Incidental Mutation 'R7469:Map4'
ID628199
Institutional Source Beutler Lab
Gene Symbol Map4
Ensembl Gene ENSMUSG00000032479
Gene Namemicrotubule-associated protein 4
SynonymsMtap4, MAP 4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7469 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109931460-110083955 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to T at 110027797 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000165876]
Predicted Effect probably null
Transcript: ENSMUST00000035055
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165876
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and do not display any overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,368,188 L443P probably damaging Het
Abtb2 T C 2: 103,566,947 V74A probably benign Het
Adam5 A T 8: 24,815,525 F66I probably benign Het
Aff1 T A 5: 103,833,547 D517E probably benign Het
Agbl3 A G 6: 34,814,414 K559R probably damaging Het
Aldh1l2 A C 10: 83,508,105 V482G probably damaging Het
Ankra2 C T 13: 98,266,374 A43V probably benign Het
Ankrd50 C A 3: 38,454,193 V419F probably damaging Het
Arhgef16 G A 4: 154,291,306 T77M probably damaging Het
Best3 T C 10: 117,004,385 V240A probably damaging Het
Btbd7 T C 12: 102,812,768 Y413C probably damaging Het
Bzw2 A T 12: 36,107,551 V305E probably damaging Het
Cacng8 G A 7: 3,415,105 A258T possibly damaging Het
Cfap157 T C 2: 32,780,684 Y184C probably damaging Het
Chmp3 T A 6: 71,579,668 V184E possibly damaging Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Ctdspl2 A T 2: 122,006,881 E376D possibly damaging Het
Cyfip1 A G 7: 55,877,720 D200G possibly damaging Het
Cylc2 T A 4: 51,227,970 probably null Het
Cyp2c66 T A 19: 39,183,863 F407L probably damaging Het
Dcp2 T C 18: 44,395,952 F45L probably damaging Het
Dhx34 C T 7: 16,216,439 R268H probably benign Het
Dnajc7 A T 11: 100,591,551 M205K probably benign Het
Dzip3 C T 16: 48,944,879 V491M probably benign Het
Fam160a1 T C 3: 85,672,762 D712G probably benign Het
Farp1 T C 14: 121,275,421 L777P probably damaging Het
Fchsd2 T G 7: 101,278,656 probably null Het
Fer1l6 A T 15: 58,590,570 probably null Het
Fitm2 A G 2: 163,469,822 F157S probably damaging Het
Flt1 G T 5: 147,603,569 A770E probably damaging Het
Flt3 T A 5: 147,331,274 E967V probably benign Het
Foxc1 G C 13: 31,808,378 A391P unknown Het
Foxc1 C T 13: 31,808,379 A391V unknown Het
Gimap6 T A 6: 48,702,458 T215S probably benign Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Itpr3 T C 17: 27,121,054 S2636P possibly damaging Het
Lsg1 A G 16: 30,561,817 Y601H probably benign Het
Mga T C 2: 119,903,046 M125T probably damaging Het
Mxi1 A G 19: 53,371,660 D271G probably damaging Het
Ndst3 T A 3: 123,671,661 T221S possibly damaging Het
Neto1 T A 18: 86,498,688 S377T probably benign Het
Nkx6-2 T C 7: 139,581,639 E210G probably damaging Het
Nos2 G T 11: 78,952,971 V915F possibly damaging Het
Nrros G A 16: 32,144,212 A329V probably benign Het
Numb T C 12: 83,803,804 K211E probably benign Het
Nup210 T A 6: 91,018,892 I1671F probably benign Het
Olfr1183 T A 2: 88,461,347 H2Q probably benign Het
Olfr1204 T A 2: 88,852,503 D184E probably benign Het
Olfr530 G A 7: 140,373,137 L158F possibly damaging Het
Pcdh15 A T 10: 74,645,980 M386L probably benign Het
Pcdhb3 C A 18: 37,301,335 T118K probably benign Het
Pcdhb8 A T 18: 37,355,958 I230F probably damaging Het
Peli2 G A 14: 48,250,558 V120I probably benign Het
Pramef20 T A 4: 144,373,103 Q364L probably damaging Het
Pramel7 T A 2: 87,491,404 M96L probably benign Het
Prex2 T A 1: 11,285,069 S1531R probably damaging Het
Prpf31 A G 7: 3,633,393 T138A possibly damaging Het
Psme4 C T 11: 30,802,837 T175I probably benign Het
Rasgrf2 A G 13: 92,029,022 probably null Het
Rps19 T A 7: 24,889,765 *146K probably null Het
Rsu1 T C 2: 13,077,560 N260S probably benign Het
Serpina3k T C 12: 104,345,335 C391R not run Het
Sipa1l1 T G 12: 82,420,664 probably null Het
Snd1 T A 6: 28,626,127 Y394N probably damaging Het
Spaca4 A T 7: 45,725,407 V57E probably damaging Het
Spata31d1b A G 13: 59,715,464 Y142C probably benign Het
Sptbn2 A G 19: 4,745,118 K1535E probably benign Het
Srcin1 A G 11: 97,534,609 S541P probably damaging Het
Tc2n A T 12: 101,665,675 F308I probably damaging Het
Tdrd5 T C 1: 156,262,905 D857G probably benign Het
Timm22 A G 11: 76,407,308 D35G probably benign Het
Tram1l1 C A 3: 124,321,240 H16Q probably benign Het
Uggt1 T C 1: 36,151,733 Y1382C probably damaging Het
Usp32 G T 11: 84,988,553 D1443E possibly damaging Het
Uty A T Y: 1,131,072 C1046S possibly damaging Het
