Incidental Mutation 'R7552:Vmn2r88'
ID628153
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Namevomeronasal 2, receptor 88
SynonymsV2r3, V2r13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R7552 (G1)
Quality Score173.009
Status Validated
Chromosome14
Chromosomal Location51410819-51419527 bp(+) (GRCm38)
Type of Mutationsplice site (45396 bp from exon)
DNA Base Change (assembly) A to T at 51410858 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
Predicted Effect probably benign
Transcript: ENSMUST00000022438
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159674
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163019
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228139
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a A G 10: 80,583,903 Y290H probably benign Het
Aco2 T C 15: 81,903,941 V257A probably damaging Het
Adam26a C A 8: 43,569,970 C161F possibly damaging Het
Adam9 G A 8: 24,955,972 P820S unknown Het
Adcy4 G A 14: 55,773,465 T665M probably benign Het
AF529169 T A 9: 89,601,835 H503L probably benign Het
Ahnak T A 19: 9,006,824 M1824K probably benign Het
Alpi T C 1: 87,099,073 N428D probably benign Het
Ano5 C T 7: 51,546,780 P153L probably benign Het
Atp1a1 A T 3: 101,582,121 L725* probably null Het
Atp8b2 G A 3: 89,946,764 T595I probably damaging Het
Ccdc66 T C 14: 27,498,863 I35V possibly damaging Het
Cd163 A G 6: 124,307,228 T120A probably benign Het
Cmah A T 13: 24,456,955 T396S possibly damaging Het
Cmya5 C T 13: 93,069,312 V3350I probably benign Het
Commd9 A C 2: 101,901,065 K198N probably damaging Het
Cxcr1 A G 1: 74,192,614 V83A probably benign Het
D630045J12Rik A G 6: 38,148,448 S1544P probably damaging Het
Ddt A T 10: 75,773,214 probably null Het
Depdc7 A G 2: 104,727,240 S222P possibly damaging Het
Ehd2 A G 7: 15,950,506 I456T probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Esr1 G A 10: 4,856,903 R273H probably damaging Het
Fras1 G A 5: 96,768,438 D3444N probably damaging Het
Gm7682 G A 5: 94,448,535 C477Y probably damaging Het
Hand2 A G 8: 57,322,237 R111G probably damaging Het
Hecw1 A T 13: 14,316,250 V306E probably damaging Het
Ift140 T C 17: 25,033,115 I312T probably benign Het
Ikbke A T 1: 131,272,150 L257* probably null Het
Kcnk5 G A 14: 20,142,281 P271S probably benign Het
Lama1 T C 17: 67,737,667 V187A Het
Lemd2 A T 17: 27,193,836 probably null Het
Lig3 T A 11: 82,788,891 D341E probably benign Het
Lpcat1 C T 13: 73,494,895 S196L probably damaging Het
Lrp1b A T 2: 40,677,570 D4048E Het
Lrrfip1 G A 1: 91,105,283 E158K probably damaging Het
Mcm5 T C 8: 75,121,592 S490P probably damaging Het
Mia3 A C 1: 183,365,695 Y73* probably null Het
Msr1 A T 8: 39,623,962 N202K probably benign Het
N4bp2l2 A T 5: 150,661,821 Y231* probably null Het
Nbeal2 A G 9: 110,653,917 W11R probably benign Het
Ncor1 T C 11: 62,373,424 E384G possibly damaging Het
Neb A G 2: 52,247,190 V254A Het
Nlrp9b T C 7: 20,045,766 S785P probably benign Het
Olfr1024 A G 2: 85,904,103 V317A probably benign Het
Olfr1191-ps1 A G 2: 88,643,408 I214V probably benign Het
Olfr1258 G T 2: 89,930,720 D304Y probably benign Het
Olfr2 T C 7: 107,001,327 T178A probably benign Het
Olfr791 T A 10: 129,526,560 F111Y possibly damaging Het
Oprd1 T G 4: 132,113,781 I289L possibly damaging Het
Orc1 A G 4: 108,588,754 N23S probably benign Het
Paip1 A T 13: 119,440,820 H149L possibly damaging Het
Pdhx A T 2: 103,046,754 D103E probably benign Het
Pi4ka T C 16: 17,291,216 Y1614C Het
Pias3 ACC AC 3: 96,701,385 probably null Het
Pigb A G 9: 73,034,488 V163A probably benign Het
Pla2g4d A G 2: 120,284,139 I37T possibly damaging Het
Ppfia1 A T 7: 144,506,245 V610D probably damaging Het
Prss1 T C 6: 41,462,573 V80A probably benign Het
Psph G A 5: 129,770,736 R49W probably benign Het
Qrich2 T C 11: 116,456,254 Y1248C possibly damaging Het
Rlbp1 T A 7: 79,380,113 Y124F probably damaging Het
Scn4a T A 11: 106,349,169 E74V probably benign Het
Sdk2 A T 11: 113,873,213 I249N possibly damaging Het
Sgsh A T 11: 119,346,552 L412Q probably damaging Het
Shank1 C A 7: 44,353,028 D1390E probably benign Het
Slc12a6 A G 2: 112,341,974 D421G probably damaging Het
Snx29 T A 16: 11,420,785 probably null Het
Spata31d1c A G 13: 65,036,123 Y493C probably damaging Het
Stmn4 G A 14: 66,356,278 G40E probably damaging Het
Stox2 A G 8: 47,203,119 probably null Het
Strada T C 11: 106,187,004 S45G unknown Het
Taco1 G A 11: 106,071,948 G154S probably benign Het
Tas2r121 T C 6: 132,700,542 M156V probably benign Het
Tbc1d31 A G 15: 57,940,740 S384G probably benign Het
Tbc1d9 A T 8: 83,239,931 D387V probably damaging Het
Tet3 A G 6: 83,368,307 L1716P probably damaging Het
Thbs1 A G 2: 118,113,362 K154E possibly damaging Het
Ush2a T C 1: 188,267,044 Y184H possibly damaging Het
