Incidental Mutation 'R0711:Vwf'
ID62733
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene NameVon Willebrand factor
Synonyms6820430P06Rik, B130011O06Rik
MMRRC Submission 038894-MU
Accession Numbers

Genbank: NM_011708; MGI: 98941

Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R0711 (G1)
Quality Score201
Status Validated
Chromosome6
Chromosomal Location125546774-125686679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125626271 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 861 (H861Q)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000112254
AA Change: H861Q

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: H861Q

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134073
Meta Mutation Damage Score 0.1317 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,068,225 D1058E probably damaging Het
4933405L10Rik A T 8: 105,708,931 probably null Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Afdn C T 17: 13,852,436 P874S probably damaging Het
Ankrd6 G A 4: 32,815,326 A391V probably damaging Het
Arhgef28 T G 13: 97,931,254 T1388P probably damaging Het
Asxl3 G T 18: 22,524,451 M1839I probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Celf2 A G 2: 6,721,415 probably null Het
Chid1 C T 7: 141,496,677 V325I probably benign Het
Cnn3 T A 3: 121,449,984 D31E probably benign Het
Col12a1 G A 9: 79,652,035 P1857L probably damaging Het
Cpeb1 T A 7: 81,351,870 R430W probably benign Het
Daw1 T C 1: 83,191,338 probably benign Het
Dcaf13 A G 15: 39,138,089 Y264C probably damaging Het
Dnah6 T C 6: 73,087,602 I2666V probably damaging Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dock10 A T 1: 80,523,975 F1833I probably damaging Het
Efhd2 C T 4: 141,859,872 A200T probably damaging Het
Epb41l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y164H possibly damaging Het
Gkn2 T C 6: 87,373,419 probably benign Het
Golgb1 A T 16: 36,918,790 Q2497L probably damaging Het
Gzme A T 14: 56,117,739 M245K probably damaging Het
Iars2 A T 1: 185,322,388 probably benign Het
Icosl T A 10: 78,073,941 V240D probably damaging Het
Igsf3 T C 3: 101,427,393 M262T probably benign Het
Ing3 G T 6: 21,971,237 E336* probably null Het
Kat2a A T 11: 100,706,471 V625E probably damaging Het
Ksr1 A G 11: 79,038,247 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Mdfi A T 17: 47,832,930 probably benign Het
Med13 A G 11: 86,301,353 probably benign Het
Msh6 C T 17: 87,986,684 R956C probably damaging Het
Myo15b A G 11: 115,883,838 E670G probably damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Olfr1193 A G 2: 88,678,674 D266G probably damaging Het
Olfr632 G A 7: 103,937,817 A146T probably benign Het
Olfr834 T A 9: 18,988,151 N54K probably benign Het
Pde8b C G 13: 95,107,817 S143T possibly damaging Het
Pias4 G T 10: 81,157,530 probably benign Het
Prkca A G 11: 107,981,654 Y427H probably benign Het
Psg25 G A 7: 18,529,560 Q113* probably null Het
Rab3gap2 T A 1: 185,249,926 S392T probably damaging Het
Scrib A G 15: 76,066,907 probably benign Het
Sdk2 A G 11: 113,903,144 probably benign Het
Serpinb1c T A 13: 32,886,283 probably benign Het
Serpinb9f T A 13: 33,327,921 W136R probably damaging Het
Skint10 C A 4: 112,715,905 probably benign Het
Slc25a13 T C 6: 6,117,128 T196A probably damaging Het
Slc26a5 T C 5: 21,847,232 H33R probably damaging Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Slitrk6 A T 14: 110,749,819 Y819N probably damaging Het
Spata46 C T 1: 170,312,034 Q201* probably null Het
Sptbn1 A T 11: 30,114,739 V1920E probably damaging Het
Taf6l A G 19: 8,778,517 F256L probably benign Het
Tmco3 T A 8: 13,292,039 N104K probably damaging Het
Tmem200c A G 17: 68,842,254 T611A probably damaging Het
Tmem202 T G 9: 59,525,372 Y24S probably damaging Het
Tpp1 A G 7: 105,749,419 L230P probably damaging Het
Trim56 C T 5: 137,112,992 E557K probably benign Het
Trrap C T 5: 144,853,499 L3590F probably damaging Het
Ttc37 C T 13: 76,182,891 P1480L probably damaging Het
Tulp4 A G 17: 6,139,112 T70A possibly damaging Het
Vcp G C 4: 42,986,201 A297G probably benign Het
Wdr64 T C 1: 175,772,185 I536T probably benign Het
Zfp72 G A 13: 74,376,425 probably benign Het
Zfp850 T C 7: 27,990,273 N170S probably benign Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138 splice site probably benign
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077 splice site probably benign
gingerman UTSW 6 125662963 critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125685837 missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125663571 nonsense probably null
R1628_Vwf_608 UTSW 6 125647738 unclassified probably benign
R1669_Vwf_448 UTSW 6 125647906 missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125642037 missense probably benign 0.14
R2130_vwf_946 UTSW 6 125657057 missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125683526 missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125628476 critical splice donor site probably null
Russiahouse UTSW 6 125639341 nonsense probably null
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0390:Vwf UTSW 6 125626361 nonsense probably null
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 splice site probably null
R1398:Vwf UTSW 6 125603457 missense probably benign 0.02
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1809:Vwf UTSW 6 125590175 splice site probably benign
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2103:Vwf UTSW 6 125646330 missense probably benign 0.31
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 splice site probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense
R4871:Vwf UTSW 6 125686462 missense probably benign 0.25
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5523:Vwf UTSW 6 125643042 missense
R5642:Vwf UTSW 6 125603418 missense
R5860:Vwf UTSW 6 125643090 missense
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R5976:Vwf UTSW 6 125603463 missense
R6053:Vwf UTSW 6 125600665 missense probably benign 0.21
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6181:Vwf UTSW 6 125566146 missense probably damaging 0.98
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
R7113:Vwf UTSW 6 125655044 missense
R7287:Vwf UTSW 6 125637467 missense
R7359:Vwf UTSW 6 125566257 missense
R7509:Vwf UTSW 6 125642169 missense
R7519:Vwf UTSW 6 125667543 missense
R7545:Vwf UTSW 6 125614097 missense
R7549:Vwf UTSW 6 125626267 missense
R7593:Vwf UTSW 6 125647768 missense
R7635:Vwf UTSW 6 125682734 missense
R7793:Vwf UTSW 6 125686520 missense
R7802:Vwf UTSW 6 125666677 missense
R7824:Vwf UTSW 6 125658815 missense
R7849:Vwf UTSW 6 125656803 missense
R7900:Vwf UTSW 6 125628476 critical splice donor site probably null
R7919:Vwf UTSW 6 125647859 missense
R7966:Vwf UTSW 6 125639341 nonsense probably null
R8101:Vwf UTSW 6 125570559 nonsense probably null
R8162:Vwf UTSW 6 125645836 splice site probably null
R8345:Vwf UTSW 6 125679302 missense
R8853:Vwf UTSW 6 125657264 missense
R9027:Vwf UTSW 6 125666663 missense
R9065:Vwf UTSW 6 125646299 missense
R9128:Vwf UTSW 6 125642730 missense not run
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Z1176:Vwf UTSW 6 125591231 missense
Z1176:Vwf UTSW 6 125603308 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGCCTTCCACAGGCTCCAAATG -3'
(R):5'- AAACTTCCTACATCGTTGGGCATCC -3'

Sequencing Primer
(F):5'- gaactcagaaattcacctgcc -3'
(R):5'- TATAGATAGAACCTGACCCAGAGAC -3'
Posted On2013-07-30