Incidental Mutation 'R0711:Celf2'
ID62718
Institutional Source Beutler Lab
Gene Symbol Celf2
Ensembl Gene ENSMUSG00000002107
Gene NameCUGBP, Elav-like family member 2
SynonymsNapor-2, ETR-3, B230345P09Rik, Cugbp2
MMRRC Submission 038894-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #R0711 (G1)
Quality Score100
Status Validated
Chromosome2
Chromosomal Location6539694-7509563 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 6721415 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002176] [ENSMUST00000002176] [ENSMUST00000100429] [ENSMUST00000100429] [ENSMUST00000114923] [ENSMUST00000114923] [ENSMUST00000114924] [ENSMUST00000114924] [ENSMUST00000114927] [ENSMUST00000114927] [ENSMUST00000114934] [ENSMUST00000114934] [ENSMUST00000123142] [ENSMUST00000123142] [ENSMUST00000137733] [ENSMUST00000137733] [ENSMUST00000142941] [ENSMUST00000142941] [ENSMUST00000150624] [ENSMUST00000150624] [ENSMUST00000170438] [ENSMUST00000170438] [ENSMUST00000182404] [ENSMUST00000182657] [ENSMUST00000182706] [ENSMUST00000182706] [ENSMUST00000182851] [ENSMUST00000182851] [ENSMUST00000182879] [ENSMUST00000182879] [ENSMUST00000183091] [ENSMUST00000183091] [ENSMUST00000183209] [ENSMUST00000183209] [ENSMUST00000183984]
Predicted Effect probably null
Transcript: ENSMUST00000002176
SMART Domains Protein: ENSMUSP00000002176
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 326 355 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
RRM 400 473 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000002176
SMART Domains Protein: ENSMUSP00000002176
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 326 355 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
RRM 400 473 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100429
SMART Domains Protein: ENSMUSP00000097996
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
RRM 406 479 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100429
SMART Domains Protein: ENSMUSP00000097996
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
RRM 406 479 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114923
SMART Domains Protein: ENSMUSP00000110573
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 41 120 1.6e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114923
SMART Domains Protein: ENSMUSP00000110573
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 41 120 1.6e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114924
SMART Domains Protein: ENSMUSP00000110574
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114924
SMART Domains Protein: ENSMUSP00000110574
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114927
SMART Domains Protein: ENSMUSP00000110577
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 359 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
RRM 404 477 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114927
SMART Domains Protein: ENSMUSP00000110577
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 359 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
RRM 404 477 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114934
SMART Domains Protein: ENSMUSP00000110584
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114934
SMART Domains Protein: ENSMUSP00000110584
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123142
SMART Domains Protein: ENSMUSP00000138666
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 91 1.58e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123142
SMART Domains Protein: ENSMUSP00000138666
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 91 1.58e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126742
Predicted Effect probably null
Transcript: ENSMUST00000137733
SMART Domains Protein: ENSMUSP00000138694
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
internal_repeat_1 109 134 2.62e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000137733
SMART Domains Protein: ENSMUSP00000138694
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
internal_repeat_1 109 134 2.62e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138347
SMART Domains Protein: ENSMUSP00000114914
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 24 102 1.29e-17 SMART
RRM 116 184 1.64e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142941
SMART Domains Protein: ENSMUSP00000120459
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
RRM 406 479 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142941
SMART Domains Protein: ENSMUSP00000120459
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
RRM 406 479 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000150624
