Incidental Mutation 'R7511:Zfp808'
ID628149
Institutional Source Beutler Lab
Gene Symbol Zfp808
Ensembl Gene ENSMUSG00000074867
Gene Namezinc finger protein 808
SynonymsGm7036
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7511 (G1)
Quality Score69.0074
Status Validated
Chromosome13
Chromosomal Location62129886-62236144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62172823 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 622 (N622S)
Ref Sequence ENSEMBL: ENSMUSP00000097048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099449] [ENSMUST00000221772]
Predicted Effect probably benign
Transcript: ENSMUST00000099449
AA Change: N622S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097048
Gene: ENSMUSG00000074867
AA Change: N622S

DomainStartEndE-ValueType
KRAB 4 66 2.1e-17 SMART
ZnF_C2H2 133 155 2.4e-3 SMART
ZnF_C2H2 161 183 8.34e-3 SMART
ZnF_C2H2 189 211 2.75e-3 SMART
ZnF_C2H2 217 239 1.98e-4 SMART
ZnF_C2H2 245 267 3.21e-4 SMART
ZnF_C2H2 273 295 2.43e-4 SMART
ZnF_C2H2 301 323 8.6e-5 SMART
ZnF_C2H2 329 351 4.54e-4 SMART
ZnF_C2H2 357 379 9.22e-5 SMART
ZnF_C2H2 385 407 8.22e-2 SMART
ZnF_C2H2 413 435 1.56e-2 SMART
ZnF_C2H2 441 463 5.99e-4 SMART
ZnF_C2H2 469 491 2.79e-4 SMART
ZnF_C2H2 497 519 4.54e-4 SMART
ZnF_C2H2 525 547 1.95e-3 SMART
ZnF_C2H2 553 575 4.24e-4 SMART
ZnF_C2H2 581 603 2.27e-4 SMART
ZnF_C2H2 609 631 2.27e-4 SMART
ZnF_C2H2 637 659 9.08e-4 SMART
ZnF_C2H2 665 687 1.4e-4 SMART
ZnF_C2H2 693 715 4.24e-4 SMART
ZnF_C2H2 721 743 1.26e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221772
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,882,954 K327E probably damaging Het
Adamts14 G A 10: 61,218,528 A572V possibly damaging Het
Add2 A G 6: 86,098,615 N249D probably benign Het
Adgrb2 A T 4: 130,022,111 M1503L probably benign Het
Alms1 A G 6: 85,609,425 K421E unknown Het
B3galt5 A G 16: 96,315,716 K183R possibly damaging Het
Braf T C 6: 39,688,253 I94M probably damaging Het
Cacna1a A G 8: 84,567,682 E1158G possibly damaging Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
Ccdc38 C A 10: 93,562,800 L147I possibly damaging Het
Ccdc83 T C 7: 90,236,922 N210D possibly damaging Het
Cdh7 T C 1: 109,997,853 probably benign Het
Coro1b T A 19: 4,152,526 Y338N probably damaging Het
Crlf3 A C 11: 80,063,986 probably null Het
Crnn A T 3: 93,149,416 K503M probably damaging Het
Cul5 T A 9: 53,625,969 N521I probably damaging Het
Cyp2c50 T A 19: 40,092,190 probably null Het
Dis3 T C 14: 99,099,606 H23R possibly damaging Het
Dock7 A T 4: 99,061,282 L441H Het
Dock7 C A 4: 99,079,755 E162* probably null Het
Dpp9 A T 17: 56,205,611 M174K possibly damaging Het
Dtd1 A G 2: 144,617,227 D57G probably benign Het
F3 A G 3: 121,731,557 E149G probably damaging Het
Glp2r C T 11: 67,757,591 R95K probably damaging Het
Gm13103 T A 4: 143,846,546 I3N possibly damaging Het
Gm38394 T A 1: 133,659,243 I119L probably benign Het
Gpr107 T A 2: 31,178,346 F273L probably benign Het
Gria1 A T 11: 57,283,625 I647F probably damaging Het
Heatr5a A C 12: 51,879,434 I1878S possibly damaging Het
Hsf2 G T 10: 57,504,557 C230F probably benign Het
Igfbp2 T G 1: 72,852,005 M254R probably damaging Het
Kifc2 C A 15: 76,661,337 Q95K possibly damaging Het
Lnx1 T G 5: 74,620,311 N183T probably benign Het
Ltn1 G T 16: 87,408,828 T983K possibly damaging Het
Macf1 A T 4: 123,473,300 V2556D possibly damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mtmr12 T G 15: 12,265,595 Y466D possibly damaging Het
Musk A G 4: 58,333,672 I256V probably benign Het
Ociad1 T C 5: 73,294,995 F43S probably damaging Het
Olfr729 A G 14: 50,148,256 L206P probably damaging Het
Olfr980 A T 9: 40,006,933 S5R possibly damaging Het
Pah G A 10: 87,554,387 A132T probably damaging Het
Pak7 G A 2: 136,083,324 S686F possibly damaging Het
Pi4kb T C 3: 94,989,312 S307P probably benign Het
Plxna1 T C 6: 89,341,907 T645A possibly damaging Het
Pold1 C T 7: 44,542,190 R124K possibly damaging Het
Prdm10 T C 9: 31,378,481 Y1153H probably damaging Het
