Incidental Mutation 'R0711:Rab3gap2'
ID62717
Institutional Source Beutler Lab
Gene Symbol Rab3gap2
Ensembl Gene ENSMUSG00000039318
Gene NameRAB3 GTPase activating protein subunit 2
Synonyms1110059F07Rik
MMRRC Submission 038894-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0711 (G1)
Quality Score163
Status Validated
Chromosome1
Chromosomal Location185204117-185286759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 185249926 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 392 (S392T)
Ref Sequence ENSEMBL: ENSMUSP00000141608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069652] [ENSMUST00000194740]
Predicted Effect probably damaging
Transcript: ENSMUST00000069652
AA Change: S392T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066325
Gene: ENSMUSG00000039318
AA Change: S392T

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-167 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 767 1366 3.2e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193245
Predicted Effect probably damaging
Transcript: ENSMUST00000194740
AA Change: S392T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141608
Gene: ENSMUSG00000039318
AA Change: S392T

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-157 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 766 1346 2.5e-233 PFAM
Meta Mutation Damage Score 0.3103 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RAB3 protein family, members of which are involved in regulated exocytosis of neurotransmitters and hormones. This protein forms the Rab3 GTPase-activating complex with RAB3GAP1, where it constitutes the regulatory subunit, whereas the latter functions as the catalytic subunit. This gene has the highest level of expression in the brain, consistent with it having a key role in neurodevelopment. Mutations in this gene are associated with Martsolf syndrome.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,068,225 D1058E probably damaging Het
4933405L10Rik A T 8: 105,708,931 probably null Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Afdn C T 17: 13,852,436 P874S probably damaging Het
Ankrd6 G A 4: 32,815,326 A391V probably damaging Het
Arhgef28 T G 13: 97,931,254 T1388P probably damaging Het
Asxl3 G T 18: 22,524,451 M1839I probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Celf2 A G 2: 6,721,415 probably null Het
Chid1 C T 7: 141,496,677 V325I probably benign Het
Cnn3 T A 3: 121,449,984 D31E probably benign Het
Col12a1 G A 9: 79,652,035 P1857L probably damaging Het
Cpeb1 T A 7: 81,351,870 R430W probably benign Het
Daw1 T C 1: 83,191,338 probably benign Het
Dcaf13 A G 15: 39,138,089 Y264C probably damaging Het
Dnah6 T C 6: 73,087,602 I2666V probably damaging Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dock10 A T 1: 80,523,975 F1833I probably damaging Het
Efhd2 C T 4: 141,859,872 A200T probably damaging Het
Epb41l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y164H possibly damaging Het
Gkn2 T C 6: 87,373,419 probably benign Het
Golgb1 A T 16: 36,918,790 Q2497L probably damaging Het
Gzme A T 14: 56,117,739 M245K probably damaging Het
Iars2 A T 1: 185,322,388 probably benign Het
Icosl T A 10: 78,073,941 V240D probably damaging Het
Igsf3 T C 3: 101,427,393 M262T probably benign Het
Ing3 G T 6: 21,971,237 E336* probably null Het
Kat2a A T 11: 100,706,471 V625E probably damaging Het
Ksr1 A G 11: 79,038,247 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Mdfi A T 17: 47,832,930 probably benign Het
Med13 A G 11: 86,301,353 probably benign Het
Msh6 C T 17: 87,986,684 R956C probably damaging Het
Myo15b A G 11: 115,883,838 E670G probably damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Olfr1193 A G 2: 88,678,674 D266G probably damaging Het
Olfr632 G A 7: 103,937,817 A146T probably benign Het
Olfr834 T A 9: 18,988,151 N54K probably benign Het
Pde8b C G 13: 95,107,817 S143T possibly damaging Het
Pias4 G T 10: 81,157,530 probably benign Het
Prkca A G 11: 107,981,654 Y427H probably benign Het
Psg25 G A 7: 18,529,560 Q113* probably null Het
Scrib A G 15: 76,066,907 probably benign Het
Sdk2 A G 11: 113,903,144 probably benign Het
Serpinb1c T A 13: 32,886,283 probably benign Het
Serpinb9f T A 13: 33,327,921 W136R probably damaging Het
Skint10 C A 4: 112,715,905 probably benign Het
Slc25a13 T C 6: 6,117,128 T196A probably damaging Het
Slc26a5 T C 5: 21,847,232 H33R probably damaging Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Slitrk6 A T 14: 110,749,819 Y819N probably damaging Het
Spata46 C T 1: 170,312,034 Q201* probably null Het
Sptbn1 A T 11: 30,114,739 V1920E probably damaging Het
Taf6l A G 19: 8,778,517 F256L probably benign Het
Tmco3 T A 8: 13,292,039 N104K probably damaging Het
Tmem200c A G 17: 68,842,254 T611A probably damaging Het
