Incidental Mutation 'R0712:Mastl'
ID 62776
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Name microtubule associated serine/threonine kinase-like
Synonyms THC2, 2700091H24Rik
MMRRC Submission 038895-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0712 (G1)
Quality Score 96
Status Not validated
Chromosome 2
Chromosomal Location 23006549-23046036 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23041005 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 106 (Y106H)
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119]
AlphaFold Q8C0P0
Predicted Effect probably damaging
Transcript: ENSMUST00000028119
AA Change: Y106H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: Y106H

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136207
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd1 G A X: 72,774,471 (GRCm39) V489M possibly damaging Het
Anln A T 9: 22,291,594 (GRCm39) V78E probably benign Het
Atp2b4 T C 1: 133,658,216 (GRCm39) K565E probably damaging Het
Cap2 T C 13: 46,768,837 (GRCm39) probably null Het
Cdh22 A G 2: 165,012,576 (GRCm39) Y170H probably damaging Het
Chrna5 A T 9: 54,911,647 (GRCm39) K45I probably damaging Het
Dnaaf4 G T 9: 72,867,939 (GRCm39) G67* probably null Het
Hdac8 T A X: 101,543,524 (GRCm39) M67L probably benign Het
Lama1 A G 17: 68,086,037 (GRCm39) probably null Het
Lrba T A 3: 86,205,297 (GRCm39) Y380* probably null Het
Obscn T C 11: 58,940,271 (GRCm39) E5210G possibly damaging Het
Or12d2 T A 17: 37,624,975 (GRCm39) H100L probably damaging Het
Or4d5 A G 9: 40,012,726 (GRCm39) V20A probably benign Het
Pcgf2 T C 11: 97,581,830 (GRCm39) Y21C probably damaging Het
Penk T C 4: 4,134,257 (GRCm39) E130G probably benign Het
Rnmt G A 18: 68,440,859 (GRCm39) probably null Het
Stk11ip T A 1: 75,504,091 (GRCm39) L277Q probably damaging Het
Synpo2l A G 14: 20,711,907 (GRCm39) S238P probably damaging Het
Tex264 A C 9: 106,536,431 (GRCm39) L242R possibly damaging Het
Ubald2 T C 11: 116,325,401 (GRCm39) F46S probably damaging Het
Zfp692 T C 11: 58,205,140 (GRCm39) V463A probably benign Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23,036,160 (GRCm39) missense probably damaging 1.00
IGL02103:Mastl APN 2 23,030,010 (GRCm39) missense probably benign 0.01
IGL02622:Mastl APN 2 23,022,857 (GRCm39) missense probably benign 0.12
IGL02826:Mastl APN 2 23,035,421 (GRCm39) missense probably damaging 1.00
IGL02896:Mastl APN 2 23,021,779 (GRCm39) missense probably damaging 1.00
IGL03024:Mastl APN 2 23,029,931 (GRCm39) missense probably damaging 1.00
IGL03038:Mastl APN 2 23,030,627 (GRCm39) splice site probably benign
R0600:Mastl UTSW 2 23,023,358 (GRCm39) missense probably benign 0.06
R1168:Mastl UTSW 2 23,023,144 (GRCm39) missense probably benign 0.06
R1750:Mastl UTSW 2 23,036,093 (GRCm39) nonsense probably null
R1911:Mastl UTSW 2 23,022,692 (GRCm39) nonsense probably null
R2051:Mastl UTSW 2 23,022,836 (GRCm39) missense possibly damaging 0.49
R2859:Mastl UTSW 2 23,029,979 (GRCm39) missense probably damaging 0.99
R3799:Mastl UTSW 2 23,030,504 (GRCm39) splice site probably benign
R3840:Mastl UTSW 2 23,030,563 (GRCm39) missense probably damaging 1.00
R4807:Mastl UTSW 2 23,022,855 (GRCm39) missense probably benign
R4818:Mastl UTSW 2 23,027,038 (GRCm39) missense probably benign 0.00
R4845:Mastl UTSW 2 23,030,010 (GRCm39) missense probably benign 0.01
R5338:Mastl UTSW 2 23,023,503 (GRCm39) missense probably benign 0.01
R5364:Mastl UTSW 2 23,023,665 (GRCm39) missense probably benign 0.16
R6077:Mastl UTSW 2 23,045,806 (GRCm39) missense probably damaging 0.99
R6158:Mastl UTSW 2 23,022,784 (GRCm39) missense possibly damaging 0.92
R6450:Mastl UTSW 2 23,010,941 (GRCm39) missense probably damaging 1.00
R6602:Mastl UTSW 2 23,022,689 (GRCm39) missense probably benign 0.04
R6788:Mastl UTSW 2 23,023,710 (GRCm39) missense probably benign 0.22
R6908:Mastl UTSW 2 23,045,988 (GRCm39) start gained probably benign
R7058:Mastl UTSW 2 23,023,425 (GRCm39) nonsense probably null
R7233:Mastl UTSW 2 23,023,670 (GRCm39) missense probably benign
R7249:Mastl UTSW 2 23,036,151 (GRCm39) missense probably damaging 1.00
R7347:Mastl UTSW 2 23,023,401 (GRCm39) missense probably damaging 0.99
R7371:Mastl UTSW 2 23,030,585 (GRCm39) missense probably damaging 1.00
R7726:Mastl UTSW 2 23,030,807 (GRCm39) splice site probably null
R8057:Mastl UTSW 2 23,023,566 (GRCm39) missense possibly damaging 0.75
R8288:Mastl UTSW 2 23,023,371 (GRCm39) missense probably damaging 1.00
R9101:Mastl UTSW 2 23,008,449 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- TGCTCAGCACTATGCTACAAAACCTTC -3'
(R):5'- TGGTACTTTGCCAAATTCCAACACAGT -3'

Sequencing Primer
(F):5'- gaaagcctgccctcagac -3'
(R):5'- GTCAGTCAGATCTAAATGGCATC -3'
Posted On 2013-07-30