Incidental Mutation 'R7608:Fan1'
ID628163
Institutional Source Beutler Lab
Gene Symbol Fan1
Ensembl Gene ENSMUSG00000033458
Gene NameFANCD2/FANCI-associated nuclease 1
SynonymsMtmr15
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7608 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location64346758-64374095 bp(-) (GRCm38)
Type of Mutationintron (140 bp from exon)
DNA Base Change (assembly) A to T at 64354231 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163289]
Predicted Effect probably null
Transcript: ENSMUST00000163289
SMART Domains Protein: ENSMUSP00000130012
Gene: ENSMUSG00000033458

DomainStartEndE-ValueType
SCOP:d1ihga1 600 737 5e-5 SMART
Blast:VRR_NUC 834 867 2e-12 BLAST
VRR_NUC 896 1011 1.99e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene plays a role in DNA interstrand cross-link repair and encodes a protein with 5' flap endonuclease and 5'-3' exonuclease activity. Mutations in this gene cause karyomegalic interstitial nephritis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for mutations in this gene display renal tubular karyomegaly with polyploidy and defects in interstrand cross-link DNA repair. Some homozygous mice also display hepatocyte karyomegaly and liver dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,177,703 F311S probably benign Het
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Akr1b7 A G 6: 34,420,522 N273S probably damaging Het
Asz1 G A 6: 18,077,253 T151M probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Galns A G 8: 122,591,445 F410S probably benign Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Lrrc49 C T 9: 60,602,722 G488S probably null Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1252 A G 2: 89,721,298 V271A probably benign Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Olfr924 T A 9: 38,848,510 V132D possibly damaging Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scg2 T C 1: 79,436,181 E275G probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc16a4 A T 3: 107,303,127 Y371F probably damaging Het
Slc4a1ap T A 5: 31,536,189 M489K possibly damaging Het
Spata13 A G 14: 60,692,507 N505D possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Txlnb A G 10: 17,815,398 K232R probably damaging Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Fan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Fan1 APN 7 64372549 missense probably damaging 0.96
IGL01752:Fan1 APN 7 64372794 missense probably benign 0.00
IGL01971:Fan1 APN 7 64353711 missense probably damaging 0.98
IGL02043:Fan1 APN 7 64371619 unclassified probably null
IGL02542:Fan1 APN 7 64364660 missense probably damaging 1.00
IGL02731:Fan1 APN 7 64372993 missense possibly damaging 0.86
IGL03111:Fan1 APN 7 64350068 missense possibly damaging 0.67
hitched UTSW 7 64364629 missense probably damaging 1.00
stitched UTSW 7 64372486 missense probably damaging 0.97
R0270:Fan1 UTSW 7 64348871 missense probably benign 0.26
R0632:Fan1 UTSW 7 64363199 missense possibly damaging 0.50
R1714:Fan1 UTSW 7 64366687 missense probably benign 0.29
R1750:Fan1 UTSW 7 64373013 missense probably benign 0.14
R1822:Fan1 UTSW 7 64372806 missense probably benign 0.00
R2031:Fan1 UTSW 7 64354424 missense probably damaging 0.98
R2107:Fan1 UTSW 7 64366788 missense probably damaging 1.00
R2126:Fan1 UTSW 7 64346888 missense probably damaging 1.00
R2869:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2869:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2870:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2870:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2871:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2871:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2873:Fan1 UTSW 7 64363190 missense probably benign 0.16
R3849:Fan1 UTSW 7 64372371 missense probably damaging 1.00
R3850:Fan1 UTSW 7 64372371 missense probably damaging 1.00
R3949:Fan1 UTSW 7 64371544 nonsense probably null
R4007:Fan1 UTSW 7 64366561 missense probably damaging 1.00
R4490:Fan1 UTSW 7 64369180 missense possibly damaging 0.84
R4623:Fan1 UTSW 7 64373553 nonsense probably null
R4918:Fan1 UTSW 7 64373538 utr 5 prime probably benign
R5328:Fan1 UTSW 7 64354469 missense probably damaging 1.00
R5691:Fan1 UTSW 7 64354370 unclassified probably null
R5902:Fan1 UTSW 7 64373322 unclassified probably null
R5905:Fan1 UTSW 7 64353651 missense probably benign 0.00
R6126:Fan1 UTSW 7 64364570 nonsense probably null
R6195:Fan1 UTSW 7 64354371 missense probably damaging 1.00
R6233:Fan1 UTSW 7 64354371 missense probably damaging 1.00
R6405:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6434:Fan1 UTSW 7 64354381 missense probably damaging 0.99
R6460:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6469:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6471:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6473:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6696:Fan1 UTSW 7 64350078 missense probably damaging 1.00
R6708:Fan1 UTSW 7 64372806 missense probably benign 0.00
R6713:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6714:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6749:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6841:Fan1 UTSW 7 64364629 missense probably damaging 1.00
R6858:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6859:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6860:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6925:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6927:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6936:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6938:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6939:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7040:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7120:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7290:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7292:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7459:Fan1 UTSW 7 64348966 missense probably damaging 0.99
R7460:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7464:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7465:Fan1 UTSW 7 64353638 missense probably benign 0.30
R7465:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7624:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7629:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7682:Fan1 UTSW 7 64372764 missense probably benign 0.06
R7731:Fan1 UTSW 7 64372696 missense probably benign 0.17
R7863:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7946:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8054:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8055:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8057:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8058:Fan1 UTSW 7 64372486 missense probably damaging 0.97
X0025:Fan1 UTSW 7 64372835 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGCAGAGCATCTAAGAGGC -3'
(R):5'- GAAGTACAAGCACCTCTTCAGC -3'

Sequencing Primer
(F):5'- CCCCCAGAGAAGCAGGC -3'
(R):5'- ACCTCTTCAGCCGGCTG -3'
Posted On2020-01-28