Mutagenetix > Incidental Mutation

Incidental Mutation 'R7484:Dscaml1'

628143

Institutional Source

Beutler Lab

Gene Symbol

Dscaml1

Ensembl Gene

ENSMUSG00000032087

Gene Name

DS cell adhesion molecule like 1

Synonyms

4921507G06Rik, 4930435C18Rik

MMRRC Submission

045558-MU

Accession Numbers

Genbank: NM_001081270; MGI: 2150309

Essential gene?

Possibly essential (E-score: 0.526) question?

Stock #

R7484 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45426628-45753712 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to G at 45749446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034592]

AlphaFold

Q4VA61

Predicted Effect

probably null
Transcript: ENSMUST00000034592

SMART Domains

Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
low complexity region	28	55	N/A	INTRINSIC
IG_like	96	168	1.22e0	SMART
IG	189	277	1.15e-3	SMART
IGc2	296	359	2.54e-14	SMART
IGc2	385	451	8.12e-13	SMART
IGc2	478	550	9.55e-10	SMART
IGc2	575	640	9.78e-7	SMART
IGc2	666	734	5.93e-6	SMART
IGc2	760	832	6.75e-10	SMART
IG	853	943	1e-3	SMART
FN3	945	1029	6.64e-7	SMART
FN3	1045	1133	9.46e-12	SMART
FN3	1148	1234	3.2e-9	SMART
FN3	1249	1332	3.48e-10	SMART
IGc2	1363	1428	1.49e-11	SMART
FN3	1442	1522	3.42e-9	SMART
FN3	1537	1618	2.14e-1	SMART
low complexity region	1671	1683	N/A	INTRINSIC
low complexity region	2018	2026	N/A	INTRINSIC
low complexity region	2035	2069	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	G	A	5: 114,218,862	V1285I	probably damaging	Het
Acly	A	T	11: 100,495,963	I591N	probably damaging	Het
Acr	T	A	15: 89,573,224	V225E	probably damaging	Het
Actr8	A	G	14: 29,992,968	D580G	probably damaging	Het
Adamts12	C	A	15: 11,345,648	Q1592K	probably benign	Het
AI481877	A	T	4: 59,062,286	V924E	probably damaging	Het
Aire	T	C	10: 78,042,570	E138G	probably damaging	Het
Apob	C	T	12: 8,006,884	Q1789*	probably null	Het
BC147527	A	T	13: 120,308,481	K112N	probably damaging	Het
Cbx5	A	C	15: 103,205,829		probably null	Het
Cd300lb	A	T	11: 114,928,519	W95R	probably damaging	Het
Cdc16	A	G	8: 13,777,605	T504A	probably benign	Het
Cenpf	A	G	1: 189,656,821	S1605P	probably damaging	Het
Ckap2l	A	G	2: 129,272,535	V596A	possibly damaging	Het
Cntn1	T	C	15: 92,254,041	W454R	probably benign	Het
Crat	C	T	2: 30,404,565	R497Q	probably benign	Het
Csf2rb	A	G	15: 78,338,899	T104A	possibly damaging	Het
Cyhr1	A	G	15: 76,646,235	L295P	probably damaging	Het
Cyp4a12b	A	G	4: 115,432,563	D209G	possibly damaging	Het
Ddx23	T	C	15: 98,648,689	E533G	probably damaging	Het
Eif3l	T	G	15: 79,084,136	C202G	probably benign	Het
Ephx4	T	G	5: 107,429,746	M312R	probably damaging	Het
Erich6	A	T	3: 58,626,691		probably null	Het
Far2	G	A	6: 148,173,913	D424N	probably damaging	Het
Fat1	C	A	8: 45,036,184	N3497K	probably damaging	Het
Fstl3	G	A	10: 79,780,031	C117Y	probably damaging	Het
Fyb2	A	T	4: 105,013,302	H700L	probably benign	Het
Gm438	A	G	4: 144,777,951	L210P	probably damaging	Het
Gm8356	T	A	14: 6,535,135	M128L	probably benign	Het
Golim4	G	T	3: 75,898,135		probably null	Het
Grm1	T	G	10: 10,746,659	D440A	probably benign	Het
Gtf2a1	A	G	12: 91,562,973	V322A	probably benign	Het
Hid1	T	C	11: 115,352,581		probably null	Het
Igfals	G	A	17: 24,879,988	V18M	possibly damaging	Het
Klk1b24	G	T	7: 44,190,264		probably null	Het
Lmbr1	T	C	5: 29,346,852		probably benign	Het
Lrrc40	T	C	3: 158,040,557	S90P	probably benign	Het
Mapk9	T	C	11: 49,872,836	Y185H	probably damaging	Het
Marveld2	C	T	13: 100,611,560	G337D	probably damaging	Het
Mga	G	T	2: 119,946,229	R1539L	probably damaging	Het
Mllt6	T	A	11: 97,672,616	S342T	probably benign	Het
Ms4a6c	T	C	19: 11,472,529		probably null	Het
Muc16	T	A	9: 18,646,768	H2743L	unknown	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Olfr1130	T	C	2: 87,607,937	F183S	probably damaging	Het
Olfr166	A	G	16: 19,487,003	H55R	possibly damaging	Het
Plcd3	T	G	11: 103,071,719	K635N	probably damaging	Het
Prkch	T	A	12: 73,585,527		probably null	Het
Rb1cc1	T	C	1: 6,274,217	V1570A	probably damaging	Het
Rp1	T	C	1: 4,345,481	N1803D	probably benign	Het
Rufy3	T	A	5: 88,598,472	V72E	probably benign	Het
Secisbp2l	G	A	2: 125,771,532	Q181*	probably null	Het
Sgcb	A	G	5: 73,639,845	F191L	possibly damaging	Het
Sgsh	T	A	11: 119,346,357	D477V	probably damaging	Het
Slc22a28	C	A	19: 8,071,127	S385I	probably benign	Het
Slc26a3	T	C	12: 31,447,788	V47A	probably benign	Het
Slco2a1	A	T	9: 103,067,986	I187F	probably damaging	Het
Sltm	T	C	9: 70,573,897	S344P	unknown	Het
Sort1	A	G	3: 108,338,825	T373A	probably damaging	Het
Stab1	A	G	14: 31,160,317	F474L	probably benign	Het
Tbc1d5	G	T	17: 50,917,545	A326E	possibly damaging	Het
Vwa8	A	C	14: 78,982,234		probably null	Het
Wdr70	G	A	15: 7,922,081	T425I	probably benign	Het
Zfp30	T	C	7: 29,792,806	Y243H	probably benign	Het
Zfp974	A	T	7: 27,912,134	N55K	possibly damaging	Het

