Incidental Mutation 'R7469:Fer1l6'
ID 628200
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1 like family member 6
Synonyms EG631797
MMRRC Submission 045543-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R7469 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 58381897-58536936 bp(+) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to T at 58462419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect probably null
Transcript: ENSMUST00000161028
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (77/79)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,259,014 (GRCm39) L443P probably damaging Het
Abtb2 T C 2: 103,397,292 (GRCm39) V74A probably benign Het
Adam5 A T 8: 25,305,541 (GRCm39) F66I probably benign Het
Aff1 T A 5: 103,981,413 (GRCm39) D517E probably benign Het
Agbl3 A G 6: 34,791,349 (GRCm39) K559R probably damaging Het
Aldh1l2 A C 10: 83,343,969 (GRCm39) V482G probably damaging Het
Ankra2 C T 13: 98,402,882 (GRCm39) A43V probably benign Het
Ankrd50 C A 3: 38,508,342 (GRCm39) V419F probably damaging Het
Arhgef16 G A 4: 154,375,763 (GRCm39) T77M probably damaging Het
Best3 T C 10: 116,840,290 (GRCm39) V240A probably damaging Het
Btbd7 T C 12: 102,779,027 (GRCm39) Y413C probably damaging Het
Bzw2 A T 12: 36,157,550 (GRCm39) V305E probably damaging Het
Cacng8 G A 7: 3,463,621 (GRCm39) A258T possibly damaging Het
Cfap157 T C 2: 32,670,696 (GRCm39) Y184C probably damaging Het
Chmp3 T A 6: 71,556,652 (GRCm39) V184E possibly damaging Het
Cst5 C T 2: 149,247,496 (GRCm39) L71F probably benign Het
Ctdspl2 A T 2: 121,837,362 (GRCm39) E376D possibly damaging Het
Cyfip1 A G 7: 55,527,468 (GRCm39) D200G possibly damaging Het
Cylc2 T A 4: 51,227,970 (GRCm39) probably null Het
Cyp2c66 T A 19: 39,172,307 (GRCm39) F407L probably damaging Het
Dcp2 T C 18: 44,529,019 (GRCm39) F45L probably damaging Het
Dhx34 C T 7: 15,950,364 (GRCm39) R268H probably benign Het
Dnajc7 A T 11: 100,482,377 (GRCm39) M205K probably benign Het
Dzip3 C T 16: 48,765,242 (GRCm39) V491M probably benign Het
Farp1 T C 14: 121,512,833 (GRCm39) L777P probably damaging Het
Fchsd2 T G 7: 100,927,863 (GRCm39) probably null Het
Fhip1a T C 3: 85,580,069 (GRCm39) D712G probably benign Het
Fitm2 A G 2: 163,311,742 (GRCm39) F157S probably damaging Het
Flt1 G T 5: 147,540,379 (GRCm39) A770E probably damaging Het
Flt3 T A 5: 147,268,084 (GRCm39) E967V probably benign Het
Foxc1 G C 13: 31,992,361 (GRCm39) A391P unknown Het
Foxc1 C T 13: 31,992,362 (GRCm39) A391V unknown Het
Gimap6 T A 6: 48,679,392 (GRCm39) T215S probably benign Het
Gm2431 A T 7: 141,811,518 (GRCm39) C129S unknown Het
Itpr3 T C 17: 27,340,028 (GRCm39) S2636P possibly damaging Het
Lsg1 A G 16: 30,380,635 (GRCm39) Y601H probably benign Het
Map4 G T 9: 109,856,865 (GRCm39) probably null Het
Mga T C 2: 119,733,527 (GRCm39) M125T probably damaging Het
Mxi1 A G 19: 53,360,091 (GRCm39) D271G probably damaging Het
Ndst3 T A 3: 123,465,310 (GRCm39) T221S possibly damaging Het
Neto1 T A 18: 86,516,813 (GRCm39) S377T probably benign Het
Nkx6-2 T C 7: 139,161,555 (GRCm39) E210G probably damaging Het
Nos2 G T 11: 78,843,797 (GRCm39) V915F possibly damaging Het
Nrros G A 16: 31,963,030 (GRCm39) A329V probably benign Het
Numb T C 12: 83,850,578 (GRCm39) K211E probably benign Het
Nup210 T A 6: 90,995,874 (GRCm39) I1671F probably benign Het
Or12j3 G A 7: 139,953,050 (GRCm39) L158F possibly damaging Het
Or4c106 T A 2: 88,682,847 (GRCm39) D184E probably benign Het
Or4c31 T A 2: 88,291,691 (GRCm39) H2Q probably benign Het
Pcdh15 A T 10: 74,481,812 (GRCm39) M386L probably benign Het
Pcdhb3 C A 18: 37,434,388 (GRCm39) T118K probably benign Het
Pcdhb8 A T 18: 37,489,011 (GRCm39) I230F probably damaging Het
Peli2 G A 14: 48,488,015 (GRCm39) V120I probably benign Het
Pramel15 T A 4: 144,099,673 (GRCm39) Q364L probably damaging Het
Pramel7 T A 2: 87,321,748 (GRCm39) M96L probably benign Het
Prex2 T A 1: 11,355,293 (GRCm39) S1531R probably damaging Het
Prpf31 A G 7: 3,636,392 (GRCm39) T138A possibly damaging Het
Psme4 C T 11: 30,752,837 (GRCm39) T175I probably benign Het
Rasgrf2 A G 13: 92,165,530 (GRCm39) probably null Het
Rps19 T A 7: 24,589,190 (GRCm39) *146K probably null Het
Rsu1 T C 2: 13,082,371 (GRCm39) N260S probably benign Het
Serpina3k T C 12: 104,311,594 (GRCm39) C391R not run Het
Sipa1l1 T G 12: 82,467,438 (GRCm39) probably null Het
Snd1 T A 6: 28,626,126 (GRCm39) Y394N probably damaging Het
Spaca4 A T 7: 45,374,831 (GRCm39) V57E probably damaging Het
Spata31d1b A G 13: 59,863,278 (GRCm39) Y142C probably benign Het
Sptbn2 A G 19: 4,795,146 (GRCm39) K1535E probably benign Het
Srcin1 A G 11: 97,425,435 (GRCm39) S541P probably damaging Het
Tc2n A T 12: 101,631,934 (GRCm39) F308I probably damaging Het
Tdrd5 T C 1: 156,090,475 (GRCm39) D857G probably benign Het
Timm22 A G 11: 76,298,134 (GRCm39) D35G probably benign Het
Tram1l1 C A 3: 124,114,889 (GRCm39) H16Q probably benign Het
Uggt1 T C 1: 36,190,814 (GRCm39) Y1382C probably damaging Het
Usp32 G T 11: 84,879,379 (GRCm39) D1443E possibly damaging Het
Uty A T Y: 1,131,072 (GRCm39) C1046S possibly damaging Het
Wdr31 T A 4: 62,375,768 (GRCm39) Q230L probably damaging Het
Wnt8b C A 19: 44,500,001 (GRCm39) T196K possibly damaging Het
Xpo4 A T 14: 57,835,436 (GRCm39) H628Q probably benign Het
Zfp780b C T 7: 27,663,382 (GRCm39) S391N probably benign Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58,534,636 (GRCm39) missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58,430,251 (GRCm39) missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58,509,763 (GRCm39) splice site probably null
R0304:Fer1l6 UTSW 15 58,462,411 (GRCm39) missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58,420,187 (GRCm39) missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58,509,943 (GRCm39) critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58,430,257 (GRCm39) splice site probably null
R0602:Fer1l6 UTSW 15 58,449,794 (GRCm39) missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58,534,784 (GRCm39) splice site probably null
R0669:Fer1l6 UTSW 15 58,425,573 (GRCm39) splice site probably null
R0854:Fer1l6 UTSW 15 58,431,037 (GRCm39) missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58,435,924 (GRCm39) missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R1483:Fer1l6 UTSW 15 58,509,819 (GRCm39) missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58,513,728 (GRCm39) missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58,518,930 (GRCm39) missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58,429,718 (GRCm39) missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58,497,080 (GRCm39) missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R2041:Fer1l6 UTSW 15 58,430,155 (GRCm39) missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2145:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2981:Fer1l6 UTSW 15 58,435,926 (GRCm39) missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58,431,087 (GRCm39) missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58,518,998 (GRCm39) missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58,499,371 (GRCm39) missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58,498,129 (GRCm39) critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58,512,075 (GRCm39) missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58,425,554 (GRCm39) missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58,512,060 (GRCm39) missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58,449,798 (GRCm39) missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58,490,751 (GRCm39) missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58,509,869 (GRCm39) missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58,472,160 (GRCm39) critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58,443,250 (GRCm39) missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58,515,769 (GRCm39) missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58,512,003 (GRCm39) missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58,422,126 (GRCm39) missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58,453,752 (GRCm39) nonsense probably null
R5561:Fer1l6 UTSW 15 58,532,674 (GRCm39) missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58,430,175 (GRCm39) missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58,494,331 (GRCm39) missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58,443,238 (GRCm39) missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58,462,399 (GRCm39) nonsense probably null
R5823:Fer1l6 UTSW 15 58,462,352 (GRCm39) nonsense probably null
R5892:Fer1l6 UTSW 15 58,435,917 (GRCm39) missense probably benign
R6006:Fer1l6 UTSW 15 58,518,893 (GRCm39) missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58,431,055 (GRCm39) missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58,509,806 (GRCm39) missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58,432,488 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,509,855 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,497,026 (GRCm39) nonsense probably null
R6271:Fer1l6 UTSW 15 58,513,767 (GRCm39) missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58,431,081 (GRCm39) nonsense probably null
R6784:Fer1l6 UTSW 15 58,443,275 (GRCm39) missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58,466,727 (GRCm39) missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58,501,227 (GRCm39) missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58,435,899 (GRCm39) missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58,447,146 (GRCm39) missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58,462,384 (GRCm39) missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58,499,446 (GRCm39) missense probably benign
R7463:Fer1l6 UTSW 15 58,445,450 (GRCm39) nonsense probably null
R7464:Fer1l6 UTSW 15 58,445,096 (GRCm39) splice site probably null
R7483:Fer1l6 UTSW 15 58,513,794 (GRCm39) missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58,472,281 (GRCm39) missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58,509,875 (GRCm39) missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58,432,331 (GRCm39) missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58,430,245 (GRCm39) missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58,499,438 (GRCm39) missense probably benign
R7607:Fer1l6 UTSW 15 58,534,581 (GRCm39) nonsense probably null
R7677:Fer1l6 UTSW 15 58,474,139 (GRCm39) missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58,502,486 (GRCm39) missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58,432,345 (GRCm39) missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58,414,012 (GRCm39) missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58,455,329 (GRCm39) missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58,502,594 (GRCm39) missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58,515,715 (GRCm39) missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58,494,230 (GRCm39) missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58,490,766 (GRCm39) missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58,429,759 (GRCm39) missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58,490,370 (GRCm39) missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58,422,113 (GRCm39) missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58,497,098 (GRCm39) missense probably benign
X0021:Fer1l6 UTSW 15 58,441,051 (GRCm39) nonsense probably null
X0027:Fer1l6 UTSW 15 58,501,189 (GRCm39) missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58,490,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAATAGGGTCCATGTTTGC -3'
(R):5'- GCCCAGCATGTTTGAAGAAATTC -3'

Sequencing Primer
(F):5'- GCTTTCTGGTGATAAAAGAGTCTTCC -3'
(R):5'- CCAGCATGTTTGAAGAAATTCACCTC -3'
Posted On 2020-02-05