Incidental Mutation 'R0710:Hmg20a'
ID62702
Institutional Source Beutler Lab
Gene Symbol Hmg20a
Ensembl Gene ENSMUSG00000032329
Gene Namehigh mobility group 20A
SynonymsHmgxb1, 5730490E10Rik, 1200004E06Rik
MMRRC Submission 038893-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0710 (G1)
Quality Score102
Status Not validated
Chromosome9
Chromosomal Location56418609-56496936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56474670 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 77 (D77N)
Ref Sequence ENSEMBL: ENSMUSP00000149375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034879] [ENSMUST00000213242] [ENSMUST00000214771] [ENSMUST00000214869] [ENSMUST00000215269] [ENSMUST00000217518]
Predicted Effect probably benign
Transcript: ENSMUST00000034879
AA Change: D77N

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034879
Gene: ENSMUSG00000032329
AA Change: D77N

DomainStartEndE-ValueType
low complexity region 80 94 N/A INTRINSIC
HMG 101 171 1.86e-21 SMART
coiled coil region 228 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213242
Predicted Effect possibly damaging
Transcript: ENSMUST00000214771
AA Change: D77N

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000214869
AA Change: D77N

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000215269
AA Change: D77N

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217518
AA Change: D77N

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Celsr2 A G 3: 108,412,712 V928A probably benign Het
Fam60a A G 6: 148,933,000 probably null Het
Farp1 C T 14: 121,237,143 T256M probably damaging Het
Fbxl3 G T 14: 103,089,315 H162Q probably damaging Het
Glra3 C T 8: 56,125,364 probably benign Het
Gpatch8 A G 11: 102,481,933 S260P unknown Het
Hectd4 G A 5: 121,336,628 V2771I probably benign Het
Hgf C A 5: 16,566,763 C129* probably null Het
Iqch A T 9: 63,525,136 S287T probably benign Het
Kcnj11 T C 7: 46,099,125 Y258C probably benign Het
Kif1c A G 11: 70,726,497 T874A probably benign Het
Mlc1 G T 15: 88,977,864 Q50K possibly damaging Het
Mtor T C 4: 148,464,391 S544P possibly damaging Het
Mypop A T 7: 19,000,560 probably null Het
Poli A T 18: 70,522,890 probably null Het
Rasa3 C A 8: 13,583,830 V478L probably damaging Het
Scn3a A T 2: 65,469,046 M1372K probably damaging Het
Sis T C 3: 72,952,531 Q297R probably damaging Het
Tnpo3 T C 6: 29,586,075 D172G possibly damaging Het
Tulp2 T A 7: 45,520,808 V301D possibly damaging Het
Ubr2 G A 17: 46,938,681 R1582W probably damaging Het
Ubr3 T C 2: 69,952,837 S706P probably damaging Het
Vmn1r171 C A 7: 23,633,001 S205Y probably damaging Het
Wnk4 G A 11: 101,274,106 A754T probably benign Het
Zfp282 C T 6: 47,880,384 R184W probably damaging Het
Other mutations in Hmg20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Hmg20a APN 9 56487650 missense probably damaging 1.00
IGL01981:Hmg20a APN 9 56477230 missense probably damaging 1.00
IGL02085:Hmg20a APN 9 56477302 nonsense probably null
IGL03284:Hmg20a APN 9 56481617 missense probably benign 0.25
ANU22:Hmg20a UTSW 9 56487650 missense probably damaging 1.00
P0033:Hmg20a UTSW 9 56489824 missense probably benign 0.01
R0369:Hmg20a UTSW 9 56487650 missense probably damaging 1.00
R1405:Hmg20a UTSW 9 56477303 missense possibly damaging 0.66
R1405:Hmg20a UTSW 9 56477303 missense possibly damaging 0.66
R1546:Hmg20a UTSW 9 56467401 missense possibly damaging 0.56
R2188:Hmg20a UTSW 9 56477300 missense possibly damaging 0.93
R4730:Hmg20a UTSW 9 56467419 missense possibly damaging 0.85
R4956:Hmg20a UTSW 9 56481664 missense probably damaging 1.00
R6115:Hmg20a UTSW 9 56489832 missense possibly damaging 0.95
R6130:Hmg20a UTSW 9 56488607 splice site probably null
R6152:Hmg20a UTSW 9 56481608 missense probably damaging 1.00
R6961:Hmg20a UTSW 9 56488728 missense probably benign 0.29
R7499:Hmg20a UTSW 9 56488943 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGCCTGTTGCTCAGGTTAACAC -3'
(R):5'- CGAGCCCTGCTGAACATTATAGGAG -3'

Sequencing Primer
(F):5'- GTTAACACACCCCGAGGGTC -3'
(R):5'- TAGCTACATTTAGTCAGACCAAGGG -3'
Posted On2013-07-30