Other mutations in Dscaml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Dscaml1	APN	9	45670200	nonsense	probably null
IGL00497:Dscaml1	APN	9	45752238	missense	probably damaging	1.00
IGL00895:Dscaml1	APN	9	45751253	missense	probably damaging	0.99
IGL01011:Dscaml1	APN	9	45683672	missense	possibly damaging	0.76
IGL01086:Dscaml1	APN	9	45702662	splice site	probably benign
IGL01125:Dscaml1	APN	9	45749632	critical splice acceptor site	probably null
IGL01132:Dscaml1	APN	9	45752328	nonsense	probably null
IGL01356:Dscaml1	APN	9	45746857	missense	probably benign	0.03
IGL01459:Dscaml1	APN	9	45742683	nonsense	probably null
IGL01552:Dscaml1	APN	9	45447908	missense	probably damaging	1.00
IGL02033:Dscaml1	APN	9	45683782	missense	probably damaging	1.00
IGL02044:Dscaml1	APN	9	45746943	nonsense	probably null
IGL02095:Dscaml1	APN	9	45447703	missense	probably damaging	1.00
IGL02166:Dscaml1	APN	9	45683701	missense	probably damaging	0.98
IGL02262:Dscaml1	APN	9	45745116	missense	probably benign
IGL02262:Dscaml1	APN	9	45732080	missense	probably benign	0.44
IGL02340:Dscaml1	APN	9	45670176	missense	possibly damaging	0.66
IGL02604:Dscaml1	APN	9	45744328	unclassified	probably benign
IGL02619:Dscaml1	APN	9	45447796	missense	probably damaging	1.00
IGL02805:Dscaml1	APN	9	45447897	missense	probably damaging	0.98
IGL03409:Dscaml1	APN	9	45670103	missense	probably damaging	1.00
D3080:Dscaml1	UTSW	9	45684325	missense	probably benign	0.44
IGL03050:Dscaml1	UTSW	9	45742999	missense	probably damaging	1.00
R0149:Dscaml1	UTSW	9	45742680	nonsense	probably null
R0582:Dscaml1	UTSW	9	45668264	missense	possibly damaging	0.77
R0629:Dscaml1	UTSW	9	45721418	missense	probably damaging	0.98
R0632:Dscaml1	UTSW	9	45732134	missense	probably benign	0.06
R0815:Dscaml1	UTSW	9	45745074	missense	probably benign	0.00
R1162:Dscaml1	UTSW	9	45752349	splice site	probably benign
R1449:Dscaml1	UTSW	9	45742223	missense	possibly damaging	0.95
R1474:Dscaml1	UTSW	9	45685221	missense	probably damaging	1.00
R1481:Dscaml1	UTSW	9	45672643	missense	probably benign	0.01
R1533:Dscaml1	UTSW	9	45450584	missense	probably damaging	0.99
R1542:Dscaml1	UTSW	9	45749440	missense	possibly damaging	0.84
R1572:Dscaml1	UTSW	9	45721333	missense	probably benign	0.00
R1627:Dscaml1	UTSW	9	45753147	missense	probably damaging	1.00
R1634:Dscaml1	UTSW	9	45672749	missense	probably damaging	1.00
R1713:Dscaml1	UTSW	9	45752690	missense	possibly damaging	0.49
R1777:Dscaml1	UTSW	9	45683756	missense	possibly damaging	0.58
R1812:Dscaml1	UTSW	9	45751286	critical splice donor site	probably null
R1834:Dscaml1	UTSW	9	45683632	missense	probably benign	0.00
R1907:Dscaml1	UTSW	9	45740480	missense	probably damaging	1.00
R1953:Dscaml1	UTSW	9	45670224	missense	probably benign	0.01
R2056:Dscaml1	UTSW	9	45750132	missense	probably damaging	0.99
R2193:Dscaml1	UTSW	9	45685234	missense	probably benign	0.21
R2497:Dscaml1	UTSW	9	45745078	missense	probably benign	0.00
R3768:Dscaml1	UTSW	9	45732137	missense	possibly damaging	0.94
R3891:Dscaml1	UTSW	9	45717484	missense	possibly damaging	0.84
