Incidental Mutation 'R7469:Cylc2'
ID628198
Institutional Source Beutler Lab
Gene Symbol Cylc2
Ensembl Gene ENSMUSG00000039555
Gene Namecylicin, basic protein of sperm head cytoskeleton 2
Synonyms4930488P18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7469 (G1)
Quality Score155.008
Status Validated
Chromosome4
Chromosomal Location51216678-51230272 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 51227970 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041392] [ENSMUST00000166749]
Predicted Effect probably null
Transcript: ENSMUST00000041392
SMART Domains Protein: ENSMUSP00000039750
Gene: ENSMUSG00000039555

DomainStartEndE-ValueType
Pfam:Cylicin_N 7 115 1.1e-43 PFAM
low complexity region 122 131 N/A INTRINSIC
low complexity region 174 220 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166749
SMART Domains Protein: ENSMUSP00000125758
Gene: ENSMUSG00000039555

DomainStartEndE-ValueType
Pfam:Cylicin_N 8 113 4.6e-46 PFAM
low complexity region 122 131 N/A INTRINSIC
low complexity region 174 220 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 338 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (77/79)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,368,188 L443P probably damaging Het
Abtb2 T C 2: 103,566,947 V74A probably benign Het
Adam5 A T 8: 24,815,525 F66I probably benign Het
Aff1 T A 5: 103,833,547 D517E probably benign Het
Agbl3 A G 6: 34,814,414 K559R probably damaging Het
Aldh1l2 A C 10: 83,508,105 V482G probably damaging Het
Ankra2 C T 13: 98,266,374 A43V probably benign Het
Ankrd50 C A 3: 38,454,193 V419F probably damaging Het
Arhgef16 G A 4: 154,291,306 T77M probably damaging Het
Best3 T C 10: 117,004,385 V240A probably damaging Het
Btbd7 T C 12: 102,812,768 Y413C probably damaging Het
Bzw2 A T 12: 36,107,551 V305E probably damaging Het
Cacng8 G A 7: 3,415,105 A258T possibly damaging Het
Cfap157 T C 2: 32,780,684 Y184C probably damaging Het
Chmp3 T A 6: 71,579,668 V184E possibly damaging Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Ctdspl2 A T 2: 122,006,881 E376D possibly damaging Het
Cyfip1 A G 7: 55,877,720 D200G possibly damaging Het
Cyp2c66 T A 19: 39,183,863 F407L probably damaging Het
Dcp2 T C 18: 44,395,952 F45L probably damaging Het
Dhx34 C T 7: 16,216,439 R268H probably benign Het
Dnajc7 A T 11: 100,591,551 M205K probably benign Het
Dzip3 C T 16: 48,944,879 V491M probably benign Het
Fam160a1 T C 3: 85,672,762 D712G probably benign Het
Farp1 T C 14: 121,275,421 L777P probably damaging Het
Fchsd2 T G 7: 101,278,656 probably null Het
Fer1l6 A T 15: 58,590,570 probably null Het
Fitm2 A G 2: 163,469,822 F157S probably damaging Het
Flt1 G T 5: 147,603,569 A770E probably damaging Het
Flt3 T A 5: 147,331,274 E967V probably benign Het
Foxc1 G C 13: 31,808,378 A391P unknown Het
Foxc1 C T 13: 31,808,379 A391V unknown Het
Gimap6 T A 6: 48,702,458 T215S probably benign Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Itpr3 T C 17: 27,121,054 S2636P possibly damaging Het
Lsg1 A G 16: 30,561,817 Y601H probably benign Het
Map4 G T 9: 110,027,797 probably null Het
Mga T C 2: 119,903,046 M125T probably damaging Het
Mxi1 A G 19: 53,371,660 D271G probably damaging Het
Ndst3 T A 3: 123,671,661 T221S possibly damaging Het
Neto1 T A 18: 86,498,688 S377T probably benign Het
Nkx6-2 T C 7: 139,581,639 E210G probably damaging Het
Nos2 G T 11: 78,952,971 V915F possibly damaging Het
