Incidental Mutation 'R7614:Atp11b'
ID628188
Institutional Source Beutler Lab
Gene Symbol Atp11b
Ensembl Gene ENSMUSG00000037400
Gene NameATPase, class VI, type 11B
Synonyms1110019I14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R7614 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location35754106-35856276 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 35810110 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029257] [ENSMUST00000029257] [ENSMUST00000029257] [ENSMUST00000198599] [ENSMUST00000198599] [ENSMUST00000198599]
Predicted Effect probably null
Transcript: ENSMUST00000029257
SMART Domains Protein: ENSMUSP00000029257
Gene: ENSMUSG00000037400

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 21 90 2.4e-24 PFAM
Pfam:E1-E2_ATPase 95 369 5.4e-13 PFAM
Pfam:Hydrolase 401 757 1.5e-10 PFAM
Pfam:HAD 404 829 5.9e-20 PFAM
Pfam:Cation_ATPase 492 605 7.1e-13 PFAM
Pfam:PhoLip_ATPase_C 846 1099 1.5e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000029257
SMART Domains Protein: ENSMUSP00000029257
Gene: ENSMUSG00000037400

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 21 90 2.4e-24 PFAM
Pfam:E1-E2_ATPase 95 369 5.4e-13 PFAM
Pfam:Hydrolase 401 757 1.5e-10 PFAM
Pfam:HAD 404 829 5.9e-20 PFAM
Pfam:Cation_ATPase 492 605 7.1e-13 PFAM
Pfam:PhoLip_ATPase_C 846 1099 1.5e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000029257
SMART Domains Protein: ENSMUSP00000029257
Gene: ENSMUSG00000037400

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 21 90 2.4e-24 PFAM
Pfam:E1-E2_ATPase 95 369 5.4e-13 PFAM
Pfam:Hydrolase 401 757 1.5e-10 PFAM
Pfam:HAD 404 829 5.9e-20 PFAM
Pfam:Cation_ATPase 492 605 7.1e-13 PFAM
Pfam:PhoLip_ATPase_C 846 1099 1.5e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198599
SMART Domains Protein: ENSMUSP00000142676
Gene: ENSMUSG00000037400

DomainStartEndE-ValueType
low complexity region 90 107 N/A INTRINSIC
Pfam:Hydrolase 201 632 3e-17 PFAM
Pfam:HAD 204 629 4e-16 PFAM
Pfam:Hydrolase_like2 292 405 1.2e-13 PFAM
low complexity region 833 848 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198599
SMART Domains Protein: ENSMUSP00000142676
Gene: ENSMUSG00000037400

DomainStartEndE-ValueType
low complexity region 90 107 N/A INTRINSIC
Pfam:Hydrolase 201 632 3e-17 PFAM
Pfam:HAD 204 629 4e-16 PFAM
Pfam:Hydrolase_like2 292 405 1.2e-13 PFAM
low complexity region 833 848 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198599
SMART Domains Protein: ENSMUSP00000142676
Gene: ENSMUSG00000037400

