Incidental Mutation 'R7475:Mylk'
ID 628196
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210
MMRRC Submission 045549-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7475 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 34565580-34822790 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 34734446 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000023538
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,218,739 (GRCm39) N214K probably benign Het
Abcf1 A G 17: 36,274,459 (GRCm39) probably null Het
Agxt2 A T 15: 10,409,623 (GRCm39) M508L probably benign Het
Akr1c21 A T 13: 4,626,318 (GRCm39) Y114F probably benign Het
Amz1 T C 5: 140,729,941 (GRCm39) probably null Het
Ank1 G T 8: 23,622,646 (GRCm39) A1732S probably benign Het
Atg16l1 T C 1: 87,687,805 (GRCm39) S50P possibly damaging Het
AW551984 A G 9: 39,509,236 (GRCm39) S302P probably damaging Het
Ccn6 T A 10: 39,034,296 (GRCm39) Y102F probably damaging Het
Ces3a T A 8: 105,780,322 (GRCm39) probably null Het
Dedd C A 1: 171,167,881 (GRCm39) P185Q probably benign Het
Fam186a A T 15: 99,845,395 (GRCm39) V283E unknown Het
Fat2 C A 11: 55,194,479 (GRCm39) V1187F probably benign Het
Fbxw11 T C 11: 32,661,999 (GRCm39) probably null Het
Fcgbp C T 7: 27,802,401 (GRCm39) T1443I probably damaging Het
Foxj2 A G 6: 122,814,801 (GRCm39) D279G probably benign Het
Gbp5 A G 3: 142,207,122 (GRCm39) D97G probably damaging Het
Gm49368 A T 7: 127,707,154 (GRCm39) T661S possibly damaging Het
Gria4 T G 9: 4,513,330 (GRCm39) T260P probably damaging Het
Gtf2ird2 T A 5: 134,230,267 (GRCm39) D195E possibly damaging Het
Hectd4 T A 5: 121,496,196 (GRCm39) probably null Het
Ifngr2 G A 16: 91,354,797 (GRCm39) C32Y unknown Het
Ikzf5 A T 7: 130,993,788 (GRCm39) C280S probably benign Het
Ints9 G T 14: 65,263,914 (GRCm39) E395D probably null Het
Isoc2b T C 7: 4,854,084 (GRCm39) D96G probably benign Het
Jmjd1c T G 10: 67,061,092 (GRCm39) S967R probably benign Het
Kcnj3 A T 2: 55,327,338 (GRCm39) K42N probably benign Het
Kiz T C 2: 146,733,006 (GRCm39) V394A possibly damaging Het
Knl1 A T 2: 118,918,027 (GRCm39) H1795L probably damaging Het
Lmntd2 A G 7: 140,790,602 (GRCm39) probably null Het
Loxhd1 C A 18: 77,500,001 (GRCm39) D1690E possibly damaging Het
Lrp1b T C 2: 41,234,588 (GRCm39) D1121G Het
Map3k2 T C 18: 32,333,015 (GRCm39) V63A possibly damaging Het
Mcc G T 18: 44,609,303 (GRCm39) A499D probably damaging Het
Mcpt9 T A 14: 56,264,400 (GRCm39) I232F probably damaging Het
Meltf A G 16: 31,700,756 (GRCm39) K92R probably benign Het
Mff T A 1: 82,723,159 (GRCm39) probably null Het
Mrgpra3 T A 7: 47,239,695 (GRCm39) Y77F probably damaging Het
Ndufv2 A G 17: 66,394,532 (GRCm39) V111A possibly damaging Het
Nkd2 T C 13: 73,973,861 (GRCm39) E99G probably damaging Het
Nlk C A 11: 78,474,225 (GRCm39) G358V probably damaging Het
Nnmt A T 9: 48,503,532 (GRCm39) C165S probably damaging Het
Nxpe4 T A 9: 48,304,640 (GRCm39) C242* probably null Het
Oas1b A T 5: 120,955,705 (GRCm39) N162I probably damaging Het
Or4s2 A G 2: 88,473,554 (GRCm39) I148V probably benign Het
Otog A G 7: 45,916,700 (GRCm39) N879S probably damaging Het
Pcsk7 T A 9: 45,838,923 (GRCm39) Y612N probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pgbd5 T C 8: 125,160,750 (GRCm39) D39G probably benign Het
Pkhd1l1 C T 15: 44,368,581 (GRCm39) Q800* probably null Het