Nrros G A 16: 32,144,212 A329V probably benign Het
Numb T C 12: 83,803,804 K211E probably benign Het
Nup210 T A 6: 91,018,892 I1671F probably benign Het
Olfr1183 T A 2: 88,461,347 H2Q probably benign Het
Olfr1204 T A 2: 88,852,503 D184E probably benign Het
Olfr530 G A 7: 140,373,137 L158F possibly damaging Het
Pcdh15 A T 10: 74,645,980 M386L probably benign Het
Pcdhb3 C A 18: 37,301,335 T118K probably benign Het
Pcdhb8 A T 18: 37,355,958 I230F probably damaging Het
Peli2 G A 14: 48,250,558 V120I probably benign Het
Pramef20 T A 4: 144,373,103 Q364L probably damaging Het
Pramel7 T A 2: 87,491,404 M96L probably benign Het
Prex2 T A 1: 11,285,069 S1531R probably damaging Het
Prpf31 A G 7: 3,633,393 T138A possibly damaging Het
Psme4 C T 11: 30,802,837 T175I probably benign Het
Rasgrf2 A G 13: 92,029,022 probably null Het
Rps19 T A 7: 24,889,765 *146K probably null Het
Rsu1 T C 2: 13,077,560 N260S probably benign Het
Serpina3k T C 12: 104,345,335 C391R not run Het
Sipa1l1 T G 12: 82,420,664 probably null Het
Snd1 T A 6: 28,626,127 Y394N probably damaging Het
Spaca4 A T 7: 45,725,407 V57E probably damaging Het
Spata31d1b A G 13: 59,715,464 Y142C probably benign Het
Sptbn2 A G 19: 4,745,118 K1535E probably benign Het
Srcin1 A G 11: 97,534,609 S541P probably damaging Het
Tc2n A T 12: 101,665,675 F308I probably damaging Het
Tdrd5 T C 1: 156,262,905 D857G probably benign Het
Timm22 A G 11: 76,407,308 D35G probably benign Het
Tram1l1 C A 3: 124,321,240 H16Q probably benign Het
Uggt1 T C 1: 36,151,733 Y1382C probably damaging Het
Usp32 G T 11: 84,988,553 D1443E possibly damaging Het
Uty A T Y: 1,131,072 C1046S possibly damaging Het
Wdr31 T A 4: 62,457,531 Q230L probably damaging Het
Wnt8b C A 19: 44,511,562 T196K possibly damaging Het
Xpo4 A T 14: 57,597,979 H628Q probably benign Het
Zfp780b C T 7: 27,963,957 S391N probably benign Het
Other mutations in Cylc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Cylc2 APN 4 51228157 missense probably damaging 1.00
IGL01669:Cylc2 APN 4 51228360 missense probably benign 0.01
IGL02662:Cylc2 APN 4 51216698 utr 5 prime probably benign
R0277:Cylc2 UTSW 4 51228477 missense unknown
R0323:Cylc2 UTSW 4 51228477 missense unknown
R0968:Cylc2 UTSW 4 51216706 start codon destroyed probably null 0.50
R1395:Cylc2 UTSW 4 51228366 missense possibly damaging 0.53
R1639:Cylc2 UTSW 4 51228310 missense probably benign 0.23
R1643:Cylc2 UTSW 4 51225173 missense probably benign 0.38
R2829:Cylc2 UTSW 4 51229798 missense unknown
R4464:Cylc2 UTSW 4 51229651 missense unknown
R4467:Cylc2 UTSW 4 51229651 missense unknown
R4496:Cylc2 UTSW 4 51229651 missense unknown
R4505:Cylc2 UTSW 4 51229651 missense unknown
R4514:Cylc2 UTSW 4 51229651 missense unknown
R4546:Cylc2 UTSW 4 51229651 missense unknown
R4546:Cylc2 UTSW 4 51229840 missense unknown
R4654:Cylc2 UTSW 4 51228279 missense probably benign 0.00
R4949:Cylc2 UTSW 4 51229804 missense unknown
R5141:Cylc2 UTSW 4 51228587 intron probably benign
R5176:Cylc2 UTSW 4 51228587 intron probably benign
R5177:Cylc2 UTSW 4 51228587 intron probably benign
R5179:Cylc2 UTSW 4 51228587 intron probably benign
R7508:Cylc2 UTSW 4 51229256 splice site probably null
Predicted Primers PCR Primer
(F):5'- TAAAGATCCTTTCCCAATCTGTTGGTG -3'
(R):5'- TCCATAATGGTGGTCTGTGAAC -3'

Sequencing Primer
(F):5'- CAATCTGTTGGTGGTCTTTTTGTC -3'
(R):5'- GTGGTCTGTGAACTCCTAATTTTTC -3'
Posted On2020-02-05