R4110:Dscaml1	UTSW	9	45732068	missense	probably benign	0.07
R4706:Dscaml1	UTSW	9	45450580	missense	probably damaging	1.00
R4716:Dscaml1	UTSW	9	45450592	missense	probably damaging	1.00
R4719:Dscaml1	UTSW	9	45672695	missense	probably benign	0.13
R4770:Dscaml1	UTSW	9	45670106	missense	probably damaging	1.00
R4924:Dscaml1	UTSW	9	45745189	missense	probably damaging	1.00
R5167:Dscaml1	UTSW	9	45717432	missense	probably damaging	1.00
R5346:Dscaml1	UTSW	9	45450559	missense	possibly damaging	0.63
R5737:Dscaml1	UTSW	9	45745185	missense	probably damaging	0.99
R5977:Dscaml1	UTSW	9	45721298	missense	probably benign	0.19
R6073:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6276:Dscaml1	UTSW	9	45668160	missense	possibly damaging	0.62
R6415:Dscaml1	UTSW	9	45683677	nonsense	probably null
R6527:Dscaml1	UTSW	9	45712184	nonsense	probably null
R6582:Dscaml1	UTSW	9	45752806	missense	probably benign	0.00
R6655:Dscaml1	UTSW	9	45746937	missense	probably benign	0.00
R6772:Dscaml1	UTSW	9	45710311	missense	probably damaging	1.00
R6799:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6892:Dscaml1	UTSW	9	45683830	missense	probably damaging	0.99
R6918:Dscaml1	UTSW	9	45430507	missense	probably benign
R6967:Dscaml1	UTSW	9	45674523	missense	probably damaging	0.97
R7214:Dscaml1	UTSW	9	45670139	missense	probably benign	0.01
R7286:Dscaml1	UTSW	9	45742746	critical splice donor site	probably null
R7315:Dscaml1	UTSW	9	45745125	missense	probably benign	0.00
R7338:Dscaml1	UTSW	9	45674504	missense	probably benign	0.12
R7343:Dscaml1	UTSW	9	45752916	missense	probably benign
R7395:Dscaml1	UTSW	9	45702405	missense	possibly damaging	0.73
R7439:Dscaml1	UTSW	9	45710326	missense	possibly damaging	0.94
R7545:Dscaml1	UTSW	9	45685383	missense	probably benign	0.11
R7979:Dscaml1	UTSW	9	45683731	missense	probably damaging	1.00
R8005:Dscaml1	UTSW	9	45717510	missense	probably damaging	1.00
R8181:Dscaml1	UTSW	9	45746842	missense	possibly damaging	0.86
R8262:Dscaml1	UTSW	9	45747140	intron	probably benign
R8428:Dscaml1	UTSW	9	45742586	missense	probably benign	0.00
R8725:Dscaml1	UTSW	9	45430461	missense	probably benign	0.00
R8727:Dscaml1	UTSW	9	45430461	missense	probably benign	0.00
R8796:Dscaml1	UTSW	9	45447728	missense	probably damaging	0.99
R8840:Dscaml1	UTSW	9	45723420	missense	probably damaging	0.99
R9291:Dscaml1	UTSW	9	45447953	missense	probably damaging	1.00
R9394:Dscaml1	UTSW	9	45750056	missense	possibly damaging	0.64
R9610:Dscaml1	UTSW	9	45668224	missense	possibly damaging	0.95
R9611:Dscaml1	UTSW	9	45668224	missense	possibly damaging	0.95
R9653:Dscaml1	UTSW	9	45732168	critical splice donor site	probably null
R9699:Dscaml1	UTSW	9	45743017	missense	probably damaging	0.97
X0058:Dscaml1	UTSW	9	45752128	missense	probably benign	0.00
Z1177:Dscaml1	UTSW	9	45672791	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GAAACCATTGCTGTTCCGTG -3'
(R):5'- CTTTCACAGGGGTGTCGAAG -3'

Sequencing Primer
(F):5'- CATTGCTGTTCCGTGGGCTTTATC -3'
(R):5'- TGTTCTTGCTGTGGAAGAAGGAAAG -3'

Posted On

2020-01-24