Mutagenetix > Incidental Mutations

Incidental Mutation 'R0711:Rab3gap2'

62717

Institutional Source

Beutler Lab

Gene Symbol

Rab3gap2

Ensembl Gene

ENSMUSG00000039318

Gene Name

RAB3 GTPase activating protein subunit 2

Synonyms

1110059F07Rik

MMRRC Submission

038894-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0711 (G1)

Quality Score

163

Status

Validated

Chromosome

Chromosomal Location

185204117-185286759 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 185249926 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 392 (S392T)

Ref Sequence

ENSEMBL: ENSMUSP00000141608 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069652] [ENSMUST00000194740]

Predicted Effect

probably damaging
Transcript: ENSMUST00000069652
AA Change: S392T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000066325
Gene: ENSMUSG00000039318
AA Change: S392T

Domain	Start	End	E-Value	Type
low complexity region	52	62	N/A	INTRINSIC
Pfam:RAB3GAP2_N	73	497	1.3e-167	PFAM
low complexity region	667	686	N/A	INTRINSIC
Pfam:RAB3GAP2_C	767	1366	3.2e-245	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193245

Predicted Effect

probably damaging
Transcript: ENSMUST00000194740
AA Change: S392T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000141608
Gene: ENSMUSG00000039318
AA Change: S392T

Domain	Start	End	E-Value	Type
low complexity region	52	62	N/A	INTRINSIC
Pfam:RAB3GAP2_N	73	497	1.3e-157	PFAM
low complexity region	667	686	N/A	INTRINSIC
Pfam:RAB3GAP2_C	766	1346	2.5e-233	PFAM