SMART Domains Protein: ENSMUSP00000138297
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 359 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
RRM 404 477 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000150624
SMART Domains Protein: ENSMUSP00000138297
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 359 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
RRM 404 477 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170438
SMART Domains Protein: ENSMUSP00000130829
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
RRM 384 467 4.92e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170438
SMART Domains Protein: ENSMUSP00000130829
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
RRM 384 467 4.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182404
SMART Domains Protein: ENSMUSP00000138769
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 22 97 4.22e-22 SMART
low complexity region 107 136 N/A INTRINSIC
low complexity region 165 192 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 254 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182560
Predicted Effect probably benign
Transcript: ENSMUST00000182657
Predicted Effect probably null
Transcript: ENSMUST00000182706
SMART Domains Protein: ENSMUSP00000138764
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 362 391 N/A INTRINSIC
low complexity region 415 428 N/A INTRINSIC
RRM 436 509 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182706
SMART Domains Protein: ENSMUSP00000138764
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 362 391 N/A INTRINSIC
low complexity region 415 428 N/A INTRINSIC
RRM 436 509 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182851
SMART Domains Protein: ENSMUSP00000138363
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
low complexity region 350 379 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
RRM 424 497 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182851
SMART Domains Protein: ENSMUSP00000138363
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
low complexity region 350 379 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
RRM 424 497 3.2e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182879
SMART Domains Protein: ENSMUSP00000138359
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
RRM 346 429 4.92e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182879
SMART Domains Protein: ENSMUSP00000138359
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
RRM 346 429 4.92e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183091
SMART Domains Protein: ENSMUSP00000138795
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
RRM 366 449 4.92e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183091
SMART Domains Protein: ENSMUSP00000138795
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
RRM 366 449 4.92e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183209
SMART Domains Protein: ENSMUSP00000138355
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
RRM 378 461 4.92e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183209
SMART Domains Protein: ENSMUSP00000138355
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
RRM 378 461 4.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183269
Predicted Effect probably benign
Transcript: ENSMUST00000183984
SMART Domains Protein: ENSMUSP00000138974
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
RRM 104 182 1.29e-17 SMART
RRM 196 271 4.22e-22 SMART
low complexity region 281 310 N/A INTRINSIC
low complexity region 339 366 N/A INTRINSIC
low complexity region 368 380 N/A INTRINSIC
Meta Mutation Damage Score 0.446 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,068,225 D1058E probably damaging Het
4933405L10Rik A T 8: 105,708,931 probably null Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Afdn C T 17: 13,852,436 P874S probably damaging Het
Ankrd6 G A 4: 32,815,326 A391V probably damaging Het
Arhgef28 T G 13: 97,931,254 T1388P probably damaging Het
Asxl3 G T 18: 22,524,451 M1839I probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Chid1 C T 7: 141,496,677 V325I probably benign Het
Cnn3 T A 3: 121,449,984 D31E probably benign Het
Col12a1 G A 9: 79,652,035 P1857L probably damaging Het
Cpeb1 T A 7: 81,351,870 R430W probably benign Het
Daw1 T C 1: 83,191,338 probably benign Het
Dcaf13 A G 15: 39,138,089 Y264C probably damaging Het
Dnah6 T C 6: 73,087,602 I2666V probably damaging Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dock10 A T 1: 80,523,975 F1833I probably damaging Het
Efhd2 C T 4: 141,859,872 A200T probably damaging Het
