Incidental Mutation 'R0711:Slitrk6'
ID62762
Institutional Source Beutler Lab
Gene Symbol Slitrk6
Ensembl Gene ENSMUSG00000045871
Gene NameSLIT and NTRK-like family, member 6
Synonyms4832410J21Rik
MMRRC Submission 038894-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R0711 (G1)
Quality Score144
Status Validated
Chromosome14
Chromosomal Location110748580-110755149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110749819 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 819 (Y819N)
Ref Sequence ENSEMBL: ENSMUSP00000077492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078386]
Predicted Effect probably damaging
Transcript: ENSMUST00000078386
AA Change: Y819N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077492
Gene: ENSMUSG00000045871
AA Change: Y819N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:LRRNT 30 68 4e-15 BLAST
LRR 87 110 1.71e1 SMART
LRR 111 134 3.07e-1 SMART
LRR 135 158 4.44e0 SMART
LRR_TYP 159 182 2.09e-3 SMART
LRR 185 206 6.23e1 SMART
LRRCT 218 268 5.61e-5 SMART
low complexity region 287 301 N/A INTRINSIC
Blast:LRRNT 327 364 2e-17 BLAST
LRR 388 408 2.68e1 SMART
LRR_TYP 409 432 3.63e-3 SMART
LRR_TYP 433 456 6.23e-2 SMART
LRR_TYP 457 480 3.69e-4 SMART
low complexity region 501 513 N/A INTRINSIC
LRRCT 516 566 1.53e-6 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 634 642 N/A INTRINSIC
Meta Mutation Damage Score 0.2626 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. This protein functions as a regulator of neurite outgrowth required for normal hearing and vision. Mutations in this gene are a cause of myopia and deafness. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous deficient mice show pronounced reduction in cochlear innervation. Innervation to the posterior crista is variably impaired and a there is a loss of neurons in the spiral and vestibular ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,068,225 D1058E probably damaging Het
4933405L10Rik A T 8: 105,708,931 probably null Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Afdn C T 17: 13,852,436 P874S probably damaging Het
Ankrd6 G A 4: 32,815,326 A391V probably damaging Het
Arhgef28 T G 13: 97,931,254 T1388P probably damaging Het
Asxl3 G T 18: 22,524,451 M1839I probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Celf2 A G 2: 6,721,415 probably null Het
Chid1 C T 7: 141,496,677 V325I probably benign Het
Cnn3 T A 3: 121,449,984 D31E probably benign Het
Col12a1 G A 9: 79,652,035 P1857L probably damaging Het
Cpeb1 T A 7: 81,351,870 R430W probably benign Het
Daw1 T C 1: 83,191,338 probably benign Het
Dcaf13 A G 15: 39,138,089 Y264C probably damaging Het
Dnah6 T C 6: 73,087,602 I2666V probably damaging Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dock10 A T 1: 80,523,975 F1833I probably damaging Het
Efhd2 C T 4: 141,859,872 A200T probably damaging Het
Epb41l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y164H possibly damaging Het
Gkn2 T C 6: 87,373,419 probably benign Het
Golgb1 A T 16: 36,918,790 Q2497L probably damaging Het
Gzme A T 14: 56,117,739 M245K probably damaging Het
Iars2 A T 1: 185,322,388 probably benign Het
Icosl T A 10: 78,073,941 V240D probably damaging Het
Igsf3 T C 3: 101,427,393 M262T probably benign Het
Ing3 G T 6: 21,971,237 E336* probably null Het
Kat2a A T 11: 100,706,471 V625E probably damaging Het
Ksr1 A G 11: 79,038,247 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Mdfi A T 17: 47,832,930 probably benign Het
Med13 A G 11: 86,301,353 probably benign Het
Msh6 C T 17: 87,986,684 R956C probably damaging Het
Myo15b A G 11: 115,883,838 E670G probably damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Olfr1193 A G 2: 88,678,674 D266G probably damaging Het
Olfr632 G A 7: 103,937,817 A146T probably benign Het
Olfr834 T A 9: 18,988,151 N54K probably benign Het
Pde8b C G 13: 95,107,817 S143T possibly damaging Het
Pias4 G T 10: 81,157,530 probably benign Het
Prkca A G 11: 107,981,654 Y427H probably benign Het
Psg25 G A 7: 18,529,560 Q113* probably null Het
Rab3gap2 T A 1: 185,249,926 S392T probably damaging Het
Scrib A G 15: 76,066,907 probably benign Het
Sdk2 A G 11: 113,903,144 probably benign Het
Serpinb1c T A 13: 32,886,283 probably benign Het
Serpinb9f T A 13: 33,327,921 W136R probably damaging Het
Skint10 C A 4: 112,715,905 probably benign Het
Slc25a13 T C 6: 6,117,128 T196A probably damaging Het