Vmn1r235 C A 17: 21,261,451 Q13K probably benign Het
Vmn2r15 A T 5: 109,292,908 Y361* probably null Het
Vps54 T C 11: 21,298,831 V460A probably benign Het
Wdr64 A G 1: 175,785,581 N674S possibly damaging Het
Zfp592 A G 7: 81,023,642 D118G probably benign Het
Zfp763 A G 17: 33,018,651 Y507H probably benign Het
Zfp934 T C 13: 62,492,891 E16G probably damaging Het
Zfyve26 G A 12: 79,290,957 L94F probably damaging Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51413125 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413060 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413256 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51416802 missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51417980 missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51414154 missense probably benign
IGL02483:Vmn2r88 APN 14 51414154 missense probably benign
IGL03241:Vmn2r88 APN 14 51418373 missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51418700 missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51414140 missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51414502 missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51418209 missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51414108 missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51418550 missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51416787 missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51418572 missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51413030 splice site probably benign
R1911:Vmn2r88 UTSW 14 51418214 missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51418194 missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51413208 missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51413807 missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51414004 missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51418689 missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51413934 missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51418632 missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51413978 missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51413190 missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51415426 missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51413289 nonsense probably null
R4397:Vmn2r88 UTSW 14 51417978 missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51418081 missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51418074 missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51418793 missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51418155 missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51413334 missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51413339 missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51413245 missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51413181 missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51411146 missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51413910 missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51418572 missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51418149 nonsense probably null
R6103:Vmn2r88 UTSW 14 51415369 missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51414338 missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51413969 missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51418643 missense
R7104:Vmn2r88 UTSW 14 51413796 missense
R7265:Vmn2r88 UTSW 14 51418319 missense
R7316:Vmn2r88 UTSW 14 51414255 missense
R7611:Vmn2r88 UTSW 14 51413997 missense
R7667:Vmn2r88 UTSW 14 51417989 missense
R7682:Vmn2r88 UTSW 14 51418449 missense
R7755:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51418703 missense
R7882:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7957:Vmn2r88 UTSW 14 51413132 missense
R7998:Vmn2r88 UTSW 14 51414108 missense
R8142:Vmn2r88 UTSW 14 51414107 missense
R8186:Vmn2r88 UTSW 14 51418700 missense
R8348:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51413073 missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51414066 missense
R8859:Vmn2r88 UTSW 14 51418806 missense probably damaging 0.97
R8916:Vmn2r88 UTSW 14 51411136 missense
R8936:Vmn2r88 UTSW 14 51418526 missense possibly damaging 0.88
V5622:Vmn2r88 UTSW 14 51413127 missense probably benign
X0024:Vmn2r88 UTSW 14 51413832 missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51416802 missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51418046 frame shift probably null
Z1177:Vmn2r88 UTSW 14 51418187 missense
Z1190:Vmn2r88 UTSW 14 51413201 missense
Predicted Primers PCR Primer
(F):5'- TGCAGGAGAAAACTGTCCTTGG -3'
(R):5'- TTCAGTCAAACAGCACAAGATGAG -3'

Sequencing Primer
(F):5'- AGAAAACTGTCCTTGGGATTTTTGC -3'
(R):5'- CAGCACAAGATGAGAGAAAACTTC -3'
Posted On2020-01-24