DomainStartEndE-ValueType
low complexity region 90 107 N/A INTRINSIC
Pfam:Hydrolase 201 632 3e-17 PFAM
Pfam:HAD 204 629 4e-16 PFAM
Pfam:Hydrolase_like2 292 405 1.2e-13 PFAM
low complexity region 833 848 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199892
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] P-type ATPases, such as ATP11B, are phosphorylated in their intermediate state and drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily transports heavy metal ions, such as Cu(2+) or Cd(2+). Another subfamily transports non-heavy metal ions, such as H(+), Na(+), K(+), or Ca(+). A third subfamily transports amphipaths, such as phosphatidylserine.[supplied by OMIM, Feb 2005]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,542,532 D42E probably benign Het
Abl2 A G 1: 156,636,859 T535A possibly damaging Het
Adcy9 A T 16: 4,418,224 L441Q probably damaging Het
Adgrv1 A T 13: 81,520,661 V2592E probably damaging Het
Ahdc1 A G 4: 133,063,514 S689G probably benign Het
Ankrd24 G A 10: 81,638,689 G229E unknown Het
Ankrd34c T A 9: 89,728,861 I476F probably damaging Het
Arhgap8 A G 15: 84,757,075 T181A probably benign Het
Arhgef19 A G 4: 141,256,779 H770R possibly damaging Het
Arhgef4 T G 1: 34,732,235 S1208A possibly damaging Het
Arid1a A T 4: 133,691,155 M654K unknown Het
Cadps A G 14: 12,454,260 I1086T probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cntn3 T C 6: 102,165,376 H1010R probably benign Het
Cyp2c66 T A 19: 39,171,028 Y308N probably damaging Het
Dok6 T A 18: 89,473,943 H170L probably damaging Het
Eefsec C T 6: 88,281,594 D506N possibly damaging Het
Fam181a C T 12: 103,316,546 P237S probably damaging Het
Fam186b T C 15: 99,286,986 I19V probably damaging Het
Gm3285 A T 10: 77,862,031 T5S unknown Het
Heg1 A G 16: 33,727,363 E864G probably benign Het
Herc2 T A 7: 56,153,275 L2124* probably null Het
Hexa T C 9: 59,561,947 S331P probably damaging Het
Hspb1 A T 5: 135,888,369 D104V probably damaging Het
Ikzf1 A T 11: 11,769,019 Q329L probably damaging Het
Kcnf1 C A 12: 17,174,786 R478L probably benign Het
Kdm3a T C 6: 71,591,953 T1161A possibly damaging Het
Krtap31-2 T C 11: 99,936,603 I87T possibly damaging Het
Lars2 T C 9: 123,395,111 S116P Het
Lrrk2 A G 15: 91,772,858 D1785G probably damaging Het
Myo10 A G 15: 25,701,623 H61R probably benign Het
Olfr12 A G 1: 92,620,461 Y185C probably damaging Het
Olfr248 T G 1: 174,391,654 F195C probably damaging Het
Pcdhb4 C A 18: 37,309,549 H637Q probably benign Het
Pcsk9 T A 4: 106,447,566 D435V probably benign Het
Prickle2 T A 6: 92,425,650 Y119F possibly damaging Het
Psd T A 19: 46,313,438 Q903L probably damaging Het
Ptpn13 T A 5: 103,501,465 S245T probably benign Het
Resp18 T C 1: 75,278,238 S24G probably damaging Het
Slc17a4 T C 13: 23,906,597 T89A probably benign Het
Slc9a9 A G 9: 94,855,739 Y233C probably damaging Het
Slit1 T A 19: 41,634,200 I707F probably damaging Het
Sp4 T C 12: 118,254,439 E691G possibly damaging Het
Sun2 G T 15: 79,739,024 probably null Het
Syne3 T C 12: 104,946,642 T723A not run Het
Tcp1 T A 17: 12,922,653 F340I possibly damaging Het
Tmem39b A T 4: 129,693,901 V39D probably damaging Het
Tmtc3 A T 10: 100,450,352 Y536* probably null Het
Tnfrsf11a A T 1: 105,827,369 T389S probably damaging Het
Ttn T C 2: 76,768,529 T19347A possibly damaging Het
Vmn1r68 A G 7: 10,527,626 S182P probably benign Het
Vmn2r95 A G 17: 18,440,090 T255A probably benign Het
Wdr59 T C 8: 111,492,762 Y221C Het
Other mutations in Atp11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp11b APN 3 35809376 splice site probably null
IGL00722:Atp11b APN 3 35819935 missense probably damaging 1.00
IGL00725:Atp11b APN 3 35827073 missense probably damaging 0.97