Tmem202 T G 9: 59,525,372 Y24S probably damaging Het
Tpp1 A G 7: 105,749,419 L230P probably damaging Het
Trim56 C T 5: 137,112,992 E557K probably benign Het
Trrap C T 5: 144,853,499 L3590F probably damaging Het
Ttc37 C T 13: 76,182,891 P1480L probably damaging Het
Tulp4 A G 17: 6,139,112 T70A possibly damaging Het
Vcp G C 4: 42,986,201 A297G probably benign Het
Vwf T A 6: 125,626,271 H861Q probably benign Het
Wdr64 T C 1: 175,772,185 I536T probably benign Het
Zfp72 G A 13: 74,376,425 probably benign Het
Zfp850 T C 7: 27,990,273 N170S probably benign Het
Other mutations in Rab3gap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Rab3gap2 APN 1 185238870 missense probably damaging 1.00
IGL01620:Rab3gap2 APN 1 185204326 missense probably benign
IGL01977:Rab3gap2 APN 1 185267023 nonsense probably null
IGL02183:Rab3gap2 APN 1 185271468 nonsense probably null
IGL02229:Rab3gap2 APN 1 185259383 missense possibly damaging 0.71
IGL02231:Rab3gap2 APN 1 185266898 splice site probably benign
IGL02506:Rab3gap2 APN 1 185252024 splice site probably benign
IGL02618:Rab3gap2 APN 1 185251741 missense possibly damaging 0.79
IGL02643:Rab3gap2 APN 1 185267000 missense possibly damaging 0.69
IGL03239:Rab3gap2 APN 1 185249894 missense probably damaging 1.00
PIT4498001:Rab3gap2 UTSW 1 185281685 missense probably damaging 1.00
R0173:Rab3gap2 UTSW 1 185249907 missense possibly damaging 0.51
R0372:Rab3gap2 UTSW 1 185262694 missense possibly damaging 0.93
R0492:Rab3gap2 UTSW 1 185252392 splice site probably benign
R0510:Rab3gap2 UTSW 1 185260508 splice site probably benign
R0708:Rab3gap2 UTSW 1 185249926 missense probably damaging 0.99
R1135:Rab3gap2 UTSW 1 185275943 missense possibly damaging 0.95
R1428:Rab3gap2 UTSW 1 185247904 missense probably damaging 1.00
R1599:Rab3gap2 UTSW 1 185251026 missense probably benign 0.07
R1758:Rab3gap2 UTSW 1 185283884 missense probably benign 0.13
R1903:Rab3gap2 UTSW 1 185221902 missense probably benign
R1929:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R1994:Rab3gap2 UTSW 1 185236024 missense probably damaging 1.00
R2010:Rab3gap2 UTSW 1 185278281 missense possibly damaging 0.57
R2102:Rab3gap2 UTSW 1 185282389 missense probably benign 0.00
R2120:Rab3gap2 UTSW 1 185261367 missense possibly damaging 0.95
R2219:Rab3gap2 UTSW 1 185275916 missense probably damaging 0.99
R2259:Rab3gap2 UTSW 1 185221859 missense probably damaging 1.00
R2270:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R2272:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R3083:Rab3gap2 UTSW 1 185204269 missense probably benign 0.00
R3776:Rab3gap2 UTSW 1 185277205 missense probably damaging 1.00
R4050:Rab3gap2 UTSW 1 185272643 critical splice donor site probably null
R4130:Rab3gap2 UTSW 1 185204297 missense possibly damaging 0.51
R4176:Rab3gap2 UTSW 1 185246666 missense probably damaging 0.99
R4296:Rab3gap2 UTSW 1 185255837 critical splice donor site probably null
R4416:Rab3gap2 UTSW 1 185282347 missense probably benign 0.00
R4426:Rab3gap2 UTSW 1 185235342 missense probably damaging 1.00
R4516:Rab3gap2 UTSW 1 185267068 missense probably benign
R4518:Rab3gap2 UTSW 1 185267068 missense probably benign
R4891:Rab3gap2 UTSW 1 185259366 missense probably benign 0.00
R4913:Rab3gap2 UTSW 1 185262829 missense probably benign 0.12
R4955:Rab3gap2 UTSW 1 185267155 intron probably benign
R5411:Rab3gap2 UTSW 1 185277145 critical splice acceptor site probably null
R5516:Rab3gap2 UTSW 1 185235487 missense probably benign 0.02
R5670:Rab3gap2 UTSW 1 185221899 missense probably benign
R5670:Rab3gap2 UTSW 1 185277205 missense probably damaging 1.00
R6380:Rab3gap2 UTSW 1 185235984 missense probably damaging 1.00
R6533:Rab3gap2 UTSW 1 185232954 splice site probably null
R6655:Rab3gap2 UTSW 1 185250011 missense probably damaging 1.00
R6676:Rab3gap2 UTSW 1 185283410 missense probably damaging 1.00
R6726:Rab3gap2 UTSW 1 185247865 missense probably damaging 0.99
R6969:Rab3gap2 UTSW 1 185236012 missense probably damaging 1.00
R7151:Rab3gap2 UTSW 1 185248053 missense probably benign 0.00
R7168:Rab3gap2 UTSW 1 185204297 missense possibly damaging 0.51
R7196:Rab3gap2 UTSW 1 185281667 missense probably damaging 1.00
R7201:Rab3gap2 UTSW 1 185267191 missense probably damaging 1.00
R7371:Rab3gap2 UTSW 1 185251068 missense probably damaging 1.00
R7573:Rab3gap2 UTSW 1 185282382 missense probably benign
R7779:Rab3gap2 UTSW 1 185259444 missense probably damaging 0.98
R7913:Rab3gap2 UTSW 1 185262816 missense possibly damaging 0.88
R7994:Rab3gap2 UTSW 1 185262816 missense possibly damaging 0.88
Z1088:Rab3gap2 UTSW 1 185281677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTCCAGACATGAGAGTGAACCC -3'
(R):5'- TGTGACCAACCAGACGCTGAAG -3'

Sequencing Primer
(F):5'- ATGGTGTCTCCTGACACAAG -3'
(R):5'- GCTGAAGGATAAAGTTGCTCACTAC -3'
Posted On2013-07-30