475 (GRCm38) E3164D probably benign Het
Mad1l1 C A 5: 140,105,582 (GRCm38) G510V probably benign Het
Mad2l1bp C T 17: 46,147,941 (GRCm38) R221H probably damaging Het
Madd C G 2: 91,142,831 (GRCm38) Q1526H probably damaging Het
Mafb T A 2: 160,366,505 (GRCm38) T58S possibly damaging Het
Magel2 G T 7: 62,379,607 (GRCm38) R753L unknown Het
Magi2 G T 5: 20,702,412 (GRCm38) G1342V probably benign Het
Magix G C X: 7,675,850 (GRCm38) R226G probably benign Het
Malt1 G T 18: 65,448,284 (GRCm38) G261V probably damaging Het
Malt1 G T 18: 65,431,373 (GRCm38) G68C probably damaging Het
Maml2 G T 9: 13,706,590 (GRCm38) G411* probably null Het
Man2a1 G C 17: 64,735,054 (GRCm38) S989T probably benign Het
Man2a1 A C 17: 64,659,020 (GRCm38) K318Q probably damaging Het
Man2b2 C G 5: 36,813,797 (GRCm38) D742H probably damaging Het
Mansc4 G A 6: 147,086,961 (GRCm38) R2W unknown Het
Map10 G T 8: 125,670,070 (GRCm38) K67N probably damaging Het
Map1a G T 2: 121,305,279 (GRCm38) C2192F probably damaging Het
Map1s G T 8: 70,914,517 (GRCm38) D689Y probably damaging Het
Map2 G T 1: 66,438,361 (GRCm38) V1756L probably damaging Het
Map2 G A 1: 66,380,680 (GRCm38) A57T probably benign Het
Map3k1 C A 13: 111,755,946 (GRCm38) G925V probably benign Het
Map3k19 G T 1: 127,822,034 (GRCm38) S1193R probably benign Het
Map3k20 C T 2: 72,298,315 (GRCm38) R32* probably null Het
Map3k4 C A 17: 12,271,697 (GRCm38) Q282H probably damaging Het
Map3k9 C A 12: 81,780,846 (GRCm38) C10F unknown Het
Map3k9 G C 12: 81,722,279 (GRCm38) S998R probably damaging Het
Map4 G C 9: 110,068,523 (GRCm38) probably null Het
Map4k1 G C 7: 29,000,008 (GRCm38) R614P probably damaging Het
Map7d1 C A 4: 126,234,377 (GRCm38) R617L unknown Het
Mapk15 C A 15: 75,998,461 (GRCm38) S441* probably null Het
Mapk7 C A 11: 61,491,362 (GRCm38) Q241H probably damaging Het
Marc1 G T 1: 184,803,937 (GRCm38) P203Q possibly damaging Het
March4 C A 1: 72,428,957 (GRCm38) Q305H probably damaging Het
March8 G T 6: 116,338,272 (GRCm38) probably benign Het
Mast1 C A 8: 84,920,446 (GRCm38) R650L probably benign Het
Mast3 T A 8: 70,789,038 (GRCm38) probably null Het
Maz C A 7: 127,025,896 (GRCm38) A151S unknown Het
Mbd1 G T 18: 74,276,939 (GRCm38) K501N probably null Het
Mbl2 C A 19: 30,233,997 (GRCm38) S6Y probably damaging Het
Mblac2 C G 13: 81,750,167 (GRCm38) R221G probably benign Het
Mboat1 C T 13: 30,226,378 (GRCm38) H273Y probably benign Het
Mbp A T 18: 82,561,845 (GRCm38) H80L probably benign Het
Mbp C A 18: 82,513,010 (GRCm38) P27T unknown Het
Mbtd1 G C 11: 93,912,459 (GRCm38) probably null Het
Mc2r T A 18: 68,407,712 (GRCm38) H170L possibly damaging Het
Mc3r C A 2: 172,249,816 (GRCm38) S319R probably benign Het
Mcam G T 9: 44,134,590 (GRCm38) probably benign Het
Mcc C A 18: 44,491,246 (GRCm38) A411S probably benign Het
Mcf2l G T 8: 13,009,654 (GRCm38) E720* probably null Het
Mcm4 A C 16: 15,632,216 (GRCm38) D317E possibly damaging Het
Mcm4 C A 16: 15,629,454 (GRCm38) D549Y probably damaging Het
Mcm5 G T 8: 75,121,672 (GRCm38) M516I possibly damaging Het
Mcoln2 A T 3: 146,175,704 (GRCm38) Q233L probably damaging Het
Mcpt8 C G 14: 56,082,336 (GRCm38) C219S probably benign Het
Mcu C A 10: 59,456,771 (GRCm38) V29L probably benign Het
Mcub C A 3: 129,916,942 (GRCm38) A227S unknown Het
Mcub C T 3: 129,916,943 (GRCm38) R280Q probably damaging Het
Mdm1 G T 10: 118,158,496 (GRCm38) R470M possibly damaging Het
Mecr A