Slc26a5 T C 5: 21,847,232 H33R probably damaging Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Spata46 C T 1: 170,312,034 Q201* probably null Het
Sptbn1 A T 11: 30,114,739 V1920E probably damaging Het
Taf6l A G 19: 8,778,517 F256L probably benign Het
Tmco3 T A 8: 13,292,039 N104K probably damaging Het
Tmem200c A G 17: 68,842,254 T611A probably damaging Het
Tmem202 T G 9: 59,525,372 Y24S probably damaging Het
Tpp1 A G 7: 105,749,419 L230P probably damaging Het
Trim56 C T 5: 137,112,992 E557K probably benign Het
Trrap C T 5: 144,853,499 L3590F probably damaging Het
Ttc37 C T 13: 76,182,891 P1480L probably damaging Het
Tulp4 A G 17: 6,139,112 T70A possibly damaging Het
Vcp G C 4: 42,986,201 A297G probably benign Het
Vwf T A 6: 125,626,271 H861Q probably benign Het
Wdr64 T C 1: 175,772,185 I536T probably benign Het
Zfp72 G A 13: 74,376,425 probably benign Het
Zfp850 T C 7: 27,990,273 N170S probably benign Het
Other mutations in Slitrk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Slitrk6 APN 14 110751115 missense probably benign 0.35
IGL01131:Slitrk6 APN 14 110751576 missense probably damaging 1.00
IGL01294:Slitrk6 APN 14 110750074 missense probably benign
IGL01295:Slitrk6 APN 14 110751436 missense possibly damaging 0.50
IGL01762:Slitrk6 APN 14 110751624 missense probably damaging 1.00
IGL02165:Slitrk6 APN 14 110751817 missense probably benign 0.41
IGL02546:Slitrk6 APN 14 110749794 missense probably benign 0.18
IGL03103:Slitrk6 APN 14 110749941 missense probably benign
PIT1430001:Slitrk6 UTSW 14 110750427 missense possibly damaging 0.93
PIT4480001:Slitrk6 UTSW 14 110749825 frame shift probably null
R0035:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0066:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0067:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0069:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0107:Slitrk6 UTSW 14 110751963 missense possibly damaging 0.69
R0157:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0422:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0422:Slitrk6 UTSW 14 110752293 start gained probably benign
R0454:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0505:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0633:Slitrk6 UTSW 14 110751885 missense probably damaging 1.00
R0843:Slitrk6 UTSW 14 110750098 missense probably benign
R1298:Slitrk6 UTSW 14 110751865 missense possibly damaging 0.94
R1693:Slitrk6 UTSW 14 110750928 missense probably damaging 1.00
R1756:Slitrk6 UTSW 14 110750552 missense probably benign
R1998:Slitrk6 UTSW 14 110751823 missense probably damaging 0.99
R2049:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2140:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2142:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2314:Slitrk6 UTSW 14 110751955 missense probably damaging 1.00
R2566:Slitrk6 UTSW 14 110750272 missense probably benign 0.00
R4231:Slitrk6 UTSW 14 110751388 missense probably benign 0.02
R4236:Slitrk6 UTSW 14 110750148 missense probably benign 0.07
R4247:Slitrk6 UTSW 14 110750739 missense probably damaging 1.00
R4576:Slitrk6 UTSW 14 110750170 missense probably benign 0.05
R4856:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4858:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4859:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4886:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4931:Slitrk6 UTSW 14 110750379 missense probably damaging 1.00
R5255:Slitrk6 UTSW 14 110749753 makesense probably null
R5281:Slitrk6 UTSW 14 110750373 missense probably damaging 1.00
R5450:Slitrk6 UTSW 14 110750097 missense probably benign
R5579:Slitrk6 UTSW 14 110751217 missense possibly damaging 0.82
R5689:Slitrk6 UTSW 14 110752126 missense probably benign
R5935:Slitrk6 UTSW 14 110749873 missense probably benign 0.00
R6016:Slitrk6 UTSW 14 110750526 missense probably benign 0.00
R6312:Slitrk6 UTSW 14 110750247 missense probably benign 0.00
R6890:Slitrk6 UTSW 14 110751096 nonsense probably null
R6952:Slitrk6 UTSW 14 110750542 missense probably benign
R7378:Slitrk6 UTSW 14 110749863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAATACTACGTACTCCTTGCAACAG -3'
(R):5'- GGGAACTTCAGCAACTTGGCATCAC -3'

Sequencing Primer
(F):5'- GAACAGGCTATATTGCCTGATG -3'
(R):5'- TTGGCATCACAGAGTACCTAAG -3'
Posted On2013-07-30