Incidental Mutation 'R7546:Mtrr'
ID 628151
Institutional Source Beutler Lab
Gene Symbol Mtrr
Ensembl Gene ENSMUSG00000034617
Gene Name 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_172480; MGI: 1891037

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7546 (G1)
Quality Score 83.0076
Status Validated
Chromosome 13
Chromosomal Location 68560780-68582149 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 68582149 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045827] [ENSMUST00000051784] [ENSMUST00000220973] [ENSMUST00000221259] [ENSMUST00000222107] [ENSMUST00000222631] [ENSMUST00000222660] [ENSMUST00000223101] [ENSMUST00000223187] [ENSMUST00000223319] [ENSMUST00000223398]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045827
SMART Domains Protein: ENSMUSP00000039810
Gene: ENSMUSG00000034617

DomainStartEndE-ValueType
Pfam:Flavodoxin_5 5 126 2.7e-9 PFAM
Pfam:Flavodoxin_1 6 142 4.3e-32 PFAM
Pfam:FAD_binding_1 267 490 2.6e-51 PFAM
Pfam:NAD_binding_1 540 660 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051784
SMART Domains Protein: ENSMUSP00000061737
Gene: ENSMUSG00000021532

DomainStartEndE-ValueType
low complexity region 178 189 N/A INTRINSIC
Pfam:FAST_1 410 478 2.9e-22 PFAM
Pfam:FAST_2 491 581 3.1e-28 PFAM
RAP 594 651 7.58e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220973
Predicted Effect probably benign
Transcript: ENSMUST00000221259
Predicted Effect probably benign
Transcript: ENSMUST00000222107
Predicted Effect probably benign
Transcript: ENSMUST00000222631
Predicted Effect probably benign
Transcript: ENSMUST00000222660
Predicted Effect probably benign
Transcript: ENSMUST00000222685
Predicted Effect probably benign
Transcript: ENSMUST00000223101
Predicted Effect probably benign
Transcript: ENSMUST00000223187
Predicted Effect probably benign
Transcript: ENSMUST00000223319
Predicted Effect probably benign
Transcript: ENSMUST00000223398
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Methionine is an essential amino acid required for protein synthesis and one-carbon metabolism. Its synthesis is catalyzed by the enzyme methionine synthase. Methionine synthase eventually becomes inactive due to the oxidation of its cob(I)alamin cofactor. The protein encoded by this gene regenerates a functional methionine synthase via reductive methylation. It is a member of the ferredoxin-NADP(+) reductase (FNR) family of electron transferases. Mutations in a similar gene in human have been associated with cblE complementation type homocystinuria-megaloblastic anemia and susceptibility to folate-sensitive neural tube defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are viable and display a male-specific reduction in postnatal weight gain as well as hyperhomocysteinemia, hypomethionemia, increased tissue methyltetrahydrofolate, and AdoMet/AdoHcy ratios that range from high to slightly below normal. [provided by MGI curators]
Allele List at MGI

