Incidental Mutation 'R0710:Tulp2'
ID62699
Institutional Source Beutler Lab
Gene Symbol Tulp2
Ensembl Gene ENSMUSG00000023467
Gene Nametubby-like protein 2
Synonyms
MMRRC Submission 038893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0710 (G1)
Quality Score195
Status Not validated
Chromosome7
Chromosomal Location45481877-45523632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45520808 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 301 (V301D)
Ref Sequence ENSEMBL: ENSMUSP00000103388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024233] [ENSMUST00000042105] [ENSMUST00000085331] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000107762] [ENSMUST00000167273] [ENSMUST00000209763] [ENSMUST00000210299] [ENSMUST00000210532] [ENSMUST00000210813] [ENSMUST00000210868] [ENSMUST00000211212]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024233
AA Change: V413D

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024233
Gene: ENSMUSG00000023467
AA Change: V413D

DomainStartEndE-ValueType
low complexity region 67 77 N/A INTRINSIC
low complexity region 212 220 N/A INTRINSIC
Pfam:Tub 315 556 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042105
SMART Domains Protein: ENSMUSP00000049488
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 536 612 8.2e-15 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085331
AA Change: V289D

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082438
Gene: ENSMUSG00000023467
AA Change: V289D

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Pfam:Tub 191 432 6.2e-117 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107758
AA Change: V308D

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467
AA Change: V308D

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107759
AA Change: V301D

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467
AA Change: V301D

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107762
AA Change: V413D

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103391
Gene: ENSMUSG00000023467
AA Change: V413D

DomainStartEndE-ValueType
Pfam:Tub_N 39 295 8.8e-36 PFAM
Pfam:Tub 315 556 1.3e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167273
SMART Domains Protein: ENSMUSP00000128497
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 531 612 1.1e-20 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209763
Predicted Effect probably benign
Transcript: ENSMUST00000210299
Predicted Effect probably benign
Transcript: ENSMUST00000210532
Predicted Effect possibly damaging
Transcript: ENSMUST00000210813
AA Change: V308D

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210868
AA Change: V301D

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000211212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211413
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TULP2 is a member of a family of tubby-like genes (TULPs) that encode proteins of unknown function. Members of this family have been identified in plants, vertebrates, and invertebrates. The TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Celsr2 A G 3: 108,412,712 V928A probably benign Het
Fam60a A G 6: 148,933,000 probably null Het
Farp1 C T 14: 121,237,143 T256M probably damaging Het
Fbxl3 G T 14: 103,089,315 H162Q probably damaging Het
Glra3 C T 8: 56,125,364 probably benign Het
Gpatch8 A G 11: 102,481,933 S260P unknown Het
Hectd4 G A 5: 121,336,628 V2771I probably benign Het
Hgf C A 5: 16,566,763 C129* probably null Het
Hmg20a G A 9: 56,474,670 D77N possibly damaging Het
Iqch A T 9: 63,525,136 S287T probably benign Het
Kcnj11 T C 7: 46,099,125 Y258C probably benign Het
Kif1c A G 11: 70,726,497 T874A probably benign Het
Mlc1 G T 15: 88,977,864 Q50K possibly damaging Het
Mtor T C 4: 148,464,391 S544P possibly damaging Het
Mypop A T 7: 19,000,560 probably null Het
Poli A T 18: 70,522,890 probably null Het
Rasa3 C A 8: 13,583,830 V478L probably damaging Het
Scn3a A T 2: 65,469,046 M1372K probably damaging Het
Sis T C 3: 72,952,531 Q297R probably damaging Het
Tnpo3 T C 6: 29,586,075 D172G possibly damaging Het
Ubr2 G A 17: 46,938,681 R1582W probably damaging Het
Ubr3 T C 2: 69,952,837 S706P probably damaging Het
Vmn1r171 C A 7: 23,633,001 S205Y probably damaging Het
Wnk4 G A 11: 101,274,106 A754T probably benign Het
Zfp282 C T 6: 47,880,384 R184W probably damaging Het
Other mutations in Tulp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tulp2 APN 7 45521908 missense probably damaging 1.00
IGL00942:Tulp2 APN 7 45516268 missense possibly damaging 0.87
IGL01881:Tulp2 APN 7 45520795 missense probably damaging 1.00
IGL03240:Tulp2 APN 7 45522310 missense probably damaging 1.00
IGL03242:Tulp2 APN 7 45521858 missense probably damaging 0.99
IGL03353:Tulp2 APN 7 45516272 missense probably damaging 1.00
R0063:Tulp2 UTSW 7 45520860 unclassified probably benign
R0063:Tulp2 UTSW 7 45520860 unclassified probably benign
R0306:Tulp2 UTSW 7 45518576 unclassified probably benign
R0648:Tulp2 UTSW 7 45519786 missense probably damaging 1.00
R1168:Tulp2 UTSW 7 45517842 missense probably benign
R1345:Tulp2 UTSW 7 45518721 missense probably benign 0.13
R1737:Tulp2 UTSW 7 45519777 missense probably damaging 1.00
R1854:Tulp2 UTSW 7 45517943 missense probably damaging 0.98
R1918:Tulp2 UTSW 7 45517941 missense possibly damaging 0.95
R2356:Tulp2 UTSW 7 45518628 missense possibly damaging 0.85
R3012:Tulp2 UTSW 7 45518763 missense probably damaging 1.00
R3419:Tulp2 UTSW 7 45518752 missense possibly damaging 0.56
R4236:Tulp2 UTSW 7 45521874 missense probably damaging 1.00
R4701:Tulp2 UTSW 7 45517924 missense probably damaging 0.98
R5367:Tulp2 UTSW 7 45516651 missense possibly damaging 0.95
R6056:Tulp2 UTSW 7 45490373 splice site probably null
R6294:Tulp2 UTSW 7 45514692 missense probably damaging 1.00
R6432:Tulp2 UTSW 7 45518588 missense probably benign 0.01
R6875:Tulp2 UTSW 7 45518614 missense probably benign 0.05
R7459:Tulp2 UTSW 7 45519803 missense probably damaging 1.00
R7556:Tulp2 UTSW 7 45518581 splice site probably null
R7676:Tulp2 UTSW 7 45521027 missense possibly damaging 0.86
R7883:Tulp2 UTSW 7 45516764 splice site probably null
R8775:Tulp2 UTSW 7 45515490 missense probably benign
R8775-TAIL:Tulp2 UTSW 7 45515490 missense probably benign
R8804:Tulp2 UTSW 7 45520974 missense probably damaging 1.00
Z1088:Tulp2 UTSW 7 45521986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACGTGGGCTAGGATAACTCACC -3'
(R):5'- CCCTGAATCCCAAGACATTGGTCTC -3'

Sequencing Primer
(F):5'- agccatctcaccagccc -3'
(R):5'- ACATTGGTCTCCTGGCAAGATAG -3'
Posted On2013-07-30