Incidental Mutation 'R0710:Fam60a'
ID62696
Institutional Source Beutler Lab
Gene Symbol Fam60a
Ensembl Gene ENSMUSG00000039985
Gene Namefamily with sequence similarity 60, member A
SynonymsPptcs1, Tera
MMRRC Submission 038893-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R0710 (G1)
Quality Score126
Status Not validated
Chromosome6
Chromosomal Location148921035-148946467 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 148933000 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054080] [ENSMUST00000081956] [ENSMUST00000111562] [ENSMUST00000132696] [ENSMUST00000139355] [ENSMUST00000139355] [ENSMUST00000146457] [ENSMUST00000203164] [ENSMUST00000203164] [ENSMUST00000204119] [ENSMUST00000204435] [ENSMUST00000204435] [ENSMUST00000204590]
Predicted Effect probably null
Transcript: ENSMUST00000054080
SMART Domains Protein: ENSMUSP00000050952
Gene: ENSMUSG00000039985

DomainStartEndE-ValueType
Pfam:FAM60A 2 198 5.2e-86 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000081956
SMART Domains Protein: ENSMUSP00000107188
Gene: ENSMUSG00000039985

DomainStartEndE-ValueType
Pfam:FAM60A 2 200 5.5e-92 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111562
SMART Domains Protein: ENSMUSP00000107187
Gene: ENSMUSG00000039985

DomainStartEndE-ValueType
Pfam:FAM60A 2 200 5.5e-92 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132696
SMART Domains Protein: ENSMUSP00000115417
Gene: ENSMUSG00000039985

DomainStartEndE-ValueType
Pfam:FAM60A 2 156 2.8e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139355
SMART Domains Protein: ENSMUSP00000119540
Gene: ENSMUSG00000039985

DomainStartEndE-ValueType
Pfam:FAM60A 2 95 6.3e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139355
SMART Domains Protein: ENSMUSP00000119540
Gene: ENSMUSG00000039985

DomainStartEndE-ValueType
Pfam:FAM60A 2 95 6.3e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143963
Predicted Effect probably null
Transcript: ENSMUST00000146457
SMART Domains Protein: ENSMUSP00000117859
Gene: ENSMUSG00000039985

DomainStartEndE-ValueType
Pfam:FAM60A 2 53 1.2e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203164
SMART Domains Protein: ENSMUSP00000145370
Gene: ENSMUSG00000039985

DomainStartEndE-ValueType
Pfam:FAM60A 2 133 8.1e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203164
SMART Domains Protein: ENSMUSP00000145370
Gene: ENSMUSG00000039985

DomainStartEndE-ValueType
Pfam:FAM60A 2 133 8.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204119
Predicted Effect probably null
Transcript: ENSMUST00000204435
SMART Domains Protein: ENSMUSP00000145487
Gene: ENSMUSG00000039985

DomainStartEndE-ValueType
Pfam:FAM60A 2 198 5.2e-86 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204435
SMART Domains Protein: ENSMUSP00000145487
Gene: ENSMUSG00000039985

DomainStartEndE-ValueType
Pfam:FAM60A 2 198 5.2e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204590
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Celsr2 A G 3: 108,412,712 V928A probably benign Het
Farp1 C T 14: 121,237,143 T256M probably damaging Het
Fbxl3 G T 14: 103,089,315 H162Q probably damaging Het
Glra3 C T 8: 56,125,364 probably benign Het
Gpatch8 A G 11: 102,481,933 S260P unknown Het
Hectd4 G A 5: 121,336,628 V2771I probably benign Het
Hgf C A 5: 16,566,763 C129* probably null Het
Hmg20a G A 9: 56,474,670 D77N possibly damaging Het
Iqch A T 9: 63,525,136 S287T probably benign Het
Kcnj11 T C 7: 46,099,125 Y258C probably benign Het
Kif1c A G 11: 70,726,497 T874A probably benign Het
Mlc1 G T 15: 88,977,864 Q50K possibly damaging Het
Mtor T C 4: 148,464,391 S544P possibly damaging Het
Mypop A T 7: 19,000,560 probably null Het
Poli A T 18: 70,522,890 probably null Het
Rasa3 C A 8: 13,583,830 V478L probably damaging Het
Scn3a A T 2: 65,469,046 M1372K probably damaging Het
Sis T C 3: 72,952,531 Q297R probably damaging Het
Tnpo3 T C 6: 29,586,075 D172G possibly damaging Het
Tulp2 T A 7: 45,520,808 V301D possibly damaging Het
Ubr2 G A 17: 46,938,681 R1582W probably damaging Het
Ubr3 T C 2: 69,952,837 S706P probably damaging Het
Vmn1r171 C A 7: 23,633,001 S205Y probably damaging Het
Wnk4 G A 11: 101,274,106 A754T probably benign Het
Zfp282 C T 6: 47,880,384 R184W probably damaging Het
Other mutations in Fam60a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Fam60a APN 6 148928507 critical splice donor site probably null
R0637:Fam60a UTSW 6 148930665 intron probably benign
R3788:Fam60a UTSW 6 148926119 missense possibly damaging 0.86
R3789:Fam60a UTSW 6 148926119 missense possibly damaging 0.86
R4896:Fam60a UTSW 6 148933000 critical splice donor site probably null
R5574:Fam60a UTSW 6 148944880 unclassified probably benign
R7438:Fam60a UTSW 6 148933102 missense probably benign 0.15
R7922:Fam60a UTSW 6 148926146 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGTCCAGCTAAAACCATAAAGAGGCAG -3'
(R):5'- GGAGCCCAGAACGGCTTATATATGC -3'

Sequencing Primer
(F):5'- GCAGAGTAAGCAGTCAGTACTAAC -3'
(R):5'- ataaaattCCCTGTGCTATGGAGTAG -3'
Posted On2013-07-30