Pkn3 T C 2: 29,977,122 (GRCm39) S621P probably benign Het
Polr3c T C 3: 96,622,501 (GRCm39) I385V probably benign Het
Ppp1r21 G T 17: 88,863,031 (GRCm39) G257W probably benign Het
Prkn A G 17: 11,653,501 (GRCm39) D199G probably benign Het
Pxylp1 C T 9: 96,738,420 (GRCm39) probably null Het
Rasgrp1 T C 2: 117,116,589 (GRCm39) T613A probably benign Het
Robo3 C T 9: 37,336,674 (GRCm39) V387I probably benign Het
Rxfp2 T A 5: 149,973,046 (GRCm39) Y174N possibly damaging Het
Sec24a T C 11: 51,604,379 (GRCm39) M746V probably damaging Het
Sema4f T A 6: 82,891,355 (GRCm39) E571D possibly damaging Het
Septin3 T C 15: 82,170,657 (GRCm39) V217A probably benign Het
Serpinb1b A C 13: 33,277,548 (GRCm39) K260N probably benign Het
Sin3b A G 8: 73,476,500 (GRCm39) T645A possibly damaging Het
Sobp C T 10: 42,897,830 (GRCm39) R585Q probably damaging Het
Specc1l T A 10: 75,082,281 (GRCm39) L559Q possibly damaging Het
Srxn1 C T 2: 151,947,573 (GRCm39) probably benign Het
Sspo G A 6: 48,432,794 (GRCm39) R890Q probably benign Het
Stard9 A G 2: 120,518,591 (GRCm39) D505G probably damaging Het
Tjp1 A T 7: 64,972,087 (GRCm39) I653K probably damaging Het
Tnks C T 8: 35,298,866 (GRCm39) E1296K probably damaging Het
Ttbk2 A T 2: 120,579,121 (GRCm39) I667N probably benign Het
Usp24 T C 4: 106,199,550 (GRCm39) S165P possibly damaging Het
Usp46 T A 5: 74,189,598 (GRCm39) K109* probably null Het
Vmn1r191 A G 13: 22,362,942 (GRCm39) C271R probably benign Het
Zfp592 T C 7: 80,673,200 (GRCm39) S55P probably damaging Het
Zmynd15 T C 11: 70,351,867 (GRCm39) S158P probably benign Het
Zscan22 T G 7: 12,640,664 (GRCm39) C303G probably damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34,759,322 (GRCm39) missense probably benign 0.36
IGL01386:Mylk APN 16 34,791,610 (GRCm39) critical splice acceptor site probably null
IGL01684:Mylk APN 16 34,792,310 (GRCm39) missense possibly damaging 0.55
IGL01884:Mylk APN 16 34,809,247 (GRCm39) splice site probably benign
IGL02079:Mylk APN 16 34,681,001 (GRCm39) missense possibly damaging 0.87
IGL02104:Mylk APN 16 34,635,805 (GRCm39) missense probably benign 0.06
IGL02624:Mylk APN 16 34,750,266 (GRCm39) missense probably benign 0.29
IGL02756:Mylk APN 16 34,784,016 (GRCm39) missense probably benign 0.42
IGL02794:Mylk APN 16 34,806,911 (GRCm39) missense probably benign 0.21
IGL02833:Mylk APN 16 34,735,270 (GRCm39) missense probably benign 0.01
IGL02946:Mylk APN 16 34,742,158 (GRCm39) missense probably benign 0.10
IGL03012:Mylk APN 16 34,773,151 (GRCm39) missense probably benign 0.03
IGL03093:Mylk APN 16 34,732,562 (GRCm39) missense possibly damaging 0.62
IGL03272:Mylk APN 16 34,799,559 (GRCm39) missense probably benign 0.09
billy UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
brutus UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
Club UTSW 16 34,732,645 (GRCm39) nonsense probably null
popeye UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
F5770:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34,797,483 (GRCm39) splice site probably benign
PIT4382001:Mylk UTSW 16 34,696,012 (GRCm39) missense probably damaging 0.99
R0131:Mylk UTSW 16 34,695,874 (GRCm39) missense probably benign 0.03
R0309:Mylk UTSW 16 34,732,667 (GRCm39) splice site probably benign