Ptk2b T C 14: 66,154,244 N947S possibly damaging Het
Rad54b A G 4: 11,578,956 probably null Het
S1pr4 A G 10: 81,499,789 probably benign Het
Sec23b A G 2: 144,590,349 K760E probably benign Het
Sergef T A 7: 46,614,746 N239I probably damaging Het
Serpinb9 C A 13: 33,008,071 N78K probably benign Het
Sntb1 G T 15: 55,647,951 F412L possibly damaging Het
Stradb T A 1: 58,992,949 F294L probably damaging Het
Ttll11 G A 2: 35,903,034 R266C probably damaging Het
Ttn A T 2: 76,794,538 M15232K possibly damaging Het
Tubgcp2 T C 7: 140,004,880 I547M probably benign Het
Vgf C A 5: 137,031,391 P136T unknown Het
Vmn1r36 T A 6: 66,716,930 probably benign Het
Vmn2r102 T C 17: 19,681,143 S511P probably damaging Het
Wdr27 C T 17: 14,883,703 V714I probably benign Het
Zfp229 A G 17: 21,745,064 S92G probably benign Het
Zfp710 C T 7: 80,082,502 Q476* probably null Het
Other mutations in Zfp808
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Zfp808 APN 13 62173209 missense probably damaging 0.96
IGL02517:Zfp808 APN 13 62173218 makesense probably null
IGL02809:Zfp808 APN 13 62173180 missense probably benign 0.00
IGL02882:Zfp808 APN 13 62173180 missense probably benign 0.00
IGL02941:Zfp808 APN 13 62173130 missense possibly damaging 0.82
IGL03184:Zfp808 APN 13 62169567 missense possibly damaging 0.90
LCD18:Zfp808 UTSW 13 62166651 intron probably benign
R0387:Zfp808 UTSW 13 62169478 missense probably damaging 1.00
R0472:Zfp808 UTSW 13 62172306 missense probably damaging 1.00
R0544:Zfp808 UTSW 13 62169434 splice site probably benign
R0635:Zfp808 UTSW 13 62172419 missense probably damaging 1.00
R0981:Zfp808 UTSW 13 62171673 missense possibly damaging 0.47
R1446:Zfp808 UTSW 13 62173007 missense probably damaging 1.00
R1569:Zfp808 UTSW 13 62172900 nonsense probably null
R1573:Zfp808 UTSW 13 62171497 missense possibly damaging 0.52
R1761:Zfp808 UTSW 13 62171646 missense possibly damaging 0.71
R1796:Zfp808 UTSW 13 62171856 missense probably damaging 1.00
R1993:Zfp808 UTSW 13 62172907 missense probably benign 0.10
R2656:Zfp808 UTSW 13 62172852 missense possibly damaging 0.63
R2938:Zfp808 UTSW 13 62171218 missense probably benign
R3027:Zfp808 UTSW 13 62171590 missense probably benign 0.33
R3777:Zfp808 UTSW 13 62171903 missense probably damaging 0.97
R3779:Zfp808 UTSW 13 62171903 missense probably damaging 0.97
R3801:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R3802:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R3804:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R4024:Zfp808 UTSW 13 62171730 missense possibly damaging 0.71
R4741:Zfp808 UTSW 13 62171949 missense probably damaging 1.00
R4791:Zfp808 UTSW 13 62171231 missense probably damaging 0.97
R4809:Zfp808 UTSW 13 62171292 nonsense probably null
R4907:Zfp808 UTSW 13 62171473 missense possibly damaging 0.71
R5056:Zfp808 UTSW 13 62172630 missense probably damaging 1.00
R5760:Zfp808 UTSW 13 62171926 missense probably damaging 1.00
R5869:Zfp808 UTSW 13 62171255 missense probably damaging 1.00
R6230:Zfp808 UTSW 13 62172322 missense probably benign 0.19
R6372:Zfp808 UTSW 13 62172477 missense probably damaging 1.00
R6545:Zfp808 UTSW 13 62171895 missense probably benign 0.02
R6620:Zfp808 UTSW 13 62172824 missense probably benign 0.08
R6622:Zfp808 UTSW 13 62171832 missense possibly damaging 0.90
R6813:Zfp808 UTSW 13 62173035 missense probably damaging 0.99
R6920:Zfp808 UTSW 13 62173168 missense probably benign 0.05
R7666:Zfp808 UTSW 13 62171411 missense probably benign
R7747:Zfp808 UTSW 13 62171505 missense probably benign 0.39
R7763:Zfp808 UTSW 13 62172664 missense probably benign 0.28
R7779:Zfp808 UTSW 13 62172757 missense possibly damaging 0.68
RF005:Zfp808 UTSW 13 62171299 missense probably benign 0.14
RF024:Zfp808 UTSW 13 62171299 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CATACTGGAGAGAAGCCCTTCAAAT -3'
(R):5'- CTCTCCAGTATGTGTTCTTCTATGAGT -3'

Sequencing Primer
(F):5'- GCCCTTCAAATGTAATCAGTGTG -3'
(R):5'- GAAGGGTTTCTCTCCAGTATG -3'
Posted On2020-01-24