Mutagenetix > Incidental Mutation

Incidental Mutation 'R7475:Mylk'

628196

Institutional Source

Beutler Lab

Gene Symbol

Mylk

Ensembl Gene

ENSMUSG00000022836

Gene Name

myosin, light polypeptide kinase

Synonyms

Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7475 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34745210-35002420 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 34914076 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000023538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023538]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000023538

SMART Domains

Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836

Domain	Start	End	E-Value	Type
IGc2	54	122	9.05e-11	SMART
IGc2	177	244	3.94e-11	SMART
Pfam:23ISL	255	409	3.6e-60	PFAM
IGc2	423	491	1.55e-9	SMART
IGc2	523	587	3.32e-18	SMART
IGc2	632	699	6.02e-7	SMART
IGc2	730	798	1.36e-5	SMART
low complexity region	827	844	N/A	INTRINSIC
IGc2	1141	1208	2.42e-11	SMART
low complexity region	1251	1269	N/A	INTRINSIC
IG	1275	1359	4.56e-7	SMART
FN3	1362	1444	2.33e-11	SMART
low complexity region	1457	1479	N/A	INTRINSIC
S_TKc	1495	1750	4.23e-95	SMART
IGc2	1852	1920	5.92e-15	SMART
low complexity region	1934	1950	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	T	16: 20,399,989	N214K	probably benign	Het
Abcf1	A	G	17: 35,963,567		probably null	Het
Agxt2	A	T	15: 10,409,537	M508L	probably benign	Het
Akr1c21	A	T	13: 4,576,319	Y114F	probably benign	Het
Amz1	T	C	5: 140,744,186		probably null	Het
Ank1	G	T	8: 23,132,630	A1732S	probably benign	Het
Atg16l1	T	C	1: 87,760,083	S50P	possibly damaging	Het
AW551984	A	G	9: 39,597,940	S302P	probably damaging	Het
Ces3a	T	A	8: 105,053,690		probably null	Het
Dedd	C	A	1: 171,340,313	P185Q	probably benign	Het
Fam186a	A	T	15: 99,947,514	V283E	unknown	Het
Fat2	C	A	11: 55,303,653	V1187F	probably benign	Het
Fbxw11	T	C	11: 32,711,999		probably null	Het
Fcgbp	C	T	7: 28,102,976	T1443I	probably damaging	Het
Foxj2	A	G	6: 122,837,842	D279G	probably benign	Het
Gbp5	A	G	3: 142,501,361	D97G	probably damaging	Het
Gm49368	A	T	7: 128,107,982	T661S	possibly damaging	Het
Gria4	T	G	9: 4,513,330	T260P	probably damaging	Het
Gtf2ird2	T	A	5: 134,201,426	D195E	possibly damaging	Het
Hectd4	T	A	5: 121,358,133		probably null	Het
Ifngr2	G	A	16: 91,557,909	C32Y	unknown	Het
Ikzf5	A	T	7: 131,392,059	C280S	probably benign	Het
Ints9	G	T	14: 65,026,465	E395D	probably null	Het
Isoc2b	T	C	7: 4,851,085	D96G	probably benign	Het
Jmjd1c	T	G	10: 67,225,313	S967R	probably benign	Het
Kcnj3	A	T	2: 55,437,326	K42N	probably benign	Het
Kiz	T	C	2: 146,891,086	V394A	possibly damaging	Het