Wdr31 T A 4: 62,457,531 Q230L probably damaging Het
Wnt8b C A 19: 44,511,562 T196K possibly damaging Het
Xpo4 A T 14: 57,597,979 H628Q probably benign Het
Zfp780b C T 7: 27,963,957 S391N probably benign Het
Other mutations in Map4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Map4 APN 9 110072604 splice site probably benign
IGL01331:Map4 APN 9 110034801 missense probably benign 0.04
IGL01599:Map4 APN 9 110034768 missense probably benign 0.26
IGL01631:Map4 APN 9 110063133 unclassified probably benign
IGL02208:Map4 APN 9 109978870 start codon destroyed probably null 1.00
IGL02455:Map4 APN 9 109999833 missense probably benign 0.15
IGL02625:Map4 APN 9 110064417 missense probably damaging 1.00
PIT4486001:Map4 UTSW 9 110072614 missense probably damaging 1.00
R0149:Map4 UTSW 9 110067624 missense probably damaging 0.96
R0384:Map4 UTSW 9 110034628 missense probably damaging 0.99
R0392:Map4 UTSW 9 110078045 missense probably damaging 1.00
R0496:Map4 UTSW 9 110039850 intron probably benign
R0526:Map4 UTSW 9 110037278 splice site probably null
R0555:Map4 UTSW 9 109979103 splice site probably benign
R0571:Map4 UTSW 9 110036766 missense probably benign 0.00
R0698:Map4 UTSW 9 110068788 nonsense probably null
R0762:Map4 UTSW 9 110038478 intron probably benign
R0862:Map4 UTSW 9 109978969 missense probably damaging 1.00
R0864:Map4 UTSW 9 109978969 missense probably damaging 1.00
R1168:Map4 UTSW 9 110034964 missense probably benign 0.00
R1238:Map4 UTSW 9 110068580 missense probably benign 0.00
R1735:Map4 UTSW 9 110034955 missense probably benign 0.00
R1869:Map4 UTSW 9 110034964 missense probably benign 0.00
R1869:Map4 UTSW 9 110068928 missense possibly damaging 0.95
R2196:Map4 UTSW 9 110071048 missense probably damaging 1.00
R2264:Map4 UTSW 9 110081457 missense probably damaging 1.00
R2507:Map4 UTSW 9 110037483 intron probably benign
R2512:Map4 UTSW 9 110034702 missense possibly damaging 0.48
R3087:Map4 UTSW 9 110053189 missense possibly damaging 0.84
R3154:Map4 UTSW 9 109999792 missense probably benign 0.19
R3498:Map4 UTSW 9 110035212 missense probably benign 0.03
R3547:Map4 UTSW 9 110052198 missense possibly damaging 0.61
R3751:Map4 UTSW 9 110038674 intron probably benign
R4036:Map4 UTSW 9 110032215 missense possibly damaging 0.47
R4423:Map4 UTSW 9 110067594 missense probably damaging 1.00
R4505:Map4 UTSW 9 110032185 missense probably benign 0.01
R4561:Map4 UTSW 9 110052371 missense possibly damaging 0.91
R4577:Map4 UTSW 9 110081421 missense possibly damaging 0.48
R4601:Map4 UTSW 9 110052819 missense possibly damaging 0.75
R4795:Map4 UTSW 9 110035263 missense probably benign 0.00
R4801:Map4 UTSW 9 110035257 missense probably benign 0.15
R4802:Map4 UTSW 9 110035257 missense probably benign 0.15
R4999:Map4 UTSW 9 110038377 intron probably benign
R5020:Map4 UTSW 9 110068800 missense probably benign 0.02
R5021:Map4 UTSW 9 110038089 nonsense probably null
R5049:Map4 UTSW 9 110079814 nonsense probably null
R5451:Map4 UTSW 9 110037783 intron probably benign
R5452:Map4 UTSW 9 110037783 intron probably benign
R5453:Map4 UTSW 9 110037783 intron probably benign
R5492:Map4 UTSW 9 110052382 missense possibly damaging 0.68
R5532:Map4 UTSW 9 110034678 missense probably benign 0.24
R5602:Map4 UTSW 9 110052700 missense possibly damaging 0.84
R5628:Map4 UTSW 9 110081847 missense probably benign 0.04
R5896:Map4 UTSW 9 110072634 missense possibly damaging 0.91
R6017:Map4 UTSW 9 110034619 missense probably benign 0.00
R6084:Map4 UTSW 9 110064292 missense probably damaging 1.00
R6294:Map4 UTSW 9 110002746 missense possibly damaging 0.82
R6397:Map4 UTSW 9 110027716 missense possibly damaging 0.78
R6773:Map4 UTSW 9 110034925 missense probably benign 0.00
R6997:Map4 UTSW 9 110052914 missense probably benign 0.35
R7141:Map4 UTSW 9 109978870 start codon destroyed probably null 1.00
R7187:Map4 UTSW 9 110053133 missense probably benign 0.03
R7320:Map4 UTSW 9 110081517 missense probably benign 0.24
R7479:Map4 UTSW 9 110068824 missense possibly damaging 0.94
R7487:Map4 UTSW 9 110027715 missense probably damaging 1.00
R7690:Map4 UTSW 9 109999793 missense probably damaging 0.99
R7780:Map4 UTSW 9 110034652 missense probably benign 0.00
R7998:Map4 UTSW 9 110079861 missense probably damaging 1.00
R8028:Map4 UTSW 9 110068744 missense probably damaging 1.00
Z1177:Map4 UTSW 9 110068523 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGAAACAAGAGATAATTACCTTCCTAA -3'
(R):5'- CTTAGGTCCATGAGTACCTGCC -3'

Sequencing Primer
(F):5'- TTACCTTCCTAATTGTATTCACTGTG -3'
(R):5'- TGAACTCTGGACCTTCGGAAG -3'
Posted On2020-02-05