Meta Mutation Damage Score

0.3103

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 91.4%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RAB3 protein family, members of which are involved in regulated exocytosis of neurotransmitters and hormones. This protein forms the Rab3 GTPase-activating complex with RAB3GAP1, where it constitutes the regulatory subunit, whereas the latter functions as the catalytic subunit. This gene has the highest level of expression in the brain, consistent with it having a key role in neurodevelopment. Mutations in this gene are associated with Martsolf syndrome.[provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,068,225	D1058E	probably damaging	Het
4933405L10Rik	A	T	8: 105,708,931		probably null	Het
Adamtsl3	T	A	7: 82,465,699		probably benign	Het
Afdn	C	T	17: 13,852,436	P874S	probably damaging	Het
Ankrd6	G	A	4: 32,815,326	A391V	probably damaging	Het
Arhgef28	T	G	13: 97,931,254	T1388P	probably damaging	Het
Asxl3	G	T	18: 22,524,451	M1839I	probably benign	Het
BC005537	T	C	13: 24,805,940	F129L	probably damaging	Het
Celf2	A	G	2: 6,721,415		probably null	Het
Chid1	C	T	7: 141,496,677	V325I	probably benign	Het
Cnn3	T	A	3: 121,449,984	D31E	probably benign	Het
Col12a1	G	A	9: 79,652,035	P1857L	probably damaging	Het
Cpeb1	T	A	7: 81,351,870	R430W	probably benign	Het
Daw1	T	C	1: 83,191,338		probably benign	Het
Dcaf13	A	G	15: 39,138,089	Y264C	probably damaging	Het
Dnah6	T	C	6: 73,087,602	I2666V	probably damaging	Het
Dnaic2	A	C	11: 114,754,332	D531A	probably benign	Het
Dock10	A	T	1: 80,523,975	F1833I	probably damaging	Het
Efhd2	C	T	4: 141,859,872	A200T	probably damaging	Het
Epb41l5	T	A	1: 119,623,911		probably benign	Het
Ermp1	A	G	19: 29,631,388	Y164H	possibly damaging	Het
Gkn2	T	C	6: 87,373,419		probably benign	Het
Golgb1	A	T	16: 36,918,790	Q2497L	probably damaging	Het
Gzme	A	T	14: 56,117,739	M245K	probably damaging	Het
Iars2	A	T	1: 185,322,388		probably benign	Het
Icosl	T	A	10: 78,073,941	V240D	probably damaging	Het
Igsf3	T	C	3: 101,427,393	M262T	probably benign	Het
Ing3	G	T	6: 21,971,237	E336*	probably null	Het
Kat2a	A	T	11: 100,706,471	V625E	probably damaging	Het
Ksr1	A	G	11: 79,038,247		probably benign	Het
Lypd8	A	T	11: 58,386,757	M122L	probably benign	Het
Mdfi	A	T	17: 47,832,930		probably benign	Het
Med13	A	G	11: 86,301,353		probably benign	Het
Msh6	C	T	17: 87,986,684	R956C	probably damaging	Het
Myo15b	A	G	11: 115,883,838	E670G	probably damaging	Het
Myo1d	A	G	11: 80,484,332	L972P	probably damaging	Het
Olfr1193	A	G	2: 88,678,674	D266G	probably damaging	Het
Olfr632	G	A	7: 103,937,817	A146T	probably benign	Het
Olfr834	T	A	9: 18,988,151	N54K	probably benign	Het
Pde8b	C	G	13: 95,107,817	S143T	possibly damaging	Het
Pias4	G	T	10: 81,157,530		probably benign	Het
Prkca	A	G	11: 107,981,654	Y427H	probably benign	Het
Psg25	G	A	7: 18,529,560	Q113*	probably null	Het
Scrib	A	G	15: 76,066,907		probably benign	Het
Sdk2	A	G	11: 113,903,144		probably benign	Het
Serpinb1c	T	A	13: 32,886,283		probably benign	Het
Serpinb9f	T	A	13: 33,327,921	W136R	probably damaging	Het
Skint10	C	A	4: 112,715,905		probably benign	Het
Slc25a13	T	C	6: 6,117,128	T196A	probably damaging	Het
Slc26a5	T	C	5: 21,847,232	H33R	probably damaging	Het
Slc27a6	T	C	18: 58,598,757		probably benign	Het
Slitrk6	A	T	14: 110,749,819	Y819N	probably damaging	Het
Spata46	C	T	1: 170,312,034	Q201*	probably null	Het
Sptbn1	A	T	11: 30,114,739	V1920E	probably damaging	Het
Taf6l	A	G	19: 8,778,517	F256L	probably benign	Het
Tmco3	T	A	8: 13,292,039	N104K	probably damaging	Het
Tmem200c	A	G	17: 68,842,254	T611A	probably damaging	Het
Tmem202	T	G	9: 59,525,372	Y24S	probably damaging	Het
Tpp1	A	G	7: 105,749,419	L230P	probably damaging	Het
Trim56	C	T	5: 137,112,992	E557K	probably benign	Het
Trrap	C	T	5: 144,853,499	L3590F	probably damaging	Het
Ttc37	C	T	13: 76,182,891	P1480L	probably damaging	Het
Tulp4	A	G	17: 6,139,112	T70A	possibly damaging	Het
Vcp	G	C	4: 42,986,201	A297G	probably benign	Het
Vwf	T	A	6: 125,626,271	H861Q	probably benign	Het
Wdr64	T	C	1: 175,772,185	I536T	probably benign	Het
Zfp72	G	A	13: 74,376,425		probably benign	Het
Zfp850	T	C	7: 27,990,273	N170S	probably benign	Het

Other mutations in Rab3gap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01359:Rab3gap2	APN	1	185238870	missense	probably damaging	1.00
IGL01620:Rab3gap2	APN	1	185204326	missense	probably benign
IGL01977:Rab3gap2	APN	1	185267023	nonsense	probably null
IGL02183:Rab3gap2	APN	1	185271468	nonsense	probably null
IGL02229:Rab3gap2	APN	1	185259383	missense	possibly damaging	0.71
IGL02231:Rab3gap2	APN	1	185266898	splice site	probably benign
IGL02506:Rab3gap2	APN	1	185252024	splice site	probably benign
IGL02618:Rab3gap2	APN	1	185251741	missense	possibly damaging	0.79
IGL02643:Rab3gap2	APN	1	185267000	missense	possibly damaging	0.69
IGL03239:Rab3gap2	APN	1	185249894	missense	probably damaging	1.00
PIT4498001:Rab3gap2	UTSW	1	185281685	missense	probably damaging	1.00
R0173:Rab3gap2	UTSW	1	185249907	missense	possibly damaging	0.51
R0372:Rab3gap2	UTSW	1	185262694	missense	possibly damaging	0.93
R0492:Rab3gap2	UTSW	1	185252392	splice site	probably benign
R0510:Rab3gap2	UTSW	1	185260508	splice site	probably benign
R0708:Rab3gap2	UTSW	1	185249926	missense	probably damaging	0.99
R1135:Rab3gap2	UTSW	1	185275943	missense	possibly damaging	0.95
R1428:Rab3gap2	UTSW	1	185247904	missense	probably damaging	1.00
R1599:Rab3gap2	UTSW	1	185251026	missense	probably benign	0.07
R1758:Rab3gap2	UTSW	1	185283884	missense	probably benign	0.13
R1903:Rab3gap2	UTSW	1	185221902	missense	probably benign
R1929:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R1994:Rab3gap2	UTSW	1	185236024	missense	probably damaging	1.00
R2010:Rab3gap2	UTSW	1	185278281	missense	possibly damaging	0.57
R2102:Rab3gap2	UTSW	1	185282389	missense	probably benign	0.00
R2120:Rab3gap2	UTSW	1	185261367	missense	possibly damaging	0.95
R2219:Rab3gap2	UTSW	1	185275916	missense	probably damaging	0.99
R2259:Rab3gap2	UTSW	1	185221859	missense	probably damaging	1.00
R2270:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R2272:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R3083:Rab3gap2	UTSW	1	185204269	missense	probably benign	0.00
R3776:Rab3gap2	UTSW	1	185277205	missense	probably damaging	1.00
R4050:Rab3gap2	UTSW	1	185272643	critical splice donor site	probably null
R4130:Rab3gap2	UTSW	1	185204297	missense	possibly damaging	0.51
R4176:Rab3gap2	UTSW	1	185246666	missense	probably damaging	0.99
R4296:Rab3gap2	UTSW	1	185255837	critical splice donor site	probably null
R4416:Rab3gap2	UTSW	1	185282347	missense	probably benign	0.00
R4426:Rab3gap2	UTSW	1	185235342	missense	probably damaging	1.00
R4516:Rab3gap2	UTSW	1	185267068	missense	probably benign
R4518:Rab3gap2	UTSW	1	185267068	missense	probably benign
R4891:Rab3gap2	UTSW	1	185259366	missense	probably benign	0.00
R4913:Rab3gap2	UTSW	1	185262829	missense	probably benign	0.12
R4955:Rab3gap2	UTSW	1	185267155	intron	probably benign
R5411:Rab3gap2	UTSW	1	185277145	critical splice acceptor site	probably null
R5516:Rab3gap2	UTSW	1	185235487	missense	probably benign	0.02
R5670:Rab3gap2	UTSW	1	185221899	missense	probably benign
R5670:Rab3gap2	UTSW	1	185277205	missense	probably damaging	1.00
R6380:Rab3gap2	UTSW	1	185235984	missense	probably damaging	1.00
R6533:Rab3gap2	UTSW	1	185232954	splice site	probably null
R6655:Rab3gap2	UTSW	1	185250011	missense	probably damaging	1.00
R6676:Rab3gap2	UTSW	1	185283410	missense	probably damaging	1.00
R6726:Rab3gap2	UTSW	1	185247865	missense	probably damaging	0.99
R6969:Rab3gap2	UTSW	1	185236012	missense	probably damaging	1.00
R7151:Rab3gap2	UTSW	1	185248053	missense	probably benign	0.00
R7168:Rab3gap2	UTSW	1	185204297	missense	possibly damaging	0.51
R7196:Rab3gap2	UTSW	1	185281667	missense	probably damaging	1.00
R7201:Rab3gap2	UTSW	1	185267191	missense	probably damaging	1.00
R7371:Rab3gap2	UTSW	1	185251068	missense	probably damaging	1.00
R7573:Rab3gap2	UTSW	1	185282382	missense	probably benign
R7779:Rab3gap2	UTSW	1	185259444	missense	probably damaging	0.98
R7913:Rab3gap2	UTSW	1	185262816	missense	possibly damaging	0.88
R7994:Rab3gap2	UTSW	1	185262816	missense	possibly damaging	0.88
Z1088:Rab3gap2	UTSW	1	185281677	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATTCCAGACATGAGAGTGAACCC -3'
(R):5'- TGTGACCAACCAGACGCTGAAG -3'

Sequencing Primer
(F):5'- ATGGTGTCTCCTGACACAAG -3'
(R):5'- GCTGAAGGATAAAGTTGCTCACTAC -3'

Posted On

2013-07-30