Incidental Mutation 'R7511:Hsf2'
ID628148
Institutional Source Beutler Lab
Gene Symbol Hsf2
Ensembl Gene ENSMUSG00000019878
Gene Nameheat shock factor 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7511 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location57486385-57513135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 57504557 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 230 (C230F)
Ref Sequence ENSEMBL: ENSMUSP00000151957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079833] [ENSMUST00000220042] [ENSMUST00000220353]
Predicted Effect probably benign
Transcript: ENSMUST00000079833
SMART Domains Protein: ENSMUSP00000078761
Gene: ENSMUSG00000019878

DomainStartEndE-ValueType
HSF 6 110 1.99e-62 SMART
coiled coil region 133 176 N/A INTRINSIC
Pfam:Vert_HS_TF 230 392 1.5e-39 PFAM
Pfam:Vert_HS_TF 391 494 2.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220042
Predicted Effect probably benign
Transcript: ENSMUST00000220353
AA Change: C230F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HSF family of transcription factors that bind specifically to the heat-shock promoter element and activate transcription. Heat shock transcription factors activate heat-shock response genes under conditions of heat or other stresses. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased late-gestational lethality associated with collapsed lateral ventricles and ventricular bleeding. Survivors may show ventricular dilation, sterility in females, and reduced sperm counts in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,882,954 K327E probably damaging Het
Adamts14 G A 10: 61,218,528 A572V possibly damaging Het
Add2 A G 6: 86,098,615 N249D probably benign Het
Adgrb2 A T 4: 130,022,111 M1503L probably benign Het
Alms1 A G 6: 85,609,425 K421E unknown Het
B3galt5 A G 16: 96,315,716 K183R possibly damaging Het
Braf T C 6: 39,688,253 I94M probably damaging Het
Cacna1a A G 8: 84,567,682 E1158G possibly damaging Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
Ccdc38 C A 10: 93,562,800 L147I possibly damaging Het
Ccdc83 T C 7: 90,236,922 N210D possibly damaging Het
Cdh7 T C 1: 109,997,853 probably benign Het
Coro1b T A 19: 4,152,526 Y338N probably damaging Het
Crlf3 A C 11: 80,063,986 probably null Het
Crnn A T 3: 93,149,416 K503M probably damaging Het
Cul5 T A 9: 53,625,969 N521I probably damaging Het
Cyp2c50 T A 19: 40,092,190 probably null Het
Dis3 T C 14: 99,099,606 H23R possibly damaging Het
Dock7 A T 4: 99,061,282 L441H Het
Dock7 C A 4: 99,079,755 E162* probably null Het
Dpp9 A T 17: 56,205,611 M174K possibly damaging Het
Dtd1 A G 2: 144,617,227 D57G probably benign Het
F3 A G 3: 121,731,557 E149G probably damaging Het
Glp2r C T 11: 67,757,591 R95K probably damaging Het
Gm13103 T A 4: 143,846,546 I3N possibly damaging Het
Gm38394 T A 1: 133,659,243 I119L probably benign Het
Gpr107 T A 2: 31,178,346 F273L probably benign Het
Gria1 A T 11: 57,283,625 I647F probably damaging Het
Heatr5a A C 12: 51,879,434 I1878S possibly damaging Het
Igfbp2 T G 1: 72,852,005 M254R probably damaging Het
Kifc2 C A 15: 76,661,337 Q95K possibly damaging Het
Lnx1 T G 5: 74,620,311 N183T probably benign Het
Ltn1 G T 16: 87,408,828 T983K possibly damaging Het
Macf1 A T 4: 123,473,300 V2556D possibly damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mtmr12 T G 15: 12,265,595 Y466D possibly damaging Het