R0358:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0381:Mylk UTSW 16 34,605,344 (GRCm39) splice site probably null
R0390:Mylk UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
R0413:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.01
R0536:Mylk UTSW 16 34,820,757 (GRCm39) missense possibly damaging 0.95
R0544:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0545:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0546:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0547:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0548:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0627:Mylk UTSW 16 34,820,799 (GRCm39) missense probably damaging 1.00
R0726:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0755:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0782:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0783:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0784:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1136:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R1170:Mylk UTSW 16 34,694,409 (GRCm39) missense probably benign 0.20
R1222:Mylk UTSW 16 34,681,022 (GRCm39) missense probably benign 0.12
R1445:Mylk UTSW 16 34,635,835 (GRCm39) missense possibly damaging 0.57
R1583:Mylk UTSW 16 34,695,956 (GRCm39) missense probably benign 0.29
R1618:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1643:Mylk UTSW 16 34,696,005 (GRCm39) missense probably benign 0.03
R1702:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.00
R1776:Mylk UTSW 16 34,773,152 (GRCm39) missense probably benign 0.16
R1865:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.03
R1975:Mylk UTSW 16 34,700,673 (GRCm39) splice site probably null
R2016:Mylk UTSW 16 34,817,187 (GRCm39) missense probably damaging 1.00
R2045:Mylk UTSW 16 34,774,023 (GRCm39) missense probably benign 0.29
R2134:Mylk UTSW 16 34,806,846 (GRCm39) missense probably benign 0.13
R3547:Mylk UTSW 16 34,700,538 (GRCm39) missense possibly damaging 0.61
R3844:Mylk UTSW 16 34,742,247 (GRCm39) missense probably benign 0.01
R4003:Mylk UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
R4396:Mylk UTSW 16 34,732,645 (GRCm39) nonsense probably null
R4470:Mylk UTSW 16 34,732,522 (GRCm39) missense probably benign 0.09
R4507:Mylk UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
R4700:Mylk UTSW 16 34,742,805 (GRCm39) missense probably benign 0.16
R4751:Mylk UTSW 16 34,699,539 (GRCm39) missense probably benign 0.29
R4815:Mylk UTSW 16 34,715,295 (GRCm39) missense probably damaging 0.97
R4832:Mylk UTSW 16 34,742,737 (GRCm39) missense probably benign 0.36
R4872:Mylk UTSW 16 34,735,360 (GRCm39) missense possibly damaging 0.89
R4953:Mylk UTSW 16 34,809,331 (GRCm39) missense probably damaging 1.00
R4969:Mylk UTSW 16 34,791,810 (GRCm39) missense probably damaging 0.96
R5009:Mylk UTSW 16 34,719,877 (GRCm39) missense probably benign 0.39
R5130:Mylk UTSW 16 34,809,367 (GRCm39) missense probably damaging 1.00
R5173:Mylk UTSW 16 34,797,383 (GRCm39) missense probably benign 0.40
R5195:Mylk UTSW 16 34,799,585 (GRCm39) missense probably damaging 1.00
R5209:Mylk UTSW 16 34,742,995 (GRCm39) missense possibly damaging 0.55
R5311:Mylk UTSW 16 34,742,127 (GRCm39) missense probably benign 0.01
R5418:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.02
R5481:Mylk UTSW 16 34,741,974 (GRCm39) missense probably benign 0.09