Knl1	A	T	2: 119,087,546	H1795L	probably damaging	Het
Lmntd2	A	G	7: 141,210,689		probably null	Het
Loxhd1	C	A	18: 77,412,305	D1690E	possibly damaging	Het
Lrp1b	T	C	2: 41,344,576	D1121G		Het
Map3k2	T	C	18: 32,199,962	V63A	possibly damaging	Het
Mcc	G	T	18: 44,476,236	A499D	probably damaging	Het
Mcpt9	T	A	14: 56,026,943	I232F	probably damaging	Het
Meltf	A	G	16: 31,881,938	K92R	probably benign	Het
Mff	T	A	1: 82,745,438		probably null	Het
Mrgpra3	T	A	7: 47,589,947	Y77F	probably damaging	Het
Ndufv2	A	G	17: 66,087,537	V111A	possibly damaging	Het
Nkd2	T	C	13: 73,825,742	E99G	probably damaging	Het
Nlk	C	A	11: 78,583,399	G358V	probably damaging	Het
Nnmt	A	T	9: 48,592,232	C165S	probably damaging	Het
Nxpe4	T	A	9: 48,393,340	C242*	probably null	Het
Oas1b	A	T	5: 120,817,640	N162I	probably damaging	Het
Olfr1191-ps1	A	G	2: 88,643,210	I148V	probably benign	Het
Otog	A	G	7: 46,267,276	N879S	probably damaging	Het
Park2	A	G	17: 11,434,614	D199G	probably benign	Het
Pcsk7	T	A	9: 45,927,625	Y612N	probably damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Pgbd5	T	C	8: 124,434,011	D39G	probably benign	Het
Pkhd1l1	C	T	15: 44,505,185	Q800*	probably null	Het
Pkn3	T	C	2: 30,087,110	S621P	probably benign	Het
Polr3c	T	C	3: 96,715,185	I385V	probably benign	Het
Ppp1r21	G	T	17: 88,555,603	G257W	probably benign	Het
Pxylp1	C	T	9: 96,856,367		probably null	Het
Rasgrp1	T	C	2: 117,286,108	T613A	probably benign	Het
Robo3	C	T	9: 37,425,378	V387I	probably benign	Het
Rxfp2	T	A	5: 150,049,581	Y174N	possibly damaging	Het
Sec24a	T	C	11: 51,713,552	M746V	probably damaging	Het
Sema4f	T	A	6: 82,914,374	E571D	possibly damaging	Het
Sept3	T	C	15: 82,286,456	V217A	probably benign	Het
Serpinb1b	A	C	13: 33,093,565	K260N	probably benign	Het
Sin3b	A	G	8: 72,749,872	T645A	possibly damaging	Het
Sobp	C	T	10: 43,021,834	R585Q	probably damaging	Het
Specc1l	T	A	10: 75,246,447	L559Q	possibly damaging	Het
Srxn1	C	T	2: 152,105,653		probably benign	Het
Sspo	G	A	6: 48,455,860	R890Q	probably benign	Het
Stard9	A	G	2: 120,688,110	D505G	probably damaging	Het
Tjp1	A	T	7: 65,322,339	I653K	probably damaging	Het
Tnks	C	T	8: 34,831,712	E1296K	probably damaging	Het
Ttbk2	A	T	2: 120,748,640	I667N	probably benign	Het
Usp24	T	C	4: 106,342,353	S165P	possibly damaging	Het
Usp46	T	A	5: 74,028,937	K109*	probably null	Het
Vmn1r191	A	G	13: 22,178,772	C271R	probably benign	Het
Wisp3	T	A	10: 39,158,300	Y102F	probably damaging	Het
Zfp592	T	C	7: 81,023,452	S55P	probably damaging	Het
Zmynd15	T	C	11: 70,461,041	S158P	probably benign	Het
Zscan22	T	G	7: 12,906,737	C303G	probably damaging	Het

