Incidental Mutation 'R0715:Supt5'
ID62815
Institutional Source Beutler Lab
Gene Symbol Supt5
Ensembl Gene ENSMUSG00000003435
Gene Namesuppressor of Ty 5
SynonymsSupt5h, Spt5
MMRRC Submission 038898-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0715 (G1)
Quality Score197
Status Validated
Chromosome7
Chromosomal Location28314891-28338746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28329037 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 178 (W178R)
Ref Sequence ENSEMBL: ENSMUSP00000147164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003527] [ENSMUST00000207563] [ENSMUST00000208243] [ENSMUST00000209141]
Predicted Effect probably damaging
Transcript: ENSMUST00000003527
AA Change: W178R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003527
Gene: ENSMUSG00000003435
AA Change: W178R

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
coiled coil region 36 63 N/A INTRINSIC
Pfam:Spt5_N 73 170 8.1e-17 PFAM
NGN 174 265 2.2e-14 SMART
KOW 270 297 8.77e0 SMART
KOW 417 444 8.69e-4 SMART
KOW 469 496 9.1e-7 SMART
KOW 591 618 2.46e-3 SMART
low complexity region 677 695 N/A INTRINSIC
KOW 697 724 3.93e-2 SMART
CTD 766 902 2.09e-31 SMART
KOW 1028 1055 9.69e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207879
Predicted Effect probably damaging
Transcript: ENSMUST00000208243
AA Change: W30R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208726
Predicted Effect probably damaging
Transcript: ENSMUST00000209141
AA Change: W178R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9685 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,223,092 C1933S probably benign Het
4930438A08Rik A G 11: 58,288,350 Y170C probably damaging Het
Adcy2 C T 13: 68,888,042 V167I probably benign Het
Agl A G 3: 116,752,176 Y1324H probably damaging Het
Arhgef37 G T 18: 61,508,789 Q170K probably damaging Het
Asah2 A G 19: 32,016,776 S390P probably damaging Het
Atp8a1 A T 5: 67,774,725 H240Q probably benign Het
Btbd16 T A 7: 130,788,827 N151K probably damaging Het
Ccdc73 T A 2: 104,973,154 probably benign Het
Cecr2 G T 6: 120,758,198 M21I probably benign Het
Ckap2l T C 2: 129,285,716 T181A probably benign Het
Col4a3 T C 1: 82,652,158 probably benign Het
Dnah9 A G 11: 66,081,248 probably benign Het
Fat3 T C 9: 16,375,123 T1035A probably benign Het
Fzd8 A G 18: 9,212,947 T10A unknown Het
Gm11639 T C 11: 104,720,880 L516P possibly damaging Het
Gm9631 C A 11: 121,942,502 C636F probably damaging Het
Gp1ba A G 11: 70,640,788 probably benign Het
Gsk3a A G 7: 25,231,709 V277A probably damaging Het
H2-M1 T A 17: 36,670,228 probably benign Het
Hesx1 T A 14: 27,000,852 W45R probably damaging Het
Il23r T A 6: 67,486,333 M59L possibly damaging Het
Insc T A 7: 114,845,077 V433E probably benign Het
Itga8 T C 2: 12,191,242 probably benign Het
Kif13a T A 13: 46,812,823 E436V probably damaging Het
Liph A G 16: 21,995,350 F7S probably benign Het
Lpar2 T C 8: 69,824,173 V204A probably damaging Het
Lrfn4 T A 19: 4,612,640 probably null Het
Man2b2 A T 5: 36,826,058 D182E probably benign Het
Mmp27 T C 9: 7,581,155 probably benign Het
Mrm1 A G 11: 84,814,813 probably benign Het
Mtx3 T C 13: 92,850,361 S271P probably damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Necab2 A G 8: 119,470,931 D332G probably damaging Het
Ngfr A G 11: 95,574,239 I261T possibly damaging Het