IGL01514:Atp11b APN 3 35836981 missense probably damaging 1.00
IGL01532:Atp11b APN 3 35849502 nonsense probably null
IGL01789:Atp11b APN 3 35789592 missense possibly damaging 0.81
IGL01915:Atp11b APN 3 35831463 missense probably damaging 1.00
IGL02009:Atp11b APN 3 35814152 missense probably benign 0.07
IGL02049:Atp11b APN 3 35800493 missense probably damaging 0.99
IGL02952:Atp11b APN 3 35828695 missense probably damaging 1.00
IGL02991:Atp11b UTSW 3 35826991 missense probably benign 0.00
R0044:Atp11b UTSW 3 35812252 missense probably damaging 0.99
R0254:Atp11b UTSW 3 35812110 missense possibly damaging 0.82
R0538:Atp11b UTSW 3 35837014 missense probably damaging 1.00
R0541:Atp11b UTSW 3 35806944 missense probably damaging 0.99
R0653:Atp11b UTSW 3 35839194 missense probably damaging 0.99
R0790:Atp11b UTSW 3 35832923 missense probably damaging 1.00
R1083:Atp11b UTSW 3 35778013 splice site probably benign
R1371:Atp11b UTSW 3 35806769 missense probably damaging 0.97
R1458:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R1875:Atp11b UTSW 3 35839147 missense probably damaging 1.00
R1921:Atp11b UTSW 3 35834325 missense probably damaging 1.00
R2008:Atp11b UTSW 3 35855122 missense probably damaging 0.97
R2065:Atp11b UTSW 3 35839074 missense probably damaging 1.00
R2112:Atp11b UTSW 3 35837528 missense probably damaging 1.00
R2228:Atp11b UTSW 3 35806942 missense probably damaging 1.00
R2270:Atp11b UTSW 3 35810134 splice site probably null
R2273:Atp11b UTSW 3 35828613 missense probably benign 0.04
R2439:Atp11b UTSW 3 35814084 missense possibly damaging 0.68
R2497:Atp11b UTSW 3 35855145 missense probably damaging 0.99
R4181:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R4181:Atp11b UTSW 3 35800565 missense probably benign 0.19
R4714:Atp11b UTSW 3 35834394 missense probably benign 0.02
R4923:Atp11b UTSW 3 35835379 critical splice donor site probably null
R4937:Atp11b UTSW 3 35807008 splice site probably null
R5013:Atp11b UTSW 3 35834383 missense possibly damaging 0.66
R5058:Atp11b UTSW 3 35809361 missense probably benign 0.41
R5171:Atp11b UTSW 3 35832937 missense probably damaging 1.00
R5200:Atp11b UTSW 3 35837007 missense probably benign 0.21
R5465:Atp11b UTSW 3 35810184 missense probably benign 0.00
R5651:Atp11b UTSW 3 35855140 missense probably damaging 1.00
R5689:Atp11b UTSW 3 35834352 missense possibly damaging 0.67
R5718:Atp11b UTSW 3 35837516 missense probably benign 0.12
R5807:Atp11b UTSW 3 35812279 missense probably damaging 1.00
R5888:Atp11b UTSW 3 35837547 missense probably benign 0.15
R6059:Atp11b UTSW 3 35814177 missense possibly damaging 0.72
R6259:Atp11b UTSW 3 35806901 missense probably damaging 1.00
R6359:Atp11b UTSW 3 35778061 missense probably benign 0.04
R6367:Atp11b UTSW 3 35784537 missense probably damaging 1.00
R6577:Atp11b UTSW 3 35839162 missense probably damaging 0.99
R6818:Atp11b UTSW 3 35814180 missense possibly damaging 0.71
R7016:Atp11b UTSW 3 35841036 missense probably benign
R7178:Atp11b UTSW 3 35819950 missense probably benign 0.34
R7729:Atp11b UTSW 3 35778107 missense probably damaging 0.97
R7910:Atp11b UTSW 3 35831503 missense possibly damaging 0.68
R7967:Atp11b UTSW 3 35841043 missense probably benign 0.03
R8085:Atp11b UTSW 3 35841036 missense probably benign
R8095:Atp11b UTSW 3 35834416 missense probably damaging 1.00
R8499:Atp11b UTSW 3 35810705 missense probably benign 0.01
R8672:Atp11b UTSW 3 35819917 missense probably benign 0.19
Z1088:Atp11b UTSW 3 35812213 missense probably damaging 1.00
Z1177:Atp11b UTSW 3 35806854 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CATATTCTCCCGAGCTTGCAG -3'
(R):5'- ATCACGCTCAATCACCTTGC -3'

Sequencing Primer
(F):5'- CCAAAGGCTACTAAAACAGT -3'
(R):5'- GCTCAATCACCTTGCCGCAG -3'
Posted On2020-02-04