Other mutations in Mylk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01384:Mylk	APN	16	34938952	missense	probably benign	0.36
IGL01386:Mylk	APN	16	34971240	critical splice acceptor site	probably null
IGL01684:Mylk	APN	16	34971940	missense	possibly damaging	0.55
IGL01884:Mylk	APN	16	34988877	splice site	probably benign
IGL02079:Mylk	APN	16	34860631	missense	possibly damaging	0.87
IGL02104:Mylk	APN	16	34815435	missense	probably benign	0.06
IGL02624:Mylk	APN	16	34929896	missense	probably benign	0.29
IGL02756:Mylk	APN	16	34963646	missense	probably benign	0.42
IGL02794:Mylk	APN	16	34986541	missense	probably benign	0.21
IGL02833:Mylk	APN	16	34914900	missense	probably benign	0.01
IGL02946:Mylk	APN	16	34921788	missense	probably benign	0.10
IGL03012:Mylk	APN	16	34952781	missense	probably benign	0.03
IGL03093:Mylk	APN	16	34912192	missense	possibly damaging	0.62
IGL03272:Mylk	APN	16	34979189	missense	probably benign	0.09
billy	UTSW	16	34875620	missense	probably damaging	0.97
brutus	UTSW	16	34953695	missense	probably benign	0.12
Club	UTSW	16	34912275	nonsense	probably null
popeye	UTSW	16	34963577	missense	probably benign	0.29
F5770:Mylk	UTSW	16	34995204	critical splice donor site	probably null
P4717OSA:Mylk	UTSW	16	34977113	splice site	probably benign
PIT4382001:Mylk	UTSW	16	34875642	missense	probably damaging	0.99
R0131:Mylk	UTSW	16	34875504	missense	probably benign	0.03
R0309:Mylk	UTSW	16	34912297	splice site	probably benign
R0358:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0381:Mylk	UTSW	16	34784974	splice site	probably null
R0390:Mylk	UTSW	16	34875620	missense	probably damaging	0.97
R0413:Mylk	UTSW	16	34921944	missense	probably benign	0.01
R0536:Mylk	UTSW	16	35000387	missense	possibly damaging	0.95
R0544:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0545:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0546:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0547:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0548:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0627:Mylk	UTSW	16	35000429	missense	probably damaging	1.00
R0726:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0755:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0782:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0783:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0784:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R1136:Mylk	UTSW	16	35000318	missense	probably damaging	1.00
R1170:Mylk	UTSW	16	34874039	missense	probably benign	0.20
R1222:Mylk	UTSW	16	34860652	missense	probably benign	0.12
R1445:Mylk	UTSW	16	34815465	missense	possibly damaging	0.57
R1583:Mylk	UTSW	16	34875586	missense	probably benign	0.29
R1618:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R1643:Mylk	UTSW	16	34875635	missense	probably benign	0.03
R1702:Mylk	UTSW	16	34921944	missense	probably benign	0.00
R1776:Mylk	UTSW	16	34952782	missense	probably benign	0.16
R1865:Mylk	UTSW	16	34912230	missense	probably benign	0.03
R1975:Mylk	UTSW	16	34880303	splice site	probably null
R2016:Mylk	UTSW	16	34996817	missense	probably damaging	1.00
R2045:Mylk	UTSW	16	34953653	missense	probably benign	0.29
R2134:Mylk	UTSW	16	34986476	missense	probably benign	0.13
R3547:Mylk	UTSW	16	34880168	missense	possibly damaging	0.61
R3844:Mylk	UTSW	16	34921877	missense	probably benign	0.01
R4003:Mylk	UTSW	16	34963577	missense	probably benign	0.29
R4396:Mylk	UTSW	16	34912275	nonsense	probably null
R4470:Mylk	UTSW	16	34912152	missense	probably benign	0.09
R4507:Mylk	UTSW	16	34953695	missense	probably benign	0.12
R4700:Mylk	UTSW	16	34922435	missense	probably benign	0.16
R4751:Mylk	UTSW	16	34879169	missense	probably benign	0.29
R4815:Mylk	UTSW	16	34894925	missense	probably damaging	0.97
