Incidental Mutation 'R7552:Vmn2r88'
ID 628153
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Name vomeronasal 2, receptor 88
Synonyms V2r13, V2r3
MMRRC Submission 045621-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R7552 (G1)
Quality Score 173.009
Status Validated
Chromosome 14
Chromosomal Location 51648458-51656984 bp(+) (GRCm39)
Type of Mutation splice site (45396 bp from exon)
DNA Base Change (assembly) A to T at 51648315 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
AlphaFold L7N1W8
Predicted Effect probably benign
Transcript: ENSMUST00000022438
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159674
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163019
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228139
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a A G 10: 80,419,737 (GRCm39) Y290H probably benign Het
Aco2 T C 15: 81,788,142 (GRCm39) V257A probably damaging Het
Adam26a C A 8: 44,023,007 (GRCm39) C161F possibly damaging Het
Adam9 G A 8: 25,445,988 (GRCm39) P820S unknown Het
Adcy4 G A 14: 56,010,922 (GRCm39) T665M probably benign Het
Ahnak T A 19: 8,984,188 (GRCm39) M1824K probably benign Het
Alpi T C 1: 87,026,795 (GRCm39) N428D probably benign Het
Ano5 C T 7: 51,196,528 (GRCm39) P153L probably benign Het
Atp1a1 A T 3: 101,489,437 (GRCm39) L725* probably null Het
Atp8b2 G A 3: 89,854,071 (GRCm39) T595I probably damaging Het
Ccdc66 T C 14: 27,220,820 (GRCm39) I35V possibly damaging Het
Cd163 A G 6: 124,284,187 (GRCm39) T120A probably benign Het
Cmah A T 13: 24,640,938 (GRCm39) T396S possibly damaging Het
Cmya5 C T 13: 93,205,820 (GRCm39) V3350I probably benign Het
Commd9 A C 2: 101,731,410 (GRCm39) K198N probably damaging Het
Cxcr1 A G 1: 74,231,773 (GRCm39) V83A probably benign Het
D630045J12Rik A G 6: 38,125,383 (GRCm39) S1544P probably damaging Het
Ddt A T 10: 75,609,048 (GRCm39) probably null Het
Depdc7 A G 2: 104,557,585 (GRCm39) S222P possibly damaging Het
Ehd2 A G 7: 15,684,431 (GRCm39) I456T probably damaging Het
Epas1 A T 17: 87,136,471 (GRCm39) M748L probably benign Het
Esr1 G A 10: 4,806,903 (GRCm39) R273H probably damaging Het
Fras1 G A 5: 96,916,297 (GRCm39) D3444N probably damaging Het
Hand2 A G 8: 57,775,272 (GRCm39) R111G probably damaging Het
Hecw1 A T 13: 14,490,835 (GRCm39) V306E probably damaging Het
Ift140 T C 17: 25,252,089 (GRCm39) I312T probably benign Het
Ikbke A T 1: 131,199,887 (GRCm39) L257* probably null Het
Kcnk5 G A 14: 20,192,349 (GRCm39) P271S probably benign Het
Lama1 T C 17: 68,044,662 (GRCm39) V187A Het
Lemd2 A T 17: 27,412,810 (GRCm39) probably null Het
Lig3 T A 11: 82,679,717 (GRCm39) D341E probably benign Het
Lpcat1 C T 13: 73,643,014 (GRCm39) S196L probably damaging Het
Lrp1b A T 2: 40,567,582 (GRCm39) D4048E Het
Lrrfip1 G A 1: 91,033,005 (GRCm39) E158K probably damaging Het
Mcm5 T C 8: 75,848,220 (GRCm39) S490P probably damaging Het
Mia3 A C 1: 183,147,036 (GRCm39) Y73* probably null Het
Minar1 T A 9: 89,483,888 (GRCm39) H503L probably benign Het
Msr1 A T 8: 40,077,003 (GRCm39) N202K probably benign Het
N4bp2l2 A T 5: 150,585,286 (GRCm39) Y231* probably null Het
Nbeal2 A G 9: 110,482,985 (GRCm39) W11R probably benign Het
Ncor1 T C 11: 62,264,250 (GRCm39) E384G possibly damaging Het
Neb A G 2: 52,137,202 (GRCm39) V254A Het
Nlrp9b T C 7: 19,779,691 (GRCm39) S785P probably benign Het
Oprd1 T G 4: 131,841,092 (GRCm39) I289L possibly damaging Het
Or4c10 G T 2: 89,761,064 (GRCm39) D304Y probably benign Het
Or4s2 A G 2: 88,473,752 (GRCm39) I214V probably benign Het
Or5m12 A G 2: 85,734,447 (GRCm39) V317A probably benign Het
Or6a2 T C 7: 106,600,534 (GRCm39) T178A probably benign Het
Or6c2 T A 10: 129,362,429 (GRCm39) F111Y possibly damaging Het
Orc1 A G 4: 108,445,951 (GRCm39) N23S probably benign Het
Paip1 A T 13: 119,577,356 (GRCm39) H149L possibly damaging Het
Pdhx A T 2: 102,877,099 (GRCm39) D103E probably benign Het
Pi4ka T C 16: 17,109,080 (GRCm39) Y1614C Het
Pias3 ACC AC 3: 96,608,701 (GRCm39) probably null Het
Pigb A G 9: 72,941,770 (GRCm39) V163A probably benign Het
Pla2g4d A G 2: 120,114,620 (GRCm39) I37T possibly damaging Het
Ppfia1 A T 7: 144,059,982 (GRCm39) V610D probably damaging Het
Pramel41 G A 5: 94,596,394 (GRCm39) C477Y probably damaging Het
Prss1 T C 6: 41,439,507 (GRCm39) V80A probably benign Het
Psph G A 5: 129,847,800 (GRCm39) R49W probably benign Het
Qrich2 T C 11: 116,347,080 (GRCm39) Y1248C possibly damaging Het
Rlbp1 T A 7: 79,029,861 (GRCm39) Y124F probably damaging Het
Scn4a T A 11: 106,239,995 (GRCm39) E74V probably benign Het
Sdk2 A T 11: 113,764,039 (GRCm39) I249N possibly damaging Het
Sgsh A T 11: 119,237,378 (GRCm39) L412Q probably damaging Het
Shank1 C A 7: 44,002,452 (GRCm39) D1390E probably benign Het
Slc12a6 A G 2: 112,172,319 (GRCm39) D421G probably damaging Het
Snx29 T A 16: 11,238,649 (GRCm39) probably null Het
Spata31d1c A G 13: 65,183,937 (GRCm39) Y493C probably damaging Het
Stmn4 G A 14: 66,593,727 (GRCm39) G40E probably damaging Het
Stox2 A G 8: 47,656,154 (GRCm39) probably null Het
Strada T C 11: 106,077,830 (GRCm39) S45G unknown Het
Taco1 G A 11: 105,962,774 (GRCm39) G154S probably benign Het
Tas2r121 T C 6: 132,677,505 (GRCm39) M156V probably benign Het
Tbc1d31 A G 15: 57,804,136 (GRCm39) S384G probably benign Het
Tbc1d9 A T 8: 83,966,560 (GRCm39) D387V probably damaging Het
Tet3 A G 6: 83,345,289 (GRCm39) L1716P probably damaging Het
Thbs1 A G 2: 117,943,843 (GRCm39) K154E possibly damaging Het
Ush2a T C 1: 187,999,241 (GRCm39) Y184H possibly damaging Het
Vmn1r235 C A 17: 21,481,713 (GRCm39) Q13K probably benign Het
Vmn2r15 A T 5: 109,440,774 (GRCm39) Y361* probably null Het
Vps54 T C 11: 21,248,831 (GRCm39) V460A probably benign Het
Wdr64 A G 1: 175,613,147 (GRCm39) N674S possibly damaging Het
Zfp592 A G 7: 80,673,390 (GRCm39) D118G probably benign Het
Zfp763 A G 17: 33,237,625 (GRCm39) Y507H probably benign Het
Zfp934 T C 13: 62,640,705 (GRCm39) E16G probably damaging Het
Zfyve26 G A 12: 79,337,731 (GRCm39) L94F probably damaging Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51,650,713 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,650,517 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,650,582 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,654,259 (GRCm39) missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51,655,437 (GRCm39) missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51,651,611 (GRCm39) missense probably benign
IGL02483:Vmn2r88 APN 14 51,651,611 (GRCm39) missense probably benign
IGL03241:Vmn2r88 APN 14 51,655,830 (GRCm39) missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51,656,157 (GRCm39) missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51,651,597 (GRCm39) missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51,651,959 (GRCm39) missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51,655,666 (GRCm39) missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51,651,565 (GRCm39) missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51,656,007 (GRCm39) missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51,654,244 (GRCm39) missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51,656,029 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51,650,487 (GRCm39) splice site probably benign
R1911:Vmn2r88 UTSW 14 51,655,671 (GRCm39) missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51,655,651 (GRCm39) missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51,650,665 (GRCm39) missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51,651,264 (GRCm39) missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51,651,461 (GRCm39) missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51,656,146 (GRCm39) missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51,651,391 (GRCm39) missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51,656,089 (GRCm39) missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51,651,435 (GRCm39) missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51,650,647 (GRCm39) missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51,652,883 (GRCm39) missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51,650,746 (GRCm39) nonsense probably null
R4397:Vmn2r88 UTSW 14 51,655,435 (GRCm39) missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51,655,538 (GRCm39) missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51,655,531 (GRCm39) missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51,656,250 (GRCm39) missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51,655,612 (GRCm39) missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51,650,791 (GRCm39) missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51,650,796 (GRCm39) missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51,650,702 (GRCm39) missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51,650,638 (GRCm39) missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51,648,603 (GRCm39) missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51,651,367 (GRCm39) missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51,656,029 (GRCm39) missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51,655,606 (GRCm39) nonsense probably null
R6103:Vmn2r88 UTSW 14 51,652,826 (GRCm39) missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51,651,795 (GRCm39) missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51,651,426 (GRCm39) missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51,656,100 (GRCm39) missense
R7104:Vmn2r88 UTSW 14 51,651,253 (GRCm39) missense
R7265:Vmn2r88 UTSW 14 51,655,776 (GRCm39) missense
R7316:Vmn2r88 UTSW 14 51,651,712 (GRCm39) missense
R7611:Vmn2r88 UTSW 14 51,651,454 (GRCm39) missense
R7667:Vmn2r88 UTSW 14 51,655,446 (GRCm39) missense
R7682:Vmn2r88 UTSW 14 51,655,906 (GRCm39) missense
R7755:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51,656,160 (GRCm39) missense
R7882:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R7957:Vmn2r88 UTSW 14 51,650,589 (GRCm39) missense
R7998:Vmn2r88 UTSW 14 51,651,565 (GRCm39) missense
R8142:Vmn2r88 UTSW 14 51,651,564 (GRCm39) missense
R8186:Vmn2r88 UTSW 14 51,656,157 (GRCm39) missense
R8348:Vmn2r88 UTSW 14 51,656,253 (GRCm39) missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51,656,253 (GRCm39) missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51,650,530 (GRCm39) missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51,651,523 (GRCm39) missense
R8859:Vmn2r88 UTSW 14 51,656,263 (GRCm39) missense probably damaging 0.97
R8916:Vmn2r88 UTSW 14 51,648,593 (GRCm39) missense
R8936:Vmn2r88 UTSW 14 51,655,983 (GRCm39) missense possibly damaging 0.88
R9004:Vmn2r88 UTSW 14 51,650,624 (GRCm39) missense
R9038:Vmn2r88 UTSW 14 51,651,490 (GRCm39) missense
R9063:Vmn2r88 UTSW 14 51,648,329 (GRCm39) start gained probably benign
R9311:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R9382:Vmn2r88 UTSW 14 51,656,197 (GRCm39) missense
R9483:Vmn2r88 UTSW 14 51,648,641 (GRCm39) missense
R9602:Vmn2r88 UTSW 14 51,651,189 (GRCm39) missense
V5622:Vmn2r88 UTSW 14 51,650,584 (GRCm39) missense probably benign
X0024:Vmn2r88 UTSW 14 51,651,289 (GRCm39) missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51,654,259 (GRCm39) missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51,655,644 (GRCm39) missense
Z1177:Vmn2r88 UTSW 14 51,655,503 (GRCm39) frame shift probably null
Z1190:Vmn2r88 UTSW 14 51,650,658 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGCAGGAGAAAACTGTCCTTGG -3'
(R):5'- TTCAGTCAAACAGCACAAGATGAG -3'

Sequencing Primer
(F):5'- AGAAAACTGTCCTTGGGATTTTTGC -3'
(R):5'- CAGCACAAGATGAGAGAAAACTTC -3'
Posted On 2020-01-24