Mutagenetix > Incidental Mutation

Incidental Mutation 'R0710:Zfp282'

62695

Institutional Source

Beutler Lab

Gene Symbol

Zfp282

Ensembl Gene

ENSMUSG00000025821

Gene Name

zinc finger protein 282

Synonyms

HUB1

MMRRC Submission

038893-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R0710 (G1)

Quality Score

100

Status

Not validated

Chromosome

Chromosomal Location

47877204-47908485 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 47880384 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 184 (R184W)

Ref Sequence

ENSEMBL: ENSMUSP00000053643 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061890]

AlphaFold

E9PVC2

Predicted Effect

probably damaging
Transcript: ENSMUST00000061890
AA Change: R184W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000053643
Gene: ENSMUSG00000025821
AA Change: R184W

Domain	Start	End	E-Value	Type
low complexity region	11	20	N/A	INTRINSIC
low complexity region	66	75	N/A	INTRINSIC
Pfam:DUF3669	98	168	1.8e-12	PFAM
KRAB	198	260	1.04e-21	SMART
internal_repeat_1	317	372	1.1e-13	PROSPERO
low complexity region	387	399	N/A	INTRINSIC
low complexity region	403	420	N/A	INTRINSIC
low complexity region	457	499	N/A	INTRINSIC
ZnF_C2H2	514	536	8.94e-3	SMART
ZnF_C2H2	542	564	4.72e-2	SMART
ZnF_C2H2	570	592	1.04e-3	SMART
ZnF_C2H2	598	620	4.24e-4	SMART
ZnF_C2H2	626	648	1.06e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125957

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Celsr2	A	G	3: 108,412,712	V928A	probably benign	Het
Fam60a	A	G	6: 148,933,000		probably null	Het
Farp1	C	T	14: 121,237,143	T256M	probably damaging	Het
Fbxl3	G	T	14: 103,089,315	H162Q	probably damaging	Het
Glra3	C	T	8: 56,125,364		probably benign	Het
Gpatch8	A	G	11: 102,481,933	S260P	unknown	Het
Hectd4	G	A	5: 121,336,628	V2771I	probably benign	Het
Hgf	C	A	5: 16,566,763	C129*	probably null	Het
Hmg20a	G	A	9: 56,474,670	D77N	possibly damaging	Het
Iqch	A	T	9: 63,525,136	S287T	probably benign	Het
Kcnj11	T	C	7: 46,099,125	Y258C	probably benign	Het
Kif1c	A	G	11: 70,726,497	T874A	probably benign	Het
Mlc1	G	T	15: 88,977,864	Q50K	possibly damaging	Het
Mtor	T	C	4: 148,464,391	S544P	possibly damaging	Het
Mypop	A	T	7: 19,000,560		probably null	Het
Poli	A	T	18: 70,522,890		probably null	Het
Rasa3	C	A	8: 13,583,830	V478L	probably damaging	Het
Scn3a	A	T	2: 65,469,046	M1372K	probably damaging	Het
Sis	T	C	3: 72,952,531	Q297R	probably damaging	Het
Tnpo3	T	C	6: 29,586,075	D172G	possibly damaging	Het
Tulp2	T	A	7: 45,520,808	V301D	possibly damaging	Het
Ubr2	G	A	17: 46,938,681	R1582W	probably damaging	Het
Ubr3	T	C	2: 69,952,837	S706P	probably damaging	Het
Vmn1r171	C	A	7: 23,633,001	S205Y	probably damaging	Het
Wnk4	G	A	11: 101,274,106	A754T	probably benign	Het

Other mutations in Zfp282

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00732:Zfp282	APN	6	47880390	missense	probably damaging	1.00
IGL00755:Zfp282	APN	6	47880390	missense	probably damaging	1.00
IGL01402:Zfp282	APN	6	47897836	missense	probably damaging	0.99
IGL01404:Zfp282	APN	6	47897836	missense	probably damaging	0.99
IGL01484:Zfp282	APN	6	47890120	missense	possibly damaging	0.76
IGL01560:Zfp282	APN	6	47880277	missense	probably damaging	1.00
IGL02949:Zfp282	APN	6	47897914	missense	probably damaging	1.00
FR4304:Zfp282	UTSW	6	47904797	small insertion	probably benign
FR4589:Zfp282	UTSW	6	47904791	small insertion	probably benign
FR4737:Zfp282	UTSW	6	47904790	small insertion	probably benign
FR4737:Zfp282	UTSW	6	47904799	small insertion	probably benign
FR4976:Zfp282	UTSW	6	47904790	small insertion	probably benign
R0020:Zfp282	UTSW	6	47880009	missense	probably damaging	1.00
R0020:Zfp282	UTSW	6	47880009	missense	probably damaging	1.00
R0118:Zfp282	UTSW	6	47892932	missense	probably benign	0.34
R0415:Zfp282	UTSW	6	47897881	missense	probably damaging	0.99
R0415:Zfp282	UTSW	6	47905053	missense	possibly damaging	0.88
R0607:Zfp282	UTSW	6	47880369	missense	probably damaging	1.00
R0946:Zfp282	UTSW	6	47880009	missense	probably damaging	1.00
R1054:Zfp282	UTSW	6	47904599	missense	probably benign	0.00
R1401:Zfp282	UTSW	6	47890174	nonsense	probably null
R1572:Zfp282	UTSW	6	47892867	missense	probably damaging	1.00
R2016:Zfp282	UTSW	6	47897787	splice site	probably null
R2971:Zfp282	UTSW	6	47897932	splice site	probably null
R4064:Zfp282	UTSW	6	47880094	missense	probably damaging	0.99
R4478:Zfp282	UTSW	6	47890696	nonsense	probably null
R4530:Zfp282	UTSW	6	47890633	missense	probably benign	0.00
R4532:Zfp282	UTSW	6	47890633	missense	probably benign	0.00
R5068:Zfp282	UTSW	6	47877703	missense	probably benign	0.01
R5261:Zfp282	UTSW	6	47897890	missense	probably damaging	0.99
R5326:Zfp282	UTSW	6	47905327	missense	probably benign
R5551:Zfp282	UTSW	6	47890645	missense	possibly damaging	0.59
R6046:Zfp282	UTSW	6	47880168	missense	probably damaging	1.00
R6408:Zfp282	UTSW	6	47880385	missense	probably damaging	1.00
R7535:Zfp282	UTSW	6	47904944	missense	probably benign	0.03
R8098:Zfp282	UTSW	6	47890718	missense	probably benign	0.00
R8158:Zfp282	UTSW	6	47890692	missense	possibly damaging	0.61
R8304:Zfp282	UTSW	6	47904788	small deletion	probably benign
R8385:Zfp282	UTSW	6	47905089	missense	possibly damaging	0.88
R8543:Zfp282	UTSW	6	47904627	missense	probably benign	0.40
R8817:Zfp282	UTSW	6	47904826	missense	probably benign	0.00
S24628:Zfp282	UTSW	6	47897881	missense	probably damaging	0.99
S24628:Zfp282	UTSW	6	47905053	missense	possibly damaging	0.88
Z1177:Zfp282	UTSW	6	47890637	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCCATTCAGGCTGTAGAGAGGAAG -3'
(R):5'- GTTGTGCAGACAGACAGACAGACC -3'

Sequencing Primer
(F):5'- CTGCTGAACTTGGAGGGAC -3'
(R):5'- TCAGCTCTGCTGGGATACAAC -3'

Posted On

2013-07-30