R4832:Mylk	UTSW	16	34922367	missense	probably benign	0.36
R4872:Mylk	UTSW	16	34914990	missense	possibly damaging	0.89
R4953:Mylk	UTSW	16	34988961	missense	probably damaging	1.00
R4969:Mylk	UTSW	16	34971440	missense	probably damaging	0.96
R5009:Mylk	UTSW	16	34899507	missense	probably benign	0.39
R5130:Mylk	UTSW	16	34988997	missense	probably damaging	1.00
R5173:Mylk	UTSW	16	34977013	missense	probably benign	0.40
R5195:Mylk	UTSW	16	34979215	missense	probably damaging	1.00
R5209:Mylk	UTSW	16	34922625	missense	possibly damaging	0.55
R5311:Mylk	UTSW	16	34921757	missense	probably benign	0.01
R5418:Mylk	UTSW	16	34912230	missense	probably benign	0.02
R5481:Mylk	UTSW	16	34921604	missense	probably benign	0.09
R5590:Mylk	UTSW	16	34879352	missense	probably benign	0.29
R5603:Mylk	UTSW	16	34956492	missense	probably benign	0.06
R5823:Mylk	UTSW	16	34894947	critical splice donor site	probably null
R6290:Mylk	UTSW	16	34894843	missense	probably benign	0.39
R6351:Mylk	UTSW	16	34921971	missense	probably benign	0.01
R6365:Mylk	UTSW	16	34860591	missense	probably benign	0.12
R6490:Mylk	UTSW	16	34929867	missense	possibly damaging	0.74
R6723:Mylk	UTSW	16	34929888	missense	possibly damaging	0.74
R6864:Mylk	UTSW	16	34874150	missense	probably benign	0.03
R6908:Mylk	UTSW	16	34880273	missense	probably benign	0.18
R6949:Mylk	UTSW	16	35000318	missense	probably damaging	1.00
R7018:Mylk	UTSW	16	35000426	missense	possibly damaging	0.88
R7035:Mylk	UTSW	16	34976982	missense	possibly damaging	0.89
R7162:Mylk	UTSW	16	34922529	missense	probably damaging	1.00
R7236:Mylk	UTSW	16	34922529	missense	probably damaging	1.00
R7269:Mylk	UTSW	16	34785011	missense	probably damaging	0.96
R7525:Mylk	UTSW	16	34988987	missense	probably benign	0.06
R7587:Mylk	UTSW	16	34922517	missense	probably benign	0.29
R7607:Mylk	UTSW	16	34894814	missense	probably benign	0.09
R7616:Mylk	UTSW	16	34879557	missense	probably damaging	0.97
R7647:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7648:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7764:Mylk	UTSW	16	34922183	missense	probably benign	0.16
R7890:Mylk	UTSW	16	34963648	nonsense	probably null
R7892:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7893:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R8065:Mylk	UTSW	16	34972019	missense	probably benign	0.08
R8067:Mylk	UTSW	16	34972019	missense	probably benign	0.08
R8143:Mylk	UTSW	16	34914155	missense	possibly damaging	0.87
R8210:Mylk	UTSW	16	35000351	missense	probably damaging	1.00
R8271:Mylk	UTSW	16	34922579	missense	probably damaging	0.97
R8540:Mylk	UTSW	16	34929887	missense	possibly damaging	0.87
R8721:Mylk	UTSW	16	34996806	missense	probably damaging	1.00
R8743:Mylk	UTSW	16	34921057	missense	probably benign	0.03
R8798:Mylk	UTSW	16	34899402	missense	possibly damaging	0.89
R8956:Mylk	UTSW	16	34971409	missense	probably benign	0.01
R9131:Mylk	UTSW	16	34956465	missense	probably benign	0.29
R9403:Mylk	UTSW	16	34875642	nonsense	probably null
R9624:Mylk	UTSW	16	34879307	missense	probably benign	0.29
R9735:Mylk	UTSW	16	34914809	missense	probably benign	0.09
R9756:Mylk	UTSW	16	34914017	missense	probably damaging	0.96
R9763:Mylk	UTSW	16	34879112	nonsense	probably null
RF001:Mylk	UTSW	16	34879371	missense	probably benign	0.03
V7580:Mylk	UTSW	16	34995204	critical splice donor site	probably null
V7583:Mylk	UTSW	16	34995204	critical splice donor site	probably null
X0065:Mylk	UTSW	16	35000441	missense	probably damaging	1.00
Z1177:Mylk	UTSW	16	34922651	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- CCCAGTGTTAACATTCTAAGTGC -3'
(R):5'- GACAGTGATCTGCCTCTGAG -3'

Sequencing Primer
(F):5'- CACAGTTGCTTCCTGGCTAGG -3'
(R):5'- TCTGAGGCTGCAGTGGGAC -3'

Posted On

2020-02-05