Nrap T C 19: 56,357,325 E617G probably damaging Het
Obscn G T 11: 59,050,480 T4505K probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr983 A G 9: 40,092,511 Y148H probably damaging Het
Osbpl11 T A 16: 33,241,730 probably benign Het
Otof A G 5: 30,394,697 V301A probably damaging Het
Phf3 A T 1: 30,811,838 L1145Q probably damaging Het
Phospho2 T A 2: 69,796,196 I232N possibly damaging Het
Pomgnt2 T A 9: 121,982,061 K551N probably damaging Het
Ptchd3 A G 11: 121,831,158 T286A possibly damaging Het
Rnf213 A G 11: 119,441,150 D2396G probably damaging Het
Sh3pxd2b A G 11: 32,423,341 E836G possibly damaging Het
Simc1 G T 13: 54,525,655 M605I possibly damaging Het
Slc12a3 G A 8: 94,329,433 E66K possibly damaging Het
Spg11 T C 2: 122,084,983 N1060S probably benign Het
Tmem41a G T 16: 21,937,990 F126L probably benign Het
Ube2m T A 7: 13,037,626 Q35L probably benign Het
Usp33 A G 3: 152,380,574 D658G probably damaging Het
Vmn2r12 A T 5: 109,090,507 C456S probably benign Het
Vmn2r81 T A 10: 79,268,600 D352E probably damaging Het
Zfp516 A G 18: 82,987,263 Y764C probably damaging Het
Zswim7 A G 11: 62,276,647 probably benign Het
Other mutations in Supt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Supt5 APN 7 28315382 missense probably benign 0.08
IGL01077:Supt5 APN 7 28323788 nonsense probably null
IGL01477:Supt5 APN 7 28317264 missense possibly damaging 0.94
IGL01813:Supt5 APN 7 28323975 missense probably damaging 0.99
IGL02405:Supt5 APN 7 28315824 missense probably benign 0.00
IGL02525:Supt5 APN 7 28318947 splice site probably benign
IGL02584:Supt5 APN 7 28326167 missense probably benign 0.08
IGL03387:Supt5 APN 7 28320083 missense possibly damaging 0.89
R0420:Supt5 UTSW 7 28317329 splice site probably benign
R1226:Supt5 UTSW 7 28328747 missense probably benign 0.03
R1655:Supt5 UTSW 7 28330024 missense probably benign 0.00
R1801:Supt5 UTSW 7 28317214 critical splice donor site probably null
R2424:Supt5 UTSW 7 28315165 missense possibly damaging 0.47
R2883:Supt5 UTSW 7 28329320 missense possibly damaging 0.75
R4280:Supt5 UTSW 7 28317073 missense probably damaging 1.00
R4614:Supt5 UTSW 7 28325972 missense possibly damaging 0.65
R4792:Supt5 UTSW 7 28316329 missense probably benign 0.19
R4997:Supt5 UTSW 7 28316037 missense probably benign 0.05
R5041:Supt5 UTSW 7 28315380 missense probably damaging 1.00
R5062:Supt5 UTSW 7 28329015 splice site probably null
R5119:Supt5 UTSW 7 28316370 missense probably damaging 1.00
R5170:Supt5 UTSW 7 28316083 missense probably benign 0.05
R5687:Supt5 UTSW 7 28317763 missense probably benign 0.27
R5720:Supt5 UTSW 7 28322568 missense probably damaging 0.97
R5935:Supt5 UTSW 7 28329475 missense probably benign 0.09
R6032:Supt5 UTSW 7 28316175 missense probably damaging 1.00
R6032:Supt5 UTSW 7 28316175 missense probably damaging 1.00
R6049:Supt5 UTSW 7 28315197 missense probably benign 0.32
R7043:Supt5 UTSW 7 28320010 missense probably benign 0.00
R7085:Supt5 UTSW 7 28331489 missense unknown
R7152:Supt5 UTSW 7 28323900 missense probably benign 0.00
R7201:Supt5 UTSW 7 28316788 missense probably benign 0.03
R7401:Supt5 UTSW 7 28323772 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTCCCCAATCTGGAAAGAGAGAC -3'
(R):5'- TCCCATACGGGGTCAAGACACATAG -3'

Sequencing Primer
(F):5'- CAGGTGTTGGAGAGCTGACAG -3'
(R):5'- GAAGTAGAGGAAGTAAGACTCTTGTG -3'
Posted On2013-07-30