All alleles(46) : Gene trapped(46)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,037,521 S36P probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Ampd1 A G 3: 103,095,712 T582A probably benign Het
Ank1 A C 8: 23,064,995 N57T probably damaging Het
Atxn3 A G 12: 101,948,002 probably null Het
Bace2 G A 16: 97,399,682 A117T probably benign Het
Bcl2l15 A G 3: 103,832,887 N19S probably benign Het
Bid C A 6: 120,900,151 probably null Het
Cadps2 A T 6: 23,626,608 M227K probably benign Het
Clip4 G A 17: 71,828,702 C483Y possibly damaging Het
D5Ertd577e C T 5: 95,482,680 R139C probably benign Het
Dennd4a A G 9: 64,873,044 T621A probably damaging Het
E2f3 G A 13: 29,910,129 S383L probably damaging Het
F2r C T 13: 95,618,350 V9I probably benign Het
Gm10424 T A 5: 95,270,312 H275L possibly damaging Het
Gm14226 T C 2: 155,025,211 S363P probably damaging Het
Gm156 T C 6: 129,772,380 H84R probably benign Het
Gstm5 T C 3: 107,897,294 Y65H probably damaging Het
H60c A G 10: 3,259,907 W127R probably damaging Het
Hist1h2bl A G 13: 21,715,870 S92P probably benign Het
Itgav G T 2: 83,776,550 G448* probably null Het
Lhx6 C T 2: 36,103,345 probably null Het
Manba T A 3: 135,570,246 V816D probably benign Het
March10 G A 11: 105,390,080 P460S not run Het
Mmp17 T A 5: 129,596,589 V244E probably damaging Het
Nup160 T C 2: 90,685,058 I170T probably damaging Het
Olfr1255 A G 2: 89,817,019 N225S probably benign Het
Olfr1255 A T 2: 89,817,194 L283F probably damaging Het
Olfr558 T C 7: 102,709,789 S177P probably damaging Het
Pappa G A 4: 65,156,115 S302N possibly damaging Het
Plekhj1 G A 10: 80,797,914 A53V possibly damaging Het
Prpf8 T C 11: 75,508,374 V2157A probably damaging Het
Rps8 G A 4: 117,153,907 R200W probably damaging Het
Sesn2 A G 4: 132,499,843 F93L probably damaging Het
Slf1 A G 13: 77,049,192 S768P probably benign Het
Stat4 A G 1: 52,098,463 N471S probably damaging Het
Trcg1 T C 9: 57,248,338 L758P probably benign Het
Trim35 A G 14: 66,303,247 T183A probably benign Het
Ttc37 C A 13: 76,134,835 L759M probably damaging Het
Ttr C A 18: 20,670,045 Y89* probably null Het
Zfp90 C A 8: 106,424,691 H345Q probably benign Het
Zmym4 A G 4: 126,864,168 V1531A probably damaging Het
Other mutations in Mtrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Mtrr APN 13 68571147 missense probably damaging 1.00
IGL01806:Mtrr APN 13 68580600 missense possibly damaging 0.92
IGL01808:Mtrr APN 13 68566093 missense probably benign 0.00
IGL01875:Mtrr APN 13 68572609 missense probably damaging 1.00
IGL02137:Mtrr APN 13 68568801 missense possibly damaging 0.75
IGL02186:Mtrr APN 13 68564357 missense probably benign
IGL03114:Mtrr APN 13 68564322 nonsense probably null
3-1:Mtrr UTSW 13 68575016 critical splice donor site probably null
H8562:Mtrr UTSW 13 68564377 missense probably damaging 0.97
N/A:Mtrr UTSW 13 68575397 splice site probably benign
R0007:Mtrr UTSW 13 68575330 missense probably benign 0.02
R0741:Mtrr UTSW 13 68579539 splice site probably null
R2140:Mtrr UTSW 13 68568940 missense possibly damaging 0.47
R2513:Mtrr UTSW 13 68566973 nonsense probably null
R4604:Mtrr UTSW 13 68564512 splice site probably null
R5501:Mtrr UTSW 13 68579647 missense probably damaging 1.00
R5658:Mtrr UTSW 13 68568915 missense possibly damaging 0.67
R6477:Mtrr UTSW 13 68570073 missense probably damaging 1.00
R6694:Mtrr UTSW 13 68564333 missense probably benign
R6979:Mtrr UTSW 13 68570003 critical splice donor site probably null
R7094:Mtrr UTSW 13 68579684 missense possibly damaging 0.83
R7296:Mtrr UTSW 13 68568860 nonsense probably null
R7354:Mtrr UTSW 13 68566207 missense probably damaging 1.00
R7378:Mtrr UTSW 13 68564402 missense probably damaging 1.00
R7562:Mtrr UTSW 13 68566217 missense probably damaging 0.96
R7759:Mtrr UTSW 13 68570027 missense probably damaging 1.00
R7975:Mtrr UTSW 13 68579547 splice site probably null
R8101:Mtrr UTSW 13 68577621 missense probably damaging 1.00
R8168:Mtrr UTSW 13 68572613 missense probably benign 0.00
R9097:Mtrr UTSW 13 68575322 missense probably benign 0.28
R9260:Mtrr UTSW 13 68580555 missense possibly damaging 0.70
R9295:Mtrr UTSW 13 68571139 missense possibly damaging 0.94
R9516:Mtrr UTSW 13 68572636 missense probably benign 0.00
R9517:Mtrr UTSW 13 68580611 missense probably benign 0.06
R9627:Mtrr UTSW 13 68577637 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACGAGGTTTTGGGAAAGG -3'
(R):5'- ATCCCGAGACACTTACCGAG -3'

Sequencing Primer
(F):5'- AAGTGCTCCCCGTGAACC -3'
(R):5'- AGACACTTACCGAGCGGCTC -3'
Posted On 2020-01-24