Incidental Mutation 'R0712:Cap2'
ID 62794
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene Name cyclase associated actin cytoskeleton regulatory protein 2
Synonyms 2810452G09Rik
MMRRC Submission 038895-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R0712 (G1)
Quality Score 187
Status Not validated
Chromosome 13
Chromosomal Location 46655379-46803757 bp(+) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to C at 46768837 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
AlphaFold Q9CYT6
Predicted Effect probably null
Transcript: ENSMUST00000021802
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119341
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225444
Predicted Effect probably null
Transcript: ENSMUST00000225824
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd1 G A X: 72,774,471 (GRCm39) V489M possibly damaging Het
Anln A T 9: 22,291,594 (GRCm39) V78E probably benign Het
Atp2b4 T C 1: 133,658,216 (GRCm39) K565E probably damaging Het
Cdh22 A G 2: 165,012,576 (GRCm39) Y170H probably damaging Het
Chrna5 A T 9: 54,911,647 (GRCm39) K45I probably damaging Het
Dnaaf4 G T 9: 72,867,939 (GRCm39) G67* probably null Het
Hdac8 T A X: 101,543,524 (GRCm39) M67L probably benign Het
Lama1 A G 17: 68,086,037 (GRCm39) probably null Het
Lrba T A 3: 86,205,297 (GRCm39) Y380* probably null Het
Mastl A G 2: 23,041,005 (GRCm39) Y106H probably damaging Het
Obscn T C 11: 58,940,271 (GRCm39) E5210G possibly damaging Het
Or12d2 T A 17: 37,624,975 (GRCm39) H100L probably damaging Het
Or4d5 A G 9: 40,012,726 (GRCm39) V20A probably benign Het
Pcgf2 T C 11: 97,581,830 (GRCm39) Y21C probably damaging Het
Penk T C 4: 4,134,257 (GRCm39) E130G probably benign Het
Rnmt G A 18: 68,440,859 (GRCm39) probably null Het
Stk11ip T A 1: 75,504,091 (GRCm39) L277Q probably damaging Het
Synpo2l A G 14: 20,711,907 (GRCm39) S238P probably damaging Het
Tex264 A C 9: 106,536,431 (GRCm39) L242R possibly damaging Het
Ubald2 T C 11: 116,325,401 (GRCm39) F46S probably damaging Het
Zfp692 T C 11: 58,205,140 (GRCm39) V463A probably benign Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46,793,425 (GRCm39) splice site probably benign
IGL01927:Cap2 APN 13 46,789,109 (GRCm39) missense probably benign 0.03
IGL02213:Cap2 APN 13 46,789,087 (GRCm39) splice site probably benign
IGL02511:Cap2 APN 13 46,684,498 (GRCm39) start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46,678,968 (GRCm39) missense probably benign 0.00
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0385:Cap2 UTSW 13 46,714,023 (GRCm39) missense probably damaging 1.00
R0387:Cap2 UTSW 13 46,713,992 (GRCm39) missense probably damaging 0.99
R1489:Cap2 UTSW 13 46,763,111 (GRCm39) missense probably damaging 1.00
R1666:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1668:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1676:Cap2 UTSW 13 46,791,335 (GRCm39) missense probably damaging 1.00
R1756:Cap2 UTSW 13 46,684,489 (GRCm39) missense probably benign 0.11
R1822:Cap2 UTSW 13 46,768,823 (GRCm39) missense probably benign 0.03
R1867:Cap2 UTSW 13 46,793,555 (GRCm39) missense probably damaging 1.00
R1972:Cap2 UTSW 13 46,791,375 (GRCm39) missense probably damaging 0.98
R1990:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46,713,978 (GRCm39) critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46,793,317 (GRCm39) missense probably benign 0.20
R4024:Cap2 UTSW 13 46,791,317 (GRCm39) splice site probably benign
R4554:Cap2 UTSW 13 46,789,250 (GRCm39) missense probably damaging 1.00
R4748:Cap2 UTSW 13 46,793,302 (GRCm39) missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46,763,586 (GRCm39) missense probably damaging 0.99
R4876:Cap2 UTSW 13 46,684,497 (GRCm39) start codon destroyed probably null
R4902:Cap2 UTSW 13 46,684,501 (GRCm39) missense probably damaging 0.99
R5320:Cap2 UTSW 13 46,801,840 (GRCm39) makesense probably null
R5666:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R5670:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R6086:Cap2 UTSW 13 46,789,188 (GRCm39) missense probably damaging 1.00
R6728:Cap2 UTSW 13 46,793,335 (GRCm39) missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46,800,101 (GRCm39) missense probably damaging 1.00
R7785:Cap2 UTSW 13 46,789,224 (GRCm39) missense probably benign
R7889:Cap2 UTSW 13 46,800,051 (GRCm39) missense probably damaging 0.99
R8065:Cap2 UTSW 13 46,791,337 (GRCm39) missense probably damaging 1.00
R8205:Cap2 UTSW 13 46,768,739 (GRCm39) missense probably damaging 1.00
R8425:Cap2 UTSW 13 46,763,208 (GRCm39) missense probably damaging 0.98
R8731:Cap2 UTSW 13 46,800,006 (GRCm39) missense probably benign 0.00
R8738:Cap2 UTSW 13 46,684,548 (GRCm39) missense probably benign 0.00
R9320:Cap2 UTSW 13 46,768,818 (GRCm39) missense probably benign 0.04
R9491:Cap2 UTSW 13 46,791,366 (GRCm39) missense possibly damaging 0.92
R9686:Cap2 UTSW 13 46,678,926 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTAGGTATGGCACACTCCCTC -3'
(R):5'- GGTAGGCTAACCATTTCCTGCTCTG -3'

Sequencing Primer
(F):5'- AGGGTTACCCACATTCTCAGTG -3'
(R):5'- TGCAGGCGGTCAACAGAG -3'
Posted On 2013-07-30