Incidental Mutation 'R7473:Insrr'
ID 628190
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Name insulin receptor-related receptor
Synonyms
MMRRC Submission 045547-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.274) question?
Stock # R7473 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 87704258-87723408 bp(+) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to A at 87711838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
AlphaFold Q9WTL4
Predicted Effect probably null
Transcript: ENSMUST00000029711
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107582
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 89,965,960 (GRCm39) probably null Het
A630095N17Rik G A 1: 75,208,675 (GRCm39) T15I unknown Het
Actr1b A G 1: 36,748,900 (GRCm39) V12A probably benign Het
Add1 A G 5: 34,776,697 (GRCm39) T473A possibly damaging Het
Akap11 A T 14: 78,751,328 (GRCm39) V353E Het
Alcam G A 16: 52,272,882 (GRCm39) probably benign Het
Alpi A G 1: 87,027,369 (GRCm39) probably null Het
Ap3s2 A G 7: 79,565,779 (GRCm39) F49S probably damaging Het
Arpc1a A G 5: 145,037,886 (GRCm39) K174E probably benign Het
Bbox1 A T 2: 110,095,843 (GRCm39) S374T probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Bltp2 T C 11: 78,157,941 (GRCm39) S368P possibly damaging Het
Bmp2k A G 5: 97,204,871 (GRCm39) N402S probably benign Het
Bmper C A 9: 23,286,926 (GRCm39) A284D probably benign Het
Bnip5 G A 17: 29,124,298 (GRCm39) R335W probably damaging Het
Bpifb2 A T 2: 153,723,116 (GRCm39) H124L possibly damaging Het
Bsn C T 9: 107,989,449 (GRCm39) R2101Q probably damaging Het
Cacng1 T A 11: 107,607,018 (GRCm39) D67V probably damaging Het
Catsperg1 A G 7: 28,894,903 (GRCm39) S565P probably damaging Het
Cep126 C T 9: 8,101,779 (GRCm39) E252K probably damaging Het
Cep55 G A 19: 38,058,384 (GRCm39) E326K probably damaging Het
Cfap58 T A 19: 47,963,064 (GRCm39) Y491* probably null Het
Cpeb2 T C 5: 43,434,848 (GRCm39) S747P Het
Cryz T A 3: 154,312,157 (GRCm39) S85T probably benign Het
D2hgdh T C 1: 93,765,800 (GRCm39) V367A probably damaging Het
Dgkh T C 14: 78,836,483 (GRCm39) N703S probably benign Het
Dnah11 T C 12: 117,866,911 (GRCm39) S4077G probably benign Het
Dnah14 A G 1: 181,579,704 (GRCm39) H3079R probably damaging Het
Dnah2 T A 11: 69,382,484 (GRCm39) T1209S probably damaging Het
Dnmt3b A G 2: 153,526,370 (GRCm39) D804G probably damaging Het
Ell2 A G 13: 75,898,154 (GRCm39) E143G probably damaging Het
Exoc2 A G 13: 31,006,613 (GRCm39) probably null Het
Fahd2a A T 2: 127,282,376 (GRCm39) I131N probably damaging Het
Fer1l5 A G 1: 36,460,689 (GRCm39) N1976D possibly damaging Het
Flt1 A G 5: 147,531,405 (GRCm39) S853P probably damaging Het
Frg2f1 C T 4: 119,387,990 (GRCm39) V170I probably benign Het
Gcn1 G A 5: 115,719,863 (GRCm39) V373M probably benign Het
Gm19965 A G 1: 116,749,602 (GRCm39) T428A unknown Het
Gm4792 A G 10: 94,129,730 (GRCm39) I124T unknown Het
Grik2 A T 10: 48,989,618 (GRCm39) C804S probably benign Het
Heatr6 T A 11: 83,672,217 (GRCm39) I1075N probably damaging Het
Hunk G A 16: 90,250,588 (GRCm39) A211T probably damaging Het
Ighe T C 12: 113,234,976 (GRCm39) I395V probably damaging Het
Ino80e A T 7: 126,456,484 (GRCm39) S104T probably damaging Het
Inpp4a A G 1: 37,408,534 (GRCm39) Y305C probably benign Het
Itgae T G 11: 73,031,504 (GRCm39) D1073E possibly damaging Het
Klf11 G T 12: 24,705,141 (GRCm39) probably null Het
Lrguk A T 6: 34,006,630 (GRCm39) K80M probably benign Het
Map2 A T 1: 66,454,617 (GRCm39) D1169V probably damaging Het
Mpst G T 15: 78,297,726 (GRCm39) C248F probably damaging Het
Myo9a C A 9: 59,802,527 (GRCm39) Q2005K probably benign Het
Nfatc4 C T 14: 56,069,421 (GRCm39) T649I probably benign Het
Nmt1 A G 11: 102,937,226 (GRCm39) R88G probably benign Het
Nqo1 G A 8: 108,129,729 (GRCm39) probably benign Het