R5590:Mylk UTSW 16 34,699,722 (GRCm39) missense probably benign 0.29
R5603:Mylk UTSW 16 34,776,862 (GRCm39) missense probably benign 0.06
R5823:Mylk UTSW 16 34,715,317 (GRCm39) critical splice donor site probably null
R6290:Mylk UTSW 16 34,715,213 (GRCm39) missense probably benign 0.39
R6351:Mylk UTSW 16 34,742,341 (GRCm39) missense probably benign 0.01
R6365:Mylk UTSW 16 34,680,961 (GRCm39) missense probably benign 0.12
R6490:Mylk UTSW 16 34,750,237 (GRCm39) missense possibly damaging 0.74
R6723:Mylk UTSW 16 34,750,258 (GRCm39) missense possibly damaging 0.74
R6864:Mylk UTSW 16 34,694,520 (GRCm39) missense probably benign 0.03
R6908:Mylk UTSW 16 34,700,643 (GRCm39) missense probably benign 0.18
R6949:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R7018:Mylk UTSW 16 34,820,796 (GRCm39) missense possibly damaging 0.88
R7035:Mylk UTSW 16 34,797,352 (GRCm39) missense possibly damaging 0.89
R7162:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7236:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7269:Mylk UTSW 16 34,605,381 (GRCm39) missense probably damaging 0.96
R7525:Mylk UTSW 16 34,809,357 (GRCm39) missense probably benign 0.06
R7587:Mylk UTSW 16 34,742,887 (GRCm39) missense probably benign 0.29
R7607:Mylk UTSW 16 34,715,184 (GRCm39) missense probably benign 0.09
R7616:Mylk UTSW 16 34,699,927 (GRCm39) missense probably damaging 0.97
R7647:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7648:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7764:Mylk UTSW 16 34,742,553 (GRCm39) missense probably benign 0.16
R7890:Mylk UTSW 16 34,784,018 (GRCm39) nonsense probably null
R7892:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7893:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R8065:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8067:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8143:Mylk UTSW 16 34,734,525 (GRCm39) missense possibly damaging 0.87
R8210:Mylk UTSW 16 34,820,721 (GRCm39) missense probably damaging 1.00
R8271:Mylk UTSW 16 34,742,949 (GRCm39) missense probably damaging 0.97
R8540:Mylk UTSW 16 34,750,257 (GRCm39) missense possibly damaging 0.87
R8721:Mylk UTSW 16 34,817,176 (GRCm39) missense probably damaging 1.00
R8743:Mylk UTSW 16 34,741,427 (GRCm39) missense probably benign 0.03
R8798:Mylk UTSW 16 34,719,772 (GRCm39) missense possibly damaging 0.89
R8956:Mylk UTSW 16 34,791,779 (GRCm39) missense probably benign 0.01
R9131:Mylk UTSW 16 34,776,835 (GRCm39) missense probably benign 0.29
R9403:Mylk UTSW 16 34,696,012 (GRCm39) nonsense probably null
R9624:Mylk UTSW 16 34,699,677 (GRCm39) missense probably benign 0.29
R9735:Mylk UTSW 16 34,735,179 (GRCm39) missense probably benign 0.09
R9756:Mylk UTSW 16 34,734,387 (GRCm39) missense probably damaging 0.96
R9763:Mylk UTSW 16 34,699,482 (GRCm39) nonsense probably null
RF001:Mylk UTSW 16 34,699,741 (GRCm39) missense probably benign 0.03
V7580:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
V7583:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
X0065:Mylk UTSW 16 34,820,811 (GRCm39) missense probably damaging 1.00
Z1177:Mylk UTSW 16 34,743,021 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CCCAGTGTTAACATTCTAAGTGC -3'
(R):5'- GACAGTGATCTGCCTCTGAG -3'

Sequencing Primer
(F):5'- CACAGTTGCTTCCTGGCTAGG -3'
(R):5'- TCTGAGGCTGCAGTGGGAC -3'
Posted On 2020-02-05