Incidental Mutation 'R7618:Slc25a10'
ID 628169
Institutional Source Beutler Lab
Gene Symbol Slc25a10
Ensembl Gene ENSMUSG00000025792
Gene Name solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10
Synonyms Dic
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7618 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 120491840-120499187 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 120496971 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026899]
AlphaFold Q9QZD8
Predicted Effect probably null
Transcript: ENSMUST00000026899
SMART Domains Protein: ENSMUSP00000026899
Gene: ENSMUSG00000025792

DomainStartEndE-ValueType
Pfam:Mito_carr 5 92 4.1e-20 PFAM
Pfam:Mito_carr 94 191 2e-18 PFAM
Pfam:Mito_carr 195 284 7.2e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that translocate small metabolites across the mitochondrial membrane. The encoded protein exchanges dicarboxylates, such as malate and succinate, for phosphate, sulfate, and other small molecules, thereby providing substrates for metabolic processes including the Krebs cycle and fatty acid synthesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Ankrd60 T C 2: 173,571,041 probably null Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in Slc25a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Slc25a10 APN 11 120497107 critical splice donor site probably null
IGL00816:Slc25a10 APN 11 120495150 splice site probably benign
IGL02448:Slc25a10 APN 11 120497053 missense probably benign 0.01
R2291:Slc25a10 UTSW 11 120497074 missense probably benign
R2860:Slc25a10 UTSW 11 120495177 missense probably damaging 0.98
R2861:Slc25a10 UTSW 11 120495177 missense probably damaging 0.98
R3938:Slc25a10 UTSW 11 120491993 nonsense probably null
R4019:Slc25a10 UTSW 11 120497439 missense probably damaging 0.99
R4020:Slc25a10 UTSW 11 120497439 missense probably damaging 0.99
R4457:Slc25a10 UTSW 11 120497089 missense probably benign
R4542:Slc25a10 UTSW 11 120497981 splice site probably null
R5643:Slc25a10 UTSW 11 120496376 intron probably benign
R5869:Slc25a10 UTSW 11 120498117 missense probably damaging 0.98
R6032:Slc25a10 UTSW 11 120494958 critical splice acceptor site probably null
R6032:Slc25a10 UTSW 11 120494958 critical splice acceptor site probably null
R6455:Slc25a10 UTSW 11 120495205 missense probably damaging 1.00
R6574:Slc25a10 UTSW 11 120497077 missense probably benign
R6954:Slc25a10 UTSW 11 120498147 missense probably benign
R7302:Slc25a10 UTSW 11 120491956 unclassified probably benign
R7671:Slc25a10 UTSW 11 120495460 missense probably benign 0.18
R7883:Slc25a10 UTSW 11 120494514 missense possibly damaging 0.84
R8855:Slc25a10 UTSW 11 120494969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTCTACAGGGATTACAGCAC -3'
(R):5'- ACGGGCTCCTTGAATCAAGC -3'

Sequencing Primer
(F):5'- CCGAGCACTGGAAACCATGG -3'
(R):5'- GGCTCCTTGAATCAAGCTCCAC -3'
Posted On 2020-01-28