Nudt2 T G 4: 41,477,576 (GRCm39) M19R probably benign Het
Or10a49 T A 7: 108,467,476 (GRCm39) K295M probably damaging Het
Or12d2 T A 17: 37,624,522 (GRCm39) Y251F probably benign Het
Or9q2 C T 19: 13,772,526 (GRCm39) V150M probably benign Het
P2ry1 T A 3: 60,911,509 (GRCm39) I216N probably damaging Het
Pcx T A 19: 4,669,589 (GRCm39) L823* probably null Het
Pkhd1 A G 1: 20,619,980 (GRCm39) V880A probably damaging Het
Plcb1 A T 2: 135,186,196 (GRCm39) N721I probably damaging Het
Prdm15 T C 16: 97,623,046 (GRCm39) K269E possibly damaging Het
Prl7b1 A G 13: 27,785,996 (GRCm39) V224A possibly damaging Het
Reln A G 5: 22,134,125 (GRCm39) V2601A probably benign Het
Rspo4 G A 2: 151,714,993 (GRCm39) R210Q unknown Het
Slc7a5 A T 8: 122,615,162 (GRCm39) D228E probably benign Het
Spopfm2 T A 3: 94,083,509 (GRCm39) K101* probably null Het
Tas2r115 A G 6: 132,714,214 (GRCm39) S246P probably damaging Het
Tenm4 A G 7: 96,423,353 (GRCm39) Y716C probably damaging Het
Tgfb3 T C 12: 86,108,923 (GRCm39) K269E possibly damaging Het
Thoc6 A G 17: 23,889,841 (GRCm39) I27T probably benign Het
Tigd5 G A 15: 75,781,748 (GRCm39) G37S probably benign Het
Tmem259 C T 10: 79,815,506 (GRCm39) D102N possibly damaging Het
Tpo T G 12: 30,142,589 (GRCm39) I712L probably benign Het
Ttn G A 2: 76,700,892 (GRCm39) T21M possibly damaging Het
Utp20 A T 10: 88,656,572 (GRCm39) probably null Het
Xrcc5 A G 1: 72,351,748 (GRCm39) D106G probably damaging Het
Xrn1 T A 9: 95,861,194 (GRCm39) F451L probably benign Het
Zar1l T A 5: 150,441,203 (GRCm39) D141V probably damaging Het
Zfp27 A T 7: 29,595,324 (GRCm39) C214S possibly damaging Het
Znfx1 A T 2: 166,880,744 (GRCm39) C1211S probably damaging Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87,720,981 (GRCm39) critical splice donor site probably null
IGL00801:Insrr APN 3 87,721,115 (GRCm39) missense probably damaging 1.00
IGL01628:Insrr APN 3 87,708,099 (GRCm39) nonsense probably null
IGL01755:Insrr APN 3 87,721,493 (GRCm39) missense probably damaging 1.00
IGL02100:Insrr APN 3 87,718,927 (GRCm39) missense probably damaging 1.00
IGL02261:Insrr APN 3 87,708,029 (GRCm39) missense probably damaging 1.00
IGL02366:Insrr APN 3 87,717,216 (GRCm39) missense possibly damaging 0.91
IGL02387:Insrr APN 3 87,720,434 (GRCm39) missense probably damaging 1.00
IGL02478:Insrr APN 3 87,716,719 (GRCm39) missense probably benign 0.14
IGL02550:Insrr APN 3 87,711,805 (GRCm39) missense probably damaging 1.00
IGL02555:Insrr APN 3 87,721,124 (GRCm39) missense probably damaging 0.99
IGL02673:Insrr APN 3 87,720,368 (GRCm39) missense possibly damaging 0.95
IGL02724:Insrr APN 3 87,716,879 (GRCm39) missense probably benign 0.31
IGL02798:Insrr APN 3 87,717,824 (GRCm39) missense probably damaging 1.00
IGL02969:Insrr APN 3 87,721,498 (GRCm39) nonsense probably null
IGL03073:Insrr APN 3 87,717,245 (GRCm39) splice site probably benign
IGL03178:Insrr APN 3 87,709,848 (GRCm39) splice site probably null
IGL03389:Insrr APN 3 87,716,038 (GRCm39) missense probably damaging 1.00
IGL03399:Insrr APN 3 87,716,638 (GRCm39) missense probably null 0.99
IGL02799:Insrr UTSW 3 87,720,888 (GRCm39) missense probably damaging 1.00
R0011:Insrr UTSW 3 87,716,923 (GRCm39) missense possibly damaging 0.86
R0053:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R0053:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R0357:Insrr UTSW 3 87,715,953 (GRCm39) splice site probably null
R0501:Insrr UTSW 3 87,717,991 (GRCm39) missense probably benign 0.12
R0504:Insrr UTSW 3 87,720,463 (GRCm39) missense possibly damaging 0.69
R0522:Insrr UTSW 3 87,708,179 (GRCm39) missense probably damaging 1.00
R0555:Insrr UTSW 3 87,721,744 (GRCm39) splice site probably benign
R0558:Insrr UTSW 3 87,718,288 (GRCm39) missense possibly damaging 0.77
R0599:Insrr UTSW 3 87,720,440 (GRCm39) missense probably damaging 0.97
R1312:Insrr UTSW 3 87,707,797 (GRCm39) missense probably damaging 1.00
R1694:Insrr UTSW 3 87,711,369 (GRCm39) missense probably benign
R1785:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R1786:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R1892:Insrr UTSW 3 87,721,184 (GRCm39) missense probably damaging 1.00
R1950:Insrr UTSW 3 87,721,820 (GRCm39) missense probably damaging 1.00
R2080:Insrr UTSW 3 87,721,598 (GRCm39) missense possibly damaging 0.79
R2094:Insrr UTSW 3 87,710,488 (GRCm39) missense probably damaging 1.00
R2130:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R2131:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R2133:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R2220:Insrr UTSW 3 87,716,725 (GRCm39) missense probably damaging 1.00
R2259:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R2404:Insrr UTSW 3 87,709,974 (GRCm39) missense possibly damaging 0.71
R4027:Insrr UTSW 3 87,716,906 (GRCm39) missense probably benign
R4042:Insrr UTSW 3 87,721,134 (GRCm39) missense probably damaging 1.00
R4510:Insrr UTSW 3 87,715,978 (GRCm39) missense possibly damaging 0.67
R4511:Insrr UTSW 3 87,715,978 (GRCm39) missense possibly damaging 0.67
R4571:Insrr UTSW 3 87,708,194 (GRCm39) missense probably benign
R4870:Insrr UTSW 3 87,718,911 (GRCm39) missense probably damaging 1.00
R5057:Insrr UTSW 3 87,722,572 (GRCm39) missense probably benign 0.00
R5393:Insrr UTSW 3 87,718,007 (GRCm39) splice site probably null
R5685:Insrr UTSW 3 87,707,803 (GRCm39) splice site probably null
R6039:Insrr UTSW 3 87,716,608 (GRCm39) missense possibly damaging 0.56
R6039:Insrr UTSW 3 87,716,608 (GRCm39) missense possibly damaging 0.56
R6047:Insrr UTSW 3 87,711,483 (GRCm39) missense probably damaging 1.00
R6276:Insrr UTSW 3 87,707,826 (GRCm39) nonsense probably null
R6298:Insrr UTSW 3 87,720,272 (GRCm39) missense probably damaging 1.00
R6726:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6727:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6728:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6796:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R7041:Insrr UTSW 3 87,722,551 (GRCm39) missense probably damaging 1.00
R7169:Insrr UTSW 3 87,715,901 (GRCm39) missense probably benign 0.15
R7270:Insrr UTSW 3 87,710,440 (GRCm39) missense probably damaging 1.00
R7340:Insrr UTSW 3 87,721,623 (GRCm39) critical splice donor site probably null
R7398:Insrr UTSW 3 87,716,039 (GRCm39) missense probably damaging 1.00
R7815:Insrr UTSW 3 87,716,002 (GRCm39) missense probably damaging 0.98
R8159:Insrr UTSW 3 87,707,735 (GRCm39) missense probably damaging 1.00
R8289:Insrr UTSW 3 87,721,501 (GRCm39) missense probably damaging 1.00
R8309:Insrr UTSW 3 87,717,749 (GRCm39) missense probably benign 0.00
R8312:Insrr UTSW 3 87,707,791 (GRCm39) missense possibly damaging 0.93
R8445:Insrr UTSW 3 87,720,891 (GRCm39) missense probably damaging 1.00
R8917:Insrr UTSW 3 87,718,276 (GRCm39) missense probably benign 0.00
R8960:Insrr UTSW 3 87,720,386 (GRCm39) missense probably damaging 1.00
R8989:Insrr UTSW 3 87,722,664 (GRCm39) missense probably damaging 0.96
R9015:Insrr UTSW 3 87,720,910 (GRCm39) missense probably damaging 1.00
R9202:Insrr UTSW 3 87,720,427 (GRCm39) missense probably damaging 1.00
R9251:Insrr UTSW 3 87,717,391 (GRCm39) missense probably benign 0.08
R9327:Insrr UTSW 3 87,721,604 (GRCm39) missense probably damaging 1.00
R9646:Insrr UTSW 3 87,721,805 (GRCm39) missense probably damaging 1.00
RF022:Insrr UTSW 3 87,711,792 (GRCm39) missense possibly damaging 0.51
Z1177:Insrr UTSW 3 87,708,134 (GRCm39) missense possibly damaging 0.91
Z1192:Insrr UTSW 3 87,709,886 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAATACCGAGGGGATCAACC -3'
(R):5'- CCAAGCAAGGTGAGACAGATCC -3'

Sequencing Primer
(F):5'- GTGAGCAGCCATGGGTG -3'
(R):5'- AACCCCAGCGTTCTTGGAG -3'
Posted On 2020-02-05