Incidental Mutation 'R0712:Mastl'
ID62776
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Namemicrotubule associated serine/threonine kinase-like
Synonyms2700091H24Rik, THC2
MMRRC Submission 038895-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0712 (G1)
Quality Score96
Status Not validated
Chromosome2
Chromosomal Location23115606-23156024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23150993 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 106 (Y106H)
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119]
Predicted Effect probably damaging
Transcript: ENSMUST00000028119
AA Change: Y106H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: Y106H

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136207
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd1 G A X: 73,730,865 V489M possibly damaging Het
Anln A T 9: 22,380,298 V78E probably benign Het
Atp2b4 T C 1: 133,730,478 K565E probably damaging Het
Cap2 T C 13: 46,615,361 probably null Het
Cdh22 A G 2: 165,170,656 Y170H probably damaging Het
Chrna5 A T 9: 55,004,363 K45I probably damaging Het
Dyx1c1 G T 9: 72,960,657 G67* probably null Het
Hdac8 T A X: 102,499,918 M67L probably benign Het
Lama1 A G 17: 67,779,042 probably null Het
Lrba T A 3: 86,297,990 Y380* probably null Het
Obscn T C 11: 59,049,445 E5210G possibly damaging Het
Olfr102 T A 17: 37,314,084 H100L probably damaging Het
Olfr984 A G 9: 40,101,430 V20A probably benign Het
Pcgf2 T C 11: 97,691,004 Y21C probably damaging Het
Penk T C 4: 4,134,257 E130G probably benign Het
Rnmt G A 18: 68,307,788 probably null Het
Stk11ip T A 1: 75,527,447 L277Q probably damaging Het
Synpo2l A G 14: 20,661,839 S238P probably damaging Het
Tex264 A C 9: 106,659,232 L242R possibly damaging Het
Ubald2 T C 11: 116,434,575 F46S probably damaging Het
Zfp692 T C 11: 58,314,314 V463A probably benign Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23146148 missense probably damaging 1.00
IGL02103:Mastl APN 2 23139998 missense probably benign 0.01
IGL02622:Mastl APN 2 23132845 missense probably benign 0.12
IGL02826:Mastl APN 2 23145409 missense probably damaging 1.00
IGL02896:Mastl APN 2 23131767 missense probably damaging 1.00
IGL03024:Mastl APN 2 23139919 missense probably damaging 1.00
IGL03038:Mastl APN 2 23140615 splice site probably benign
R0600:Mastl UTSW 2 23133346 missense probably benign 0.06
R1168:Mastl UTSW 2 23133132 missense probably benign 0.06
R1750:Mastl UTSW 2 23146081 nonsense probably null
R1911:Mastl UTSW 2 23132680 nonsense probably null
R2051:Mastl UTSW 2 23132824 missense possibly damaging 0.49
R2859:Mastl UTSW 2 23139967 missense probably damaging 0.99
R3799:Mastl UTSW 2 23140492 splice site probably benign
R3840:Mastl UTSW 2 23140551 missense probably damaging 1.00
R4807:Mastl UTSW 2 23132843 missense probably benign
R4818:Mastl UTSW 2 23137026 missense probably benign 0.00
R4845:Mastl UTSW 2 23139998 missense probably benign 0.01
R5338:Mastl UTSW 2 23133491 missense probably benign 0.01
R5364:Mastl UTSW 2 23133653 missense probably benign 0.16
R6077:Mastl UTSW 2 23155794 missense probably damaging 0.99
R6158:Mastl UTSW 2 23132772 missense possibly damaging 0.92
R6450:Mastl UTSW 2 23120929 missense probably damaging 1.00
R6602:Mastl UTSW 2 23132677 missense probably benign 0.04
R6788:Mastl UTSW 2 23133698 missense probably benign 0.22
R6908:Mastl UTSW 2 23155976 start gained probably benign
R7058:Mastl UTSW 2 23133413 nonsense probably null
R7233:Mastl UTSW 2 23133658 missense probably benign
R7249:Mastl UTSW 2 23146139 missense probably damaging 1.00
R7347:Mastl UTSW 2 23133389 missense probably damaging 0.99
R7371:Mastl UTSW 2 23140573 missense probably damaging 1.00
R7726:Mastl UTSW 2 23140795 splice site probably null
R8057:Mastl UTSW 2 23133554 missense possibly damaging 0.75
R8288:Mastl UTSW 2 23133359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAGCACTATGCTACAAAACCTTC -3'
(R):5'- TGGTACTTTGCCAAATTCCAACACAGT -3'

Sequencing Primer
(F):5'- gaaagcctgccctcagac -3'
(R):5'- GTCAGTCAGATCTAAATGGCATC -3'
Posted On2013-07-30