Musk A G 4: 58,333,672 I256V probably benign Het
Ociad1 T C 5: 73,294,995 F43S probably damaging Het
Olfr729 A G 14: 50,148,256 L206P probably damaging Het
Olfr980 A T 9: 40,006,933 S5R possibly damaging Het
Pah G A 10: 87,554,387 A132T probably damaging Het
Pak7 G A 2: 136,083,324 S686F possibly damaging Het
Pi4kb T C 3: 94,989,312 S307P probably benign Het
Plxna1 T C 6: 89,341,907 T645A possibly damaging Het
Pold1 C T 7: 44,542,190 R124K possibly damaging Het
Prdm10 T C 9: 31,378,481 Y1153H probably damaging Het
Ptk2b T C 14: 66,154,244 N947S possibly damaging Het
Rad54b A G 4: 11,578,956 probably null Het
S1pr4 A G 10: 81,499,789 probably benign Het
Sec23b A G 2: 144,590,349 K760E probably benign Het
Sergef T A 7: 46,614,746 N239I probably damaging Het
Serpinb9 C A 13: 33,008,071 N78K probably benign Het
Sntb1 G T 15: 55,647,951 F412L possibly damaging Het
Stradb T A 1: 58,992,949 F294L probably damaging Het
Ttll11 G A 2: 35,903,034 R266C probably damaging Het
Ttn A T 2: 76,794,538 M15232K possibly damaging Het
Tubgcp2 T C 7: 140,004,880 I547M probably benign Het
Vgf C A 5: 137,031,391 P136T unknown Het
Vmn1r36 T A 6: 66,716,930 probably benign Het
Vmn2r102 T C 17: 19,681,143 S511P probably damaging Het
Wdr27 C T 17: 14,883,703 V714I probably benign Het
Zfp229 A G 17: 21,745,064 S92G probably benign Het
Zfp710 C T 7: 80,082,502 Q476* probably null Het
Zfp808 A G 13: 62,172,823 N622S probably benign Het
Other mutations in Hsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Hsf2 APN 10 57512028 missense probably benign 0.00
IGL00965:Hsf2 APN 10 57512100 missense probably damaging 1.00
IGL01338:Hsf2 APN 10 57501379 missense probably damaging 1.00
IGL01518:Hsf2 APN 10 57512134 missense probably damaging 1.00
IGL01721:Hsf2 APN 10 57496181 missense probably benign 0.13
IGL02219:Hsf2 APN 10 57496274 missense probably damaging 1.00
IGL03493:Hsf2 APN 10 57505366 missense probably damaging 1.00
R0270:Hsf2 UTSW 10 57502639 missense probably benign 0.28
R1774:Hsf2 UTSW 10 57512146 missense probably damaging 1.00
R2406:Hsf2 UTSW 10 57497546 missense probably damaging 0.96
R3410:Hsf2 UTSW 10 57505282 missense probably damaging 1.00
R4829:Hsf2 UTSW 10 57496170 missense probably damaging 0.96
R4958:Hsf2 UTSW 10 57501371 missense probably damaging 0.99
R5154:Hsf2 UTSW 10 57504712 missense probably benign
R5237:Hsf2 UTSW 10 57506221 missense probably benign 0.16
R5903:Hsf2 UTSW 10 57504723 missense probably benign
R6125:Hsf2 UTSW 10 57512005 missense probably benign
R6126:Hsf2 UTSW 10 57495917 missense probably damaging 1.00
R6280:Hsf2 UTSW 10 57511495 missense probably benign 0.03
R6309:Hsf2 UTSW 10 57486580 start gained probably benign
R6954:Hsf2 UTSW 10 57504643 missense probably damaging 1.00
R6966:Hsf2 UTSW 10 57495984 missense probably damaging 1.00
R7088:Hsf2 UTSW 10 57512092 missense probably damaging 1.00
R7182:Hsf2 UTSW 10 57505176 missense possibly damaging 0.87
R7743:Hsf2 UTSW 10 57511335 intron probably null
Z1088:Hsf2 UTSW 10 57496168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACTTTGGGTATGTCATTCATC -3'
(R):5'- TTGGAGGAATCCACTACAACATCC -3'

Sequencing Primer
(F):5'- ACTTTGGGTATGTCATTCATCTTCAG -3'
(R):5'- CCTCATTTGTTTCTGGAATAACTGG -3'
Posted On2020-01-24