Epb41l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y164H possibly damaging Het
Gkn2 T C 6: 87,373,419 probably benign Het
Golgb1 A T 16: 36,918,790 Q2497L probably damaging Het
Gzme A T 14: 56,117,739 M245K probably damaging Het
Iars2 A T 1: 185,322,388 probably benign Het
Icosl T A 10: 78,073,941 V240D probably damaging Het
Igsf3 T C 3: 101,427,393 M262T probably benign Het
Ing3 G T 6: 21,971,237 E336* probably null Het
Kat2a A T 11: 100,706,471 V625E probably damaging Het
Ksr1 A G 11: 79,038,247 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Mdfi A T 17: 47,832,930 probably benign Het
Med13 A G 11: 86,301,353 probably benign Het
Msh6 C T 17: 87,986,684 R956C probably damaging Het
Myo15b A G 11: 115,883,838 E670G probably damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Olfr1193 A G 2: 88,678,674 D266G probably damaging Het
Olfr632 G A 7: 103,937,817 A146T probably benign Het
Olfr834 T A 9: 18,988,151 N54K probably benign Het
Pde8b C G 13: 95,107,817 S143T possibly damaging Het
Pias4 G T 10: 81,157,530 probably benign Het
Prkca A G 11: 107,981,654 Y427H probably benign Het
Psg25 G A 7: 18,529,560 Q113* probably null Het
Rab3gap2 T A 1: 185,249,926 S392T probably damaging Het
Scrib A G 15: 76,066,907 probably benign Het
Sdk2 A G 11: 113,903,144 probably benign Het
Serpinb1c T A 13: 32,886,283 probably benign Het
Serpinb9f T A 13: 33,327,921 W136R probably damaging Het
Skint10 C A 4: 112,715,905 probably benign Het
Slc25a13 T C 6: 6,117,128 T196A probably damaging Het
Slc26a5 T C 5: 21,847,232 H33R probably damaging Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Slitrk6 A T 14: 110,749,819 Y819N probably damaging Het
Spata46 C T 1: 170,312,034 Q201* probably null Het
Sptbn1 A T 11: 30,114,739 V1920E probably damaging Het
Taf6l A G 19: 8,778,517 F256L probably benign Het
Tmco3 T A 8: 13,292,039 N104K probably damaging Het
Tmem200c A G 17: 68,842,254 T611A probably damaging Het
Tmem202 T G 9: 59,525,372 Y24S probably damaging Het
Tpp1 A G 7: 105,749,419 L230P probably damaging Het
Trim56 C T 5: 137,112,992 E557K probably benign Het
Trrap C T 5: 144,853,499 L3590F probably damaging Het
Ttc37 C T 13: 76,182,891 P1480L probably damaging Het
Tulp4 A G 17: 6,139,112 T70A possibly damaging Het
Vcp G C 4: 42,986,201 A297G probably benign Het
Vwf T A 6: 125,626,271 H861Q probably benign Het
Wdr64 T C 1: 175,772,185 I536T probably benign Het
Zfp72 G A 13: 74,376,425 probably benign Het
Zfp850 T C 7: 27,990,273 N170S probably benign Het
Other mutations in Celf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Celf2 APN 2 6721577 missense probably benign 0.00
IGL01974:Celf2 APN 2 6604031 missense probably damaging 1.00
IGL02159:Celf2 APN 2 6604177 nonsense probably null
LCD18:Celf2 UTSW 2 6779076 intron probably benign
R0113:Celf2 UTSW 2 6624714 missense probably damaging 1.00
R0511:Celf2 UTSW 2 6604176 missense probably damaging 1.00
R1755:Celf2 UTSW 2 6884958 start codon destroyed probably benign 0.01
R1802:Celf2 UTSW 2 6549933 missense probably damaging 1.00
R1898:Celf2 UTSW 2 6604164 missense probably damaging 1.00
R1912:Celf2 UTSW 2 6615753 missense probably damaging 1.00
R2422:Celf2 UTSW 2 6553889 missense probably damaging 1.00
R2848:Celf2 UTSW 2 6604125 missense probably damaging 0.96
R2849:Celf2 UTSW 2 6604125 missense probably damaging 0.96
R3708:Celf2 UTSW 2 6624678 missense probably damaging 1.00
R4295:Celf2 UTSW 2 6604064 missense probably benign 0.10
R4601:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4602:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4610:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4611:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4667:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4668:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4669:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4790:Celf2 UTSW 2 6549903 missense probably damaging 1.00
R5022:Celf2 UTSW 2 6607847 intron probably benign
R5369:Celf2 UTSW 2 7081081 intron probably benign
R5540:Celf2 UTSW 2 6553932 missense probably benign 0.43
R5805:Celf2 UTSW 2 6553787 missense probably damaging 1.00
R5913:Celf2 UTSW 2 7081158 start codon destroyed probably null 0.02
R6330:Celf2 UTSW 2 6884955 missense probably benign 0.05
R7505:Celf2 UTSW 2 6624700 missense probably damaging 1.00
X0018:Celf2 UTSW 2 6553913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCATAGGAGCAATCAGGAGACC -3'
(R):5'- TTTGGATCATTCAGACCAGCCAGAC -3'

Sequencing Primer
(F):5'- AATTCTGGGAGGAGCCCTG -3'
(R):5'- CCCAGATGCCATTAAGATGTTTGTC -3'
Posted On2013-07-30