Incidental Mutation 'R7583:Lrrc31'
ID628158
Institutional Source Beutler Lab
Gene Symbol Lrrc31
Ensembl Gene ENSMUSG00000074653
Gene Nameleucine rich repeat containing 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7583 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location30679058-30699843 bp(-) (GRCm38)
Type of Mutationintron (58 bp from exon)
DNA Base Change (assembly) T to C at 30691099 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108263] [ENSMUST00000126658]
Predicted Effect probably null
Transcript: ENSMUST00000108263
SMART Domains Protein: ENSMUSP00000103898
Gene: ENSMUSG00000074653

DomainStartEndE-ValueType
LRR 92 119 4.5e-2 SMART
Blast:LRR 148 175 1e-8 BLAST
LRR 176 203 2.6e-1 SMART
LRR 204 231 6.7e-2 SMART
LRR 260 287 1e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126658
SMART Domains Protein: ENSMUSP00000120802
Gene: ENSMUSG00000074653

DomainStartEndE-ValueType
LRR 92 119 4.4e-2 SMART
Blast:LRR 148 175 2e-8 BLAST
LRR 176 203 2.5e-1 SMART
LRR 204 231 6.5e-2 SMART
LRR 260 287 9.9e-2 SMART
Pfam:LRR_6 288 307 8.2e-1 PFAM
LRR 372 399 8e-3 SMART
LRR 402 430 2.7e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (95/96)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,739,326 D462V probably damaging Het
Abcc1 T C 16: 14,404,038 W222R probably damaging Het
Adamts13 A G 2: 26,973,953 K48E probably benign Het
Adgrd1 A C 5: 129,179,588 T674P probably benign Het
Agbl4 A T 4: 111,118,953 Y169F possibly damaging Het
Ahnak T A 19: 9,006,093 N1580K possibly damaging Het
Angptl8 A C 9: 21,835,914 probably null Het
Ap3d1 G A 10: 80,709,458 T1053I probably benign Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Bdp1 T A 13: 100,049,812 T1711S probably damaging Het
Bod1l T C 5: 41,833,790 I141V probably damaging Het
Cavin2 A T 1: 51,289,618 N78I possibly damaging Het
Ccnb1 T C 13: 100,779,754 H406R probably benign Het
Cd200r4 A G 16: 44,833,421 T194A probably damaging Het
Cdt1 G A 8: 122,570,256 R263H probably damaging Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Clasp2 A G 9: 113,908,687 D1043G probably benign Het
Cmip A T 8: 117,454,952 N578I probably damaging Het
Col2a1 T G 15: 97,976,184 K1440N unknown Het
Cpne2 A T 8: 94,555,581 M252L probably benign Het
Crb2 A G 2: 37,790,595 T512A probably benign Het
Csmd1 A G 8: 15,998,833 Y2290H probably damaging Het
Ctnnd1 A T 2: 84,612,061 D642E probably damaging Het
Ctns A G 11: 73,188,470 S141P probably benign Het
Cwh43 A G 5: 73,434,289 Q575R probably benign Het
Cyp2b19 C A 7: 26,759,064 T68K probably damaging Het
Dcaf6 A G 1: 165,333,310 S849P probably damaging Het
Dnm3 T A 1: 162,477,774 Q17L possibly damaging Het
Enpp3 A T 10: 24,836,092 M1K probably null Het
Fam124a T A 14: 62,606,559 C505* probably null Het
Fam160b1 T A 19: 57,378,602 D192E probably benign Het
Fsip2 A G 2: 82,975,241 I635V probably benign Het
Gm5878 A T 6: 85,118,700 probably null Het
Gm6205 A T 5: 94,682,894 T84S possibly damaging Het
Gpld1 C A 13: 24,975,760 A437D probably damaging Het
Grk5 G T 19: 61,083,204 V401L possibly damaging Het
Gucy2g A T 19: 55,235,615 L259Q probably damaging Het
Habp2 T A 19: 56,311,804 D191E probably benign Het
Helz2 T A 2: 181,237,572 H751L probably benign Het
Hgsnat A G 8: 25,971,564 probably null Het
Hivep1 T A 13: 42,164,240 V2064E probably damaging Het
Ikbke C T 1: 131,276,479 A26T probably damaging Het
Ivd C A 2: 118,862,131 D37E probably damaging Het
Kif26b G A 1: 178,530,445 W40* probably null Het
Klrc2 A G 6: 129,659,311 S114P probably damaging Het
Lama1 A T 17: 67,761,621 T772S Het
Lamc1 T A 1: 153,243,232 K880N possibly damaging Het
Lmf1 G A 17: 25,655,449 D12N Het
Lpin2 G T 17: 71,231,396 E384* probably null Het
Lrrc23 T C 6: 124,779,578 probably benign Het
Luc7l2 A G 6: 38,551,885 Q13R probably damaging Het
Ly6c1 G T 15: 75,048,497 H5Q probably damaging Het
Lyst A T 13: 13,635,887 H714L probably damaging Het
Man2a2 C T 7: 80,366,944 R374H probably damaging Het
Mchr1 A T 15: 81,237,441 T131S probably benign Het
Msto1 T C 3: 88,912,929 probably null Het
Myh1 C T 11: 67,220,913 T1698I probably benign Het
Ncapd3 G T 9: 27,071,848 C964F probably damaging Het
Nefh T C 11: 4,941,089 E510G probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1513 T C 14: 52,349,903 T48A possibly damaging Het
Olfr357 A C 2: 36,997,080 K90T probably damaging Het
Olfr362 A T 2: 37,105,527 L41* probably null Het
Olfr538 A G 7: 140,574,210 E19G probably benign Het
P4ha1 T A 10: 59,369,640 S497R probably benign Het
Palb2 T C 7: 122,127,342 D435G probably benign Het
Papola C T 12: 105,811,045 P282L probably damaging Het
Pcdhgb1 A G 18: 37,682,324 R623G probably damaging Het
Pcolce T G 5: 137,607,445 K229Q probably benign Het
Pkhd1l1 T C 15: 44,568,364 probably null Het
Ppp6r3 T A 19: 3,490,790 T443S probably benign Het
Psg20 T A 7: 18,682,483 D236V probably damaging Het
Ptgr2 T G 12: 84,308,405 S304R probably damaging Het
Ptpn22 A T 3: 103,902,114 D681V probably benign Het
Rab3gap1 T C 1: 127,930,875 S574P probably benign Het
Slc36a1 A G 11: 55,213,928 probably null Het
Slc9a5 A G 8: 105,363,272 S621G possibly damaging Het
Sntg1 A G 1: 8,445,025 probably null Het
Snx17 A G 5: 31,196,533 N222D possibly damaging Het
Spata19 G T 9: 27,400,433 S116I possibly damaging Het
Spn G A 7: 127,137,062 A91V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
St7 A T 6: 17,942,754 T575S possibly damaging Het
Taf2 A T 15: 55,064,676 Y110* probably null Het
Tcf20 T C 15: 82,855,276 E658G possibly damaging Het
Tdrd6 G T 17: 43,624,238 A1973E probably benign Het
Tg T G 15: 66,764,418 L2237W probably damaging Het
Ticrr C A 7: 79,696,739 Y1882* probably null Het
Trim45 T A 3: 100,925,023 C191S probably damaging Het
Upf3a G A 8: 13,785,889 probably null Het
Vmn2r42 A T 7: 8,194,741 L293* probably null Het
Vmn2r62 T A 7: 42,788,042 Q339H possibly damaging Het
Wdr24 A T 17: 25,825,830 R220W probably null Het
Wdr5 T A 2: 27,518,775 S22T probably benign Het
Zfp37 G A 4: 62,192,016 probably benign Het
Zfp735 A T 11: 73,711,107 L292F possibly damaging Het
Zfp985 T A 4: 147,583,489 C271* probably null Het
Zranb1 G A 7: 132,983,896 R691Q probably benign Het
Other mutations in Lrrc31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03110:Lrrc31 APN 3 30679266 missense probably benign 0.04
R0285:Lrrc31 UTSW 3 30684948 missense probably benign 0.02
R0348:Lrrc31 UTSW 3 30689228 missense probably benign 0.14
R0418:Lrrc31 UTSW 3 30689234 missense probably damaging 1.00
R0453:Lrrc31 UTSW 3 30687525 missense probably damaging 1.00
R0613:Lrrc31 UTSW 3 30685035 splice site probably benign
R2243:Lrrc31 UTSW 3 30685030 splice site probably benign
R2248:Lrrc31 UTSW 3 30689901 missense possibly damaging 0.95
R4093:Lrrc31 UTSW 3 30695522 missense probably damaging 1.00
R4781:Lrrc31 UTSW 3 30687377 intron probably benign
R4805:Lrrc31 UTSW 3 30691297 nonsense probably null
R4835:Lrrc31 UTSW 3 30679157 missense probably damaging 0.97
R4893:Lrrc31 UTSW 3 30679297 missense probably benign 0.02
R4936:Lrrc31 UTSW 3 30689268 missense probably damaging 1.00
R5063:Lrrc31 UTSW 3 30689936 missense possibly damaging 0.78
R5135:Lrrc31 UTSW 3 30684890 nonsense probably null
R5527:Lrrc31 UTSW 3 30691228 missense probably damaging 1.00
R5607:Lrrc31 UTSW 3 30689845 splice site probably null
R5608:Lrrc31 UTSW 3 30689845 splice site probably null
R5611:Lrrc31 UTSW 3 30691155 critical splice donor site probably null
R5865:Lrrc31 UTSW 3 30679140 missense probably benign 0.01
R6001:Lrrc31 UTSW 3 30691169 missense possibly damaging 0.68
X0027:Lrrc31 UTSW 3 30689279 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGCCCAGTTGTGCACATAAAC -3'
(R):5'- TTTCCTGGAACGATTTTGCCAG -3'

Sequencing Primer
(F):5'- AATAACCTCTAGTTTGGTCCTTCAGG -3'
(R):5'- CACTGAGGACGTTCAAAC -